... the following statement: I swear by Apollo the physician, and Asclepius, and Hygieia and acea and all the gods and goddesses as my witnesses, that, according Pan-to my ability and judgement, I ... 5Afford-bankrupt Expanding access to healthcare isn’t a blue state value or a red state value; it’s an American value ”Other evidence also indicates that commitment to healthcare for all is part ... political issues associated with healthcare, which are often abundant and perplexing Keywords: human rights—study & teaching; right to health care; probit analysis; human rights-based approach;
Ngày tải lên: 25/10/2022, 03:19
... was from QIAGEN (Hilden, Germany) Restriction endonucleases were purchased from Takara Bio (Shiga, Japan) and Toyobo (Osaka, Japan) Butyl SepharoseTM 4 Fast Flow was from GE Healthcare DEAE-Toyopearl ... gene was amplified using KOD -plus- DNA polymerase (Toyobo) with primers 5´-CACCATGAGTAAAATTAGAATTGGG-3´ (forward) and 5´-TAAAAGTTCTTTTCTTAAATCTTCTGGAG-3´ (reverse), and then cloned using a ChampionTM ... 7thermosphaericus strain A1 The enzyme was then purified from the thermophile and characterized as a thermostable meso-DAPDH, and the gene was sequenced Trang 8Materials and methods Materials An
Ngày tải lên: 20/06/2014, 23:20
Báo cáo y học: "Clinicians'''' evaluations of, endorsements of, and intentions to use practice guidelines change over time: a retrospective analysis from an organized guideline program" doc
... Ontario, Canada and 4 Sunnybrook Hospital, Toronto, Ontario, Canada Email: Melissa Brouwers* - mbrouwer@mcmaster.ca; Steven Hanna - hannas@mcmaster.ca; Mona Abdel-Motagally - abdelmm@mcmaster.ca; ... (favouring females) (p = 0.034) and a significant time by gender Table 2: Six-year mean, year one mean, and annual change in quality, endorsement and intention scores Domain (Score Range) Mean ... by an established cancer CPG program; and evaluate how clini-cian characteristics and cliniclini-cian beliefs and attitudes are associated with these trends Methods Context The Cancer Care Ontario
Ngày tải lên: 11/08/2014, 05:21
báo cáo khoa học: " Clinicians'''' evaluations of, endorsements of, and intentions to use practice guidelines change over time: a retrospective analysis from an organized guideline program" pot
... Ontario, Canada and 4 Sunnybrook Hospital, Toronto, Ontario, Canada Email: Melissa Brouwers* - mbrouwer@mcmaster.ca; Steven Hanna - hannas@mcmaster.ca; Mona Abdel-Motagally - abdelmm@mcmaster.ca; ... (favouring females) (p = 0.034) and a significant time by gender Table 2: Six-year mean, year one mean, and annual change in quality, endorsement and intention scores Domain (Score Range) Mean ... by an established cancer CPG program; and evaluate how clini-cian characteristics and cliniclini-cian beliefs and attitudes are associated with these trends Methods Context The Cancer Care Ontario
Ngày tải lên: 11/08/2014, 16:20
báo cáo khoa học: " Molecular characterization of a rice mutator-phenotype derived from an incompatible cross-pollination reveals transgenerational mobilization of multiple transposable elements and extensive epigenetic instability" ppt
... Tong211-LP and its progenies, a set of variable AFLP and MSAP bands were isolated, cloned and sequenced (see Additional file 3) It was found that all variable bands were chromosomal DNA sequences ... studies have established that the intrinsic DNA methylation patterns in both plants and animals are faith-fully maintained and perpetuated by coordinated func-tion of at least two classes of DNA methyltransferases ... normalization against a rice β-actin gene (Genbank accession X79378) The gene names are labeled * and ** denote statistical significance at the 0.05 and 0.01 levels, respectively Trang 9type and
Ngày tải lên: 12/08/2014, 03:20
Báo cáo y học: " Detection of epithelial to mesenchymal transition in airways of a bleomycin induced pulmonary fibrosis model derived from an α-smooth muscle actin-Cre transgenic mouse" potx
... GAAGATCTATGCCCAAGAAGAAGAGGAAGGTGTC-CAATTTACTGAC-3' and reverse 5'-CGGAATTCT-GAACAAACGACCCAAC-3' The PCR product was then sub-cloned into the BamHI-EcoRI site of the VSMP8 plas-mid (a gift of Professor Art ... sc-7870), rabbit anti-mouse/human E-cadherin pAb was purchased from Boster Company (Cat BA0475) GAPDH mAb was purchased from Chemi-con (Cat CB1001) SeChemi-condary antibodies of goat anti-rab-bit pAb ... Zhuang Wu†1, Leilei Yang†2, Lin Cai1, Min Zhang1, Xuan Cheng2, Xiao Yang*2 and Jun Xu*1 Address: 1 Guangzhou Institute of Respiratory Disease, First Affiliated Hospital of Guangzhou Medical
Ngày tải lên: 12/08/2014, 16:20
Báo cáo y học: " A method to estimate the efficiency of gene expression from an integrated retroviral vector" potx
... are NI2F cacacacaaggctgacttccct-3') and NI2R (5'-gccactccccagtccgccc-3') The primers used to detect the ampicillin resistant gene are AmpF (5'-gataacactgcg-gccaactt-3') and AmpR (5'-ttgccgggaagctagagtaa-3') ... unintegrated species The latter can be excluded by using a selectable marker To survive and proliferate in an antibiotic, a cell must express the appropriate antibiotic resistance gene, and pass ... 2.5 units of Taq DNA polymerase (Sigma) and an appropriate amount of DNA template In PCR for LTR, 5% DMSO (Sigma) was used as an enhancer The reaction was made up to 50 µl with water The primers
Ngày tải lên: 13/08/2014, 09:20
Báo cáo sinh học: " Introgression of a major QTL from an inferior into a superior population using genomic selection" pdf
... adjacent markers was calculated as the standardized chi-square, χ2' [8,9] Within each base population, average calculated and expected [10] LD for adjacent markers (expectation based on actual ... disease resistance Compared with pure genomic selection, gene-assisted selection had an advantage with respect to disease resistance (28–40% increase in genetic gain) and acted as an extra precaution ... chromosomes assuming the Haldane mapping function and a Mendelian inheritance of all loci For each chromo-some, 500 marker loci were assumed, as well as 100 QTL per trait (PT and DR) Markers and QTL
Ngày tải lên: 14/08/2014, 13:21
three extensions to the inventory theoretic approach- a transportation selection model, a discrete event simulation of the inventory theoretic approach, postponement from an inventory theoretic perspective
... optimization models can handle a wide variety of variables, easily accommodate additional constraints, and guarantee the optimal answer given valid assumptions and accurate data In contrast to ... Freight have advertised an ocean guarantee less-than-container-load (LCL) service from Hong Kong to Chicago offering eighteen days transit with a standard deviation of half a day (Clancy and Hoppin ... variable, and nonlinear) In addition, they efficiently handle a wide variety of variables, constraints are easily added or changed, and they guarantee the optimal answer given valid assumptions and accurate
Ngày tải lên: 02/11/2014, 00:50
Giáo án TD 8 Tài A Xing
... chia nhóm luyện tâp GV quan sát sửa động tác sai GV quan sát và nhận xét khả năng tiếp thu của HS Giáo án Thể Dục 8 Năm học 2010-2011 4 Trang 5III Phần kết thúc: 1 Nhận xét: Ưu khuyết điểm của ... thấp-chạy lao -chạy giữa quãng Trang 22GV Nguyễn Tấn Tài Trường PTCS A XINGa Khởi động chung: Chạy nhẹ nhành 3 vòng sân trường.Các động tác: tay cao, tay ngực, lườn, vặn mình và 2.Kiểm tra bài củ ... của bài thể dục IV/ Tiến Trình Lên Lớp: Trang 13 b.Khởi động chuyên môn: 2.Kiểm tra bài củ: GV gọi 2 em lên thực hiện động tác -Xuất phát cao chạy nhanh 30m-60m -Giáo viên cho học sinh chạy nhanh
Ngày tải lên: 09/05/2015, 08:00
Giáo án Tiếng Anh 9 Unit 1: A visit from a pen pal
... Sam Son beach/ West Lake/LeNin Park/ restaurants II/ Listen and read 1/ Read and answer True or False? Trang 3* If he/she visits HaNoi, what will you introduce him/her? Lan has a pen pal and ... things Ba did last week Now you work in pairs study the table and make similar dialogue about Nga's, Lan's, Nam's and Hoa's weekend * Who can read the dialogues? - Listen and correct Lan and her ... Ps read the dialogue again Listen and speak Keys: A: 1B: cA: 5B: bA: 4B: dA: 2B: eA: 3B: aA: 6 b- Make similar dialogue Trang 7* Who's can speak?4/ Post-speaking - Guide Ps to play the game "Who
Ngày tải lên: 28/08/2016, 16:37
Giáo án Tiếng Anh 9 Unit 1: A visit from a pen pal
... Nga is taking to Maryam - Matching and ordering the conversion between - Nga and Maryam - Hang extra board on ; ask Ss to work in pairs to match Trang 5 Call match.- Let Ss order the dialogue ... Play-Much Ado … Sunday/ 7 p.m T ask ss to read the model conversation and look at the table about Thao, Huong , Lam …activies work in pairs (about each person’s activity) Let ss ask and answer ... this map ? - How many parts are there in Malaysia ? -Which country are next to Malaysia ? 2 Pre Reading * Introduce using the map of malaysia a) Pre- teach : Vocabulary Comprise (v) Example
Ngày tải lên: 28/08/2016, 16:39
Giáo án Tiếng Anh 9 Unit 1: A visit from a pen pal
... / No, I haven’t - I went to Dalat/Da Nang - By train - Yes, I did - Yes, I did - Answer the questions 1 Now, I’m visiting my friend in Danang city 2 Lan met me at Danang airport at Trang 17s 2 ... to make a complete dialogue Practise the dialogue in pairs Ask and answer the questions in pairs: Trang 6s 02m s Ask some questions to check student’s understanding: * Questions: a Have Nga and ... action that happened in definite time in the past * Pronunciation: Ask Ss to work in pairs to ask and answer the questions about what Ba, Nga, Lan, Nam and hoa did on the weekend ( Exercise 1/ Page
Ngày tải lên: 28/08/2016, 16:39
Giáo án Tiếng Anh 9 Unit 1: A visit from a pen pal
... Myanmar, Thailand, Brunei Capital: Ha Noi, Kuala Lumpur, Singapore, Trang 7Jakarta, Manila, Vientiane, Phnom Penh,Yangun,Bangkok, Bandar Seri Begawan * Pre-reading : -T introduces the reading by using ... names of countries of ASIAN and other group write the namea of capitals of Asian countries -S answer Country: Viet Nam, Malaysia, Singapore, Indonesia, Philipines, Laos, Cambodia, Myanmar, Thailand, ... to the table on page 10 ) B : You’re Maryam, from Malaysia You have to answer A’s questions about your country. 7 Bahasa Malaysia 8 English * Answer : b) 1 T 2 F ( There are more than two religions.)
Ngày tải lên: 28/08/2016, 16:40
Giáo án Tiếng Anh 9 Unit 1: A visit from a pen pal
... Liverpool Australia Perth Japan Bombay Myanmar Rendar Seri (Begauan) India Kualar Lumpur England Rangoon Malaysia 2 Vocabulary. - (to) introduce (sit) giới thiệu - pleased (adj) ... city: (Kuala Lumpur) 6 Official religion: (Islam) 7 National language: (Bahasa Malaysia) 8.Compulsory secondary language: (English) IV Homework: - Reread and translate the text into Vietnamese ... be able to get more reading practice to understand the text about Lan and her pen pal Maryam’s a visit to Ha Noi and know a new structure with “ wish” can’t happen at present and future • Teaching
Ngày tải lên: 28/08/2016, 16:42
Giáo án Tiếng Anh 9 Unit 1: A visit from a pen pal
... that Tim is talking Carlos to visit Trang 9Ask Ss to listen to the tape to check their guesses Give feedback: Ask Ss to work in pairs to ask and answer questions about what Ba, Nga, Lan, Nam and ... ?B: yes , certainly A: What language is spken in your country ?B: Bahasa Malaysia English, Chinese, and Tamil are also widely spoken A: Do children have to study any foreign language in school ... delicious, and the sights are so beautiful I will leave Da Nang at 2 am/ 7 pm … next Thursday? Sunday…and will arrive home at 11 pm / 5 am … please pick me up at the airport / bus station / train station…
Ngày tải lên: 28/08/2016, 16:43
Giáo án Tiếng Anh 9 Unit 1: A visit from a pen pal
... about Malaysia - T asks “What do you know about Malaysia - T asks sts to read the passage silently and underline the new words - T explains new word (translation method) - Sts answer (in Vietnamese) ... Reading the passage in silently an underline the new word - Listening to the explanation Trang 9While-reading - T reads the passage and students listen and find the right information about Malaysia ... Vocabulary: Some words relating to capitals and big cities in the word, especially in Asia III Techniques: Asking and answering – Pair work – Role play – Matching IV Teaching aids: Pictures, cassette
Ngày tải lên: 28/08/2016, 16:44
Giáo án Tiếng Anh 9 Unit 1: A visit from a pen pal
... map on the board and explains the game - T gives some information - Ss guess what that country is - T says “ Today we will learn about Malaysia, a member country of Asian.” * Change into passive ... 2ms) 1 WARM UP : GUESSING GAME 1/ This country borders with Laos and Cambodia It has many tourist attractions The major cities are Bangkok, Chang Mai What country is it? ( Thai lan ) 2/.It ... Association of South East Asian ( ASEAN ), II LANGUAGE CONTENTS: Grammar: - The simple present ( review),- The simple past ( review) Vocabulary: - Association of South East Asian Nations (n) - Divide
Ngày tải lên: 28/08/2016, 16:44
How people acquire knowledge from a web page: An eye tracking study
... messages faster from visuals Image-rich learning material can reach more students and teach them more quickly and meaningfully than traditional text-based learning material A large body of research ... user behaviour is not the same when facing a text-only page versus an illustrated one Visual Teaching Alliance (http://visualteachingalliance.com/) and e.g Burmark (2002) argue that people transmit ... multimedia learning model, the verbal information and pictorial information are processed by two sensory channels: the auditory channel and the visual channel (Mayer, 2014; Wang, Tsai, & Tsai,
Ngày tải lên: 10/01/2020, 11:02
Elevated tumor necrosis factor-a-induced protein 8-like 2 mRNA from peripheral blood mononuclear cells in patients with acute ischemic stroke
... Forward CTCAGCAACTTCAACCCG Reverse GCACTTGGAGGCAGCCCG NF-kB Forward CACAGATACCACTAAGACGCACC Reverse GACCGCATTCAAGTCATAGTCC IL-6 Forward ACCCCTGACCCAACCACAAAT Reverse AGCTGCGCAGAATGAGATGAGTT ... Forward ATGCTTCGAGATCTCCGAGA Reverse AAATCGATGACAGCGCCGTA IL-1β Forward AAACAGATGAAGTGCTCCTTCCAGG Reverse TGGAGAACACCACTTGTTGCTCCA β-actin Forward ATGGGTCAGAAGGATTCCTATGTG Reverse CTTCATGAGGTAGTCAGTCAGGTC ... Forward GGAACATCCAAGGCAAGACTG Reverse AGCACCTCACTGCTTGTCTCATC TNF-α Forward AAGCCTGTAGCCCATGTTGT Reverse CAGATAGATGGGCTCATACC IFN-γ Forward GCAGAGCCAAATTGTCTCCT Reverse ATGCTCTTCGACCTCGAAAC AP-1
Ngày tải lên: 15/01/2020, 04:08