successive study of a contextual ar game

... deformation characteristics of a permeable capsule for various physical parameters, 3 extend the IIM approach to study the adhesion and detachment of a permeable capsule adhered onto a rigid planar ... capsule is away from the walls; (b) initial non-adhesive capsule is near a wall; (c) initial adhesive capsule is near a wall, Wad = 20 µJ/m2; (d) initial adhesive capsule is near a wall, Wad = 40 ... Trang 1A NUMERICAL STUDY OF A PERMEABLE CAPSULE UNDER STOKES FLOWS BY THE IMMERSED INTERFACE METHOD PAHALA GEDARA JAYATHILAKE NATIONAL UNIVERSITY OF SINGAPORE 2010 Trang 2A NUMERICAL STUDY

Ngày tải lên: 11/09/2015, 09:15

... The rapid expansion of roads also depleted large areas of agricultural land, particularly in eastern China where population density was high and the economy was fast land management Capital construction ... had taken place at the expense of agricultural land and unused land, among which the loss of cultivated or arable land (gengdi) was most acute Based on an analysis of the 1996 nation-wide land ... government.2 As of 2007, China’s arable land per capita had fallen to 1.39 mu or 0.093 hectare, which is only a third of the world’s average.3 The depletion of agricultural land was accompanied by a rise

Ngày tải lên: 14/09/2015, 14:11

... that industrialization, indicated by the area of industrial land and development zones, caused the expansion in non-agricultural land use Similarly, the use of “urban built-up area” as an explanation ... ensures that land use change can be carried out with relatively few obstructions Yet the bargaining power of peasants against local cadres also varies with local conditions, some of which are mentioned ... area and industrial land, are not appropriate for analyzing the causes of non-agricultural land use Lin, for one, suggests that “a city-centred urban sprawl at the top and a dispersed rural-based

Ngày tải lên: 14/09/2015, 14:11

... year: 1) A cash reward of 50,000 yuan for a tax contribution of one million yuan and above 2) A cash reward of 80,000 yuan for a tax contribution of three million yuan and above 3) A cash reward ... reward of 50,000 yuan for a tax contribution of one million yuan and above 2) A cash reward of 80,000 yuan for a tax contribution of three million yuan and above 3) A cash reward of 150,000 yuan ... 30,000 yuan for an investment of 30 million yuan and above 2) A cash reward of 50,000 yuan for an investment of 50 million yuan and above 3) A cash reward of 80,000 yuan for an investment of 100

Ngày tải lên: 14/09/2015, 14:14

... the Longwan ceramic industrial park includes orchards, fish ponds and arable land in eight of Xiamao’s natural villages.23 Moreover, the total area of the three industrial parks in Xiamao is 11,510 ... development; award for attracting foreign capital; award for exceeding the quota in attracting businesses and investment.15 Xiamao town was one of the few danwei that received a total of four awards, a ... total land area is agricultural land, of which arable land makes up 23.5 percent and forests 51.6 percent Capital farmland constitutes 28,800 mu or more than 80 percent of the total arable land

Ngày tải lên: 14/09/2015, 14:14

... that the government’s pro-urbanization growth strategy has narrowed the rural-urban income gap In 2001, a Sihui worker’s average annual salary was 9,763 yuan while that of a farmer is 4,376 yuan ... yuan As of 2004, the average annual salary of a worker had risen to 16,096 yuan, more than three times that of a farmer’s at 4,961 yuan.6 Moreover, there is also the question of how necessary and ... reason for land expropriation 4 Integrate city planning with the land use master plan at each level, align the time-frame of the plans and adopt a standard set of criteria in forecasting land

Ngày tải lên: 14/09/2015, 14:14

... processes such as marketing, financial accounting, and human resource management (e.g Baan) (Kumar & van Hillegersberg, 2000; Markus & Tanis, 2000) ERP systems are an amalgam of these different ... scope, as software entrepreneurs developed integrated software packages in which multiple functional applications shared a common database to meet organizational information-processing needs (Markus ... (Kremers & van Dissel, 2000) Having a number of smaller software versions is also easier to support as compared to a large variety of products (Kremers & van Dissel, 2000) Regular upgrading

Ngày tải lên: 26/09/2015, 09:57

... For photocatalytic reactions, trapped charge carrier diffusion is as important as charge carrier trapping because the trapped charge carriers must diffuse to the surface to react Charge carrier ... made to narrow the band gap of TiO2 by doping Quite a number of metal dopants have been evaluated such as Fe (Sclafani et al., 1993), Cr Trang 31(Borgarello et al., 1982), Mo and V (Luo et al., ... in a neutral solution was reported by Rangaraju et al.: 0.74mA cm-2 at 0.2V vs Ag/AgCl (about 1.23V vs RHE) It was attributed to the presence of nano-dendrites and vertically oriented nano-channels;

Ngày tải lên: 26/09/2015, 10:05

... observation that ants and vascular plants have ecological parallels (Andersen, 1991) Vascular plants generally have similar ecological requirements and strategies in that individuals are situated ... floor (Andersen, 1995) Opportunist ants were similarly abundant because they are able to establish themselves in disturbed habitats and are often the most abundant ants in large cleared areas of ... that there exists a negative linear relationship between the proportional abundance of Opportunist ants and the age of a tropical rain forest Proportional abundance was defined as the ratio of

Ngày tải lên: 29/09/2015, 13:01

... CGCGGATCCAATGGACTACAAAGACGATGAC GACAAGAGCATAGTGATCCCA M5b_NotI.rev AAGGAAAAAAGCGGCCGCCAATATACGCGA GACTAGTCTT GFP- MLL5β M5b_SalI.for ACGCGTCGACATGAGCATAGTGATCCCATTG M5b_BamHI.rev CGCGGATCCCAATATACGCGAGACTAGTCTT ... UUCUCCGAACGUGUCACGUdTdT Antisense ACGUCACACGUUCGGAGAAdTdT MLL5 #1 (1063) Sense CGCCGGAAAAGGGAAAAUAdTdT Antisense UAUUUUCCCUUUUCCGGCGdTdT MLL5 #2 (1147) Sense GCAUUUCAGCAUACUCCAAdTdT Antisense ... human cervix, the narrow portion of the uterus that connects the lower part of uterus to the upper part of vagina Two main forms of cervical cancers are squamous cell carcinoma, accounting for around

Ngày tải lên: 02/10/2015, 17:15

... brand items such as handbags and clothes (Cho, 2008) In addition, physical appearance and fashion are important to Koreans; they place priority on their appearance and are spending increasing amounts ... matter of this, but also have a highly distinctive attitude and analytical stance towards the social world (Goffman, 1967) According to Adler, Adler, and Fontana (1987), Goffman suggests an analysis ... <alt,coffee> The members of the newsgroup speak using terms that are unfamiliar to outgroup people: baristas, JavaJocks, cremas and roastmasters, tampers and superautomatics, livias and

Ngày tải lên: 05/10/2015, 22:16

... “NP(patient) +V-qilai +(ADV) +AP/VP”。For traditional linguists, descriptive and comparative analysis are important to find the difference an similaritiesis of middle construction between English and ... FOR THE DEGREE OF MASTER OF ARTS DEPARTMENT OF CHINESE STUDIES NATIONAL UNIVERSITY OF SINGAPORE Trang 2现 代 汉 语 “ NP（ 受 事 ） +状 +V” 中 动 句 式 研 究 The Study of a Kind of Contemporary Chinese Middle ... Studies from NUS and PKU for accepting my application for this double M A research programmer Many thanks also to many other teachers from both National University of Singapore and Peking University,

Ngày tải lên: 12/10/2015, 17:34

... bodies Special thanks go to Chak Li Ling, Tan Jee Hian, Allan and to Dr Maria D Serafica for their invaluable assistance in Illumina Microarray experiment and data analysis I am also grateful to ... Hybridization, wash and scan of Illumina microarray 2.7.4 Bioinformatics data analysis of Illumina microarray 2.8 Quantitative Real-time PCR (qRT-PCR)   3 Results 3.1 SAGE data analysis to search for pluripotency ... populations 1.2 Transcriptome studies of human ES cells 1.2.1 DNA Microarray DNA microarray is a multiplex detection and characterization technology based on DNA and complementary DNA (cDNA)

Ngày tải lên: 16/10/2015, 11:58

... (through a large ramp for container trucks), private loading areas and car parks The ramp has to be wide enough to accommodate the turning radius of 40-ft trucks and large access roads have to ... solving land scarcity, building such a large vehicular ramp requires an extensive land area and large capital cost A better alternative system is one that delivers the containers to the various ... a German manufacturer of marine cranes and mining material handling, has developed an automated system design specifically for intermodal rail terminals (but can be adapted for marine terminals)

Ngày tải lên: 26/11/2015, 12:46

... degree of saturation Ssat Saturated degree of saturation Sres Residual saturation T Temperature TA Transmissivity of aquifer V Maximum shear at final excavated depth in parametric study Vo Maximum ... Maximum shear at final excavated depth using basic parameters z Depth α An auxiliary model parameter in Hardening-Soil model αc Coefficient of thermal expansion of concrete αr Radio of radial earth ... Trang 1NUMERICAL STUDY OF A LARGE DIAMETER SHAFT IN OLD ALLUVIUM TAN RWE YUN NATIONAL UNIVERSITY OF SINGAPORE 2004 Trang 2NUMERICAL STUDY OF A LARGE DIAMETER SHAFT IN OLD ALLUVIUM TAN RWE

Ngày tải lên: 27/11/2015, 11:19

... secondary indicators affecting smaller; radar analysis can be further found that every athlete's physical strengths, weaknesses factors; gap between diagnosis can be based on physical indicators athlete's ... of Pareto Law, radar analysis and target challenge model method Pareto cut set method can identify the few but for volleyball fitness play a decisive role, but the majority of key indicators and ... special physical evaluation, research with the team, the test data of the indicators, using SPSS13.0, Microsoft Excel software for data Statistical Analysis The purpose is to build the "Vietnam

Ngày tải lên: 13/05/2016, 16:36

... probability of rockfall Avoidance alternatives are often more costly than stabilization and protection alternatives However, appar-ently they are safer than others Particularly, avoidance alternatives ... freeze-thaw) took 73% of the failures and 14% was attributed to earthquakes Generally, there are many causes of rockfall, most of them relate to tal factors Particularly, the causes related to water are ... N., Wakizaka Y (2002) The Detailed Hazard Map of Road Slopes in Japan Public Works Research Institute, Japan Sasiharan, N., Muhunthan, B., Badger, T., Shu, S., & Carradine, D (2006) cal analysis

Ngày tải lên: 21/05/2016, 23:07

... which are addressed are positioned outside and cross-cut the various disciplinary areas Additionally, since higher education addresses general features of teaching and learning, research and knowledge ... Professor Chika Sehoole, Professor Max Bergman, Mrs Zinette Bergman, Professor Michael Cross, Professor Olugbenga Adedeji, Mr Mark Sandham, Baba Bankole, Professor & Dr Jimoh Pedro, Alaagba ... [which may be] described and evaluated quantitatively This assesses how much was learned, as tested, for example, by recall of details, while qualitative evaluation addresses the quality of learning,

Ngày tải lên: 12/12/2016, 20:23

... because of a low sample fraction and that some years the effect of the weather are higher Defoliation data should be shown in complementary tables not in balances Defoliation data are only available ... area is artificially regenerated To this should originally naturally regenerated but later beeted area of about 10-15 percent of total area be added The beeting is a result of not approved natural ... year period, since sample errors for annual data can be higher than annual changes ( special for area changes and growth) Defoliation data are not presented in the balances but in complementary...

Ngày tải lên: 08/03/2014, 08:20

... steady-state value after a small transient phase, with the disappearance rate of NADH varying in parallel In contrast, the system cannot reach a steady state in the second case (Fig 1B), as the ... cleaning of the column), and the presence of an small amount of ADP and AMP due to a contamination of ATP and NADH standard solutions (data not shown) It can be seen that at the end of the reaction, ... E, Varon R & Garc a- Carmona F (1997) Mathematical model for the determination of an enzyme activity based on enzymatic amplication by substrate cycling Anal Chim Acta 346, 215221 Valero E & Garc...

Ngày tải lên: 30/03/2014, 10:20