mpeg b part 4 and mpeg c part 4

slide 1 matching 1 present simple 2 “be going to” 3 past simple 4 present perfect 5 present progressive a to talk about the future b with “since” or “for” c to show changes with “get” and “become”

slide 1 matching 1 present simple 2 “be going to” 3 past simple 4 present perfect 5 present progressive a to talk about the future b with “since” or “for” c to show changes with “get” and “become”

... the box B - The box A is the box B - The box A is the - The box A is the box B box B - The box B is the box C - The box B is the box C (10)-The box ... -The box A is as big asas big as the box B. the box B. -The box A is -The box A is the same asthe same as the box B. the box B. -The box B is -The box B is different fromdifferent from the box ... talk about the future a (to) talk about the future b with “since” or “for” b with “since” or “for” c (to) show changes with c (to) show changes with “get” and “become” “get” and “become”

Ngày tải lên: 20/04/2021, 11:38

14 30 0
Hsk standard course 4下 (workbook b) part 1

Hsk standard course 4下 (workbook b) part 1

... TA RB? ATs V #Jt BAR Hin Sy PO RULIE wer Bic PRE TA SR FS BK Trang 6Wriurt M1 Xã RENE SAHA 48t Pal area Ril4R#/8f91H BURR mi x24%Xiùbl9Muã BARR wœ—h Trang 7 ese 4 (FB) Ye I — Ba i BBS MWB COD) ... fli⁄E-Bñl4 LiÃF AFR, READ K, (ATA DORA MER AES © kA RATER : A XTRA B BR PE C Bante hae 7 D B#4§0# 7ƒ Trang 11* RGA, BAe “BEE” 2 * XB EB A AMARA B GARR C SRIRAM D FABEP AIT 42-43 WUE, A A, ACAEMIAM, ... REB A? 35 HERA CHINE KB, WARIS TTA ABI 5, hi Ah * AGRE, ATRIA EB: I73A7 ALS, RESTS, BT SMe Be, BA Bice hm AULA, HABA SRR ERR! xit†tA E8 Ï : A 2X B IDR CHRP DSA HE BD 38 LAB ABIME, RAMEE 80 409A,

Ngày tải lên: 14/10/2022, 22:38

53 4 0
Hsk standard course 4下 (workbook b) part 2

Hsk standard course 4下 (workbook b) part 2

... ERU: %W ẽ C Bite D @WTMBG 40-41 + BREA, BFF: 58 Trang 12§A WHữM B RET C JAMA D JfffR7 9A HUẾ B MA C A4#h D k#W 12 A Heat B 4X C #iWf##1t D HBR 62 Trang 1363Trang 14A”“l# B# Ci# DER EAH ... l6 A ALG B Zjl#>»# C /#ñfäX D 48 17 A BRET B Bie C TM D SAFE 18 A Abia B RUBE C 8k D AlHjA^£ 103 Trang 54SESH FELL ZS Bel SSM CHE BAEKTrang 55we 3ñ Ora EEL RUS RS CRE aa xế ... EY B REIT C HAY D #jliH> / 11, A 3M €1 BAMHI C ace D #&8##7 12 A AAW B UTA C AEH D yar Zeb TA] 13, A Wi B +hIG C =†7ú Ú =t—n 14 A 3% B #Zlf C AL D W#ñ 5 A iÑ⁄ B EM C T8

Ngày tải lên: 14/10/2022, 22:51

67 3 0
Safe Blood Transfusion- Screening for Hepatitis B and Hepatitis C Virus Infections in Potential Blood Donors in Rural Southeast Asia

Safe Blood Transfusion- Screening for Hepatitis B and Hepatitis C Virus Infections in Potential Blood Donors in Rural Southeast Asia

... chronic HBV infection, HBsAg and anti-HBc IgG generally persist for life and HBV DNA can be detected by nucleic acid amplification The presence of HBsAg and the absence of IgM anti-HBc also indicate ... probably the main cause of HBV TTID and blood donors with the presence of HBV DNA and absence of HBsAg, the so-called “Occult Hepatitis B Infection - OBI” can be infective [11] This will be described ... surface antigen Anti-HCV Antibodies to Hepatitis C cccDNA Covalently Closed Circular DNA CMIA Chemiluminescent Microparticle Immunoassay HBeAg Hepatitis B Envelope antigen HBsAg Hepatitis B surface

Ngày tải lên: 03/03/2015, 21:05

64 466 0
Development of direct asymmetric aldol reactions mediated by primary amino acid derived organocatalysts  exploring DNA cleaving activities of varacin b and varacin c

Development of direct asymmetric aldol reactions mediated by primary amino acid derived organocatalysts exploring DNA cleaving activities of varacin b and varacin c

... 140 4.2.1 Catalyst Design 140 4.2.2 Synthesis of Catalysts 141 4.3 Results and Discussion 143 4.3.1 Catalyst Screening 143 4.3.2 Additives 144 4.3.3 Effects of Solvents 145 4.3.4 Scope ... reaction 140 Scheme 4-2 Organocatalysts designed in this chapter 141 Scheme 4-3 Synthetic route for catalysts 4-7a-d, 4-8a-b and 4-9a-c 142 Scheme 4-4 Synthesis of 2-hydroxy-γ-butyrolactones ... 150 Scheme 5-1 Structures of varacin, varacin A, varacin B and varacin C 193 Scheme 5-2 Proposed mechanism of DNA cleavage by varacin C 194 Scheme 5-3 Synthesis of varacin B and varacin C

Ngày tải lên: 14/09/2015, 08:39

282 174 0
DSpace at VNU: Measurements of the branching fractions for B(s)→D (s)πππ and Λb0→Λc+πππ

DSpace at VNU: Measurements of the branching fractions for B(s)→D (s)πππ and Λb0→Λc+πππ

... Borghi,47A Borgia,52T J V Bowcock,48C Bozzi,16 T Brambach,9J van den Brand,24J Bressieux,38D Brett,50S Brisbane,51M Britsch,10T Britton,52N H Brook,42 H Brown,48A Bu¨chler-Germann,39I Burducea,28A Bursche,39J ... Baldini,16R J Barlow,50C Barschel,37S Barsuk,7 W Barter,43A Bates,47C Bauer,10Th Bauer,23A Bay,38I Bediaga,1K Belous,34I Belyaev,30,37E Ben-Haim,8 M Benayoun,8G Bencivenni,18S Benson,46J Benton,42R Bernet,39M.-O ... Carson,36K Carvalho Akiba,23G Casse,48M Cattaneo,37M Charles,51 Ph Charpentier,37N Chiapolini,39K Ciba,37X Cid Vidal,36G Ciezarek,49P E L Clarke,46,37M Clemencic,37 H V Cliff,43J Closier,37C Coca,28V Coco,23J

Ngày tải lên: 16/12/2017, 01:19

19 143 0
Summary of the Doctoral thesis: Study on chemical constituents and biological activities of litsea glutinosa (lour). C. B. Rob. (lauraceae) and lepisanthes rubiginosa (roxb.) Leenh. (sapinda

Summary of the Doctoral thesis: Study on chemical constituents and biological activities of litsea glutinosa (lour). C. B. Rob. (lauraceae) and lepisanthes rubiginosa (roxb.) Leenh. (sapinda

... Botanical characteristics, chemical constituents, and biological activities of some selected species in the genus Litsea Lam 1.2 Botanical characteristics, chemical constituents and biological activities ... β-D-glucopyranose is binded to C-3 of oleanolic acid, which + 13 C-3 17 is evidenced by the HMBC correlations between H-1’ (δ 4.49) and C-3 (δ 92.31; H-3 (δ 3.23) and C-1’ (δ 105.55); H-1’ (δ 4.49) and C-2’ ... 9.5 Hz) and C-1’’ (δC 110.93) The α-D-galactopyranose is connected to β-Dglucopyranose at C-4’, indicating by the HMBC correlations from H-1’’’ (δH 5.24) to C-4’ (δC 82.13) and C-1’’’ (δC 105.38)

Ngày tải lên: 10/01/2020, 06:54

26 61 0
Summary of the Doctoral thesis: Study on chemical constituents and biological activities of litsea glutinosa (lour). C. B. Rob. (lauraceae) and lepisanthes rubiginosa (roxb.) Leenh. (sapinda

Summary of the Doctoral thesis: Study on chemical constituents and biological activities of litsea glutinosa (lour). C. B. Rob. (lauraceae) and lepisanthes rubiginosa (roxb.) Leenh. (sapinda

... glutinosa and L rubiginosa 1.1 Botanical characteristics, chemical constituents, and biological activities of some selected species in the genus Litsea Lam 1.2 Botanical characteristics, chemical constituents ... 1MINISTRY OF EDUCATION AND TRAINING VIETNAM ACADEMY OF SCIENCE AND TECHNOLOGY GRADUATE UNIVERSITY FOR SCIENCE AND TECHNOLOGY - PHAM THI NINH STUDY ON CHEMICAL CONSTITUENTS AND BIOLOGICAL ACTIVITIES ... (Lour.) Roxb (BL01, BL05- BL10, BL12- BL16, BL19-BL21) Trang 16Table 3.10: Cytotoxic activity of the compounds BL01- BL11, isolated from Thua Thien Hue sample Compound IC 50 (g/ml) KB Hep G-2

Ngày tải lên: 17/01/2020, 06:58

26 83 0
Ebook Comprehensive textbook of hepatitis B: Part 1

Ebook Comprehensive textbook of hepatitis B: Part 1

... HBV vaccine, the WHO hasrecommended that all countries continue their hepatitis B vaccine programs.be completed with either monovalent HBV vaccine or a combination vaccinecontaining HBV vaccine ... transfusion-associated transmission of HBV, screening HBc and nucleic acid testing (NAT) can be considered in addition to HBsAg forscreening blood donors However, the practical values of anti-HBc and NAT ... population can be excluded through screening with unspecificanti-HBc test and the implementation of NAT is hampered by the cost Nosocomial HBV infection can be also prevented by HBV vaccination

Ngày tải lên: 22/01/2020, 05:24

172 47 0
Ebook Comprehensive textbook of hepatitis B: Part 2

Ebook Comprehensive textbook of hepatitis B: Part 2

... IN HBV AND HCV COINFECTION Patients with dual active HBV and HCV coinfection (HBV DNA + and HCV RNA +) progress to cirrhosis and patients decompensed rapidly It is observed HBV and HCV Coinfection ... C virus coinfection Annals of Clinical Microbiology and Antimicrobials 2005;4:13doi:10.1186/1476-0711-4-13 Soriano V, Barreiro P, Nuñez M Management of chronic hepatitis B and C in HIVcoinfected ... monoinfected patients PATTERNS OF HBV AND HCV COINFECTION The subgroups of coinfection are seen on Table 17.1 Acute HBV and HCV Coinfection Mimms and colleagues studied on incidents that have acute

Ngày tải lên: 23/01/2020, 05:26

180 33 0
Giáo án Tiếng Anh 7 Unit 9: At home and away - Lesson 6: B 3 – 4

Giáo án Tiếng Anh 7 Unit 9: At home and away - Lesson 6: B 3 – 4

... đồ thị hµm sè f(x) víi yªu cÇu chÝnh x¸c ë: + Các khoảng đơn điệu + Các điểm đặc biệt :cực trị, giao với các trục toạ độ + ... lời câu hỏi mục tiêu đạt bước khảo sát  Giáo án Giải tích 12 Chương trình chuẩn Lop12.net Hoạt động giáo viên - Tổ chức cho học sinh ... số Cách khảo sát hàm số đa thức bậc ba - Lµm bµi tËp 1, 4, 5, trang 43-44 sgk TiÕt 15 KiÓm tra bµi cò: CH: Khảo sát biến

Ngày tải lên: 01/04/2021, 03:24

18 28 0
tuçn 4 tuçn 4 thø ngµy th¸ng n¨m tëp ®äc nh÷ng con sõu b»ng giêy ls thõ giíi i môc tiªu §äc tr«i ch¶y l­u lo¸t toµn bµi ®äc ®óng tªn ®þa lý n­íc ngoµi biõt ®äc diôn c¶m bµi v¨n tè c¸o téi ¸c chi

tuçn 4 tuçn 4 thø ngµy th¸ng n¨m tëp ®äc nh÷ng con sõu b»ng giêy ls thõ giíi i môc tiªu §äc tr«i ch¶y l­u lo¸t toµn bµi ®äc ®óng tªn ®þa lý n­íc ngoµi biõt ®äc diôn c¶m bµi v¨n tè c¸o téi ¸c chi

... đúng các bài tập 3 Giáo dục: H/s ý tích cực, tự giác, tính cẩn thận, chính xác trong học toán II/ Chuẩn bị: III/ Hoạt động dạy - học: 1 Tổ chức : Lớp hát. 2 Kiểm tra bài cũ : - 1, em chữa bài ... giờ trớc trên bảng, Gv nhận xét. 3 Bài mới : a Giới thiệu bài ghi bảng. b Giảng bài mới * Luyện tập: * Bài 1: + Y/c h/s đọc bài toán, nêu cách tóm tắt và cách giải + Cho h/s tự làm bài và chữa ... Hiểu ý nghĩa của bài: Kêu gọi đoàn kết chống chiến tranh, bảo vệ cuộc sống bình yên của các dân tộc - GD h/s yêu hoà bình, chống lại chiến tranh II Đồ dùng dạy học: - Tranh minh hoạ, bảng phụ ghi

Ngày tải lên: 10/04/2021, 12:45

24 10 0
tuçn 1 tuçn 1 m«n tin häc líp 4 tiõt sè 1 tªn bµi ¤n l¹i c¸c kióu ch÷ vµ fonts ch÷ trong word i môc tiªu häc sinh nhí l¹i c¸c quy t¾c gâ ch÷ tiõng viöt cã dêu víi kióu vni vµ telex ii §å dïng häc tëp

tuçn 1 tuçn 1 m«n tin häc líp 4 tiõt sè 1 tªn bµi ¤n l¹i c¸c kióu ch÷ vµ fonts ch÷ trong word i môc tiªu häc sinh nhí l¹i c¸c quy t¾c gâ ch÷ tiõng viöt cã dêu víi kióu vni vµ telex ii §å dïng häc tëp

... dụng các công cụ có sẵn để sao chép hình. * Sao chép cả hình nền : - B1: Click vào biểu tợng hoặc chọn rồi di chuột kéo đờng bao quanh hình cần sao chép - B2: ấn phím Ctrl + di chuyển chuột ... Gäi 1 häc sinh lªn b¶ng nªu c¸c bíc Trang 27Tuần: 10Môn: Tin học lớp 4 - Tiết số: 19 I Mục đích - Học sinh nhớ lại các công cụ vẽ hình đã đợc học ở chơng II - Hs sử dụng kết hợp các công cụ vẽ ... học lớp 4 - Tiết số: 13I Mục tiêu - Học sinh biết tác dụng của việc sao chép các đối tợng khi làm việc trên máy tính - Thực hiện đợc thao tác sao chép một phần hình vẽ  GV nhắc lại các công cụ

Ngày tải lên: 11/04/2021, 13:31

84 4 0
vat ly 8 i ph©n phèi ch­¬ng tr×nh vët lý 8 tuçn tiõt bµi d¹y 1 1 bµi 1 chuyón ®éng c¬ häc 2 2 bµi 2 vën tèc 3 3 bµi 3 chuyón ®éng ®òu – chuyón ®éng kh«ng ®òu 4 4 bµi 4 bióu diôn lùc 5 5 bµi 5 sù c©n b

vat ly 8 i ph©n phèi ch­¬ng tr×nh vët lý 8 tuçn tiõt bµi d¹y 1 1 bµi 1 chuyón ®éng c¬ häc 2 2 bµi 2 vën tèc 3 3 bµi 3 chuyón ®éng ®òu – chuyón ®éng kh«ng ®òu 4 4 bµi 4 bióu diôn lùc 5 5 bµi 5 sù c©n b

... 6) Bài 4 Biểu diễn lực A Mục tiêu - Nêu đợc ví dụ thể hiện lực tác dụng làm thay đổi vận tốc - Nhận biết đợc lực là đại lợng vectơ Biểu diễn đợc véc tơ lực B Chuẩn bị Nhắc HS xem lại bài Lực – ... đợc ví dụ thể hiện lực tác dụng làm thay đổi vận tốc Trang 8- Nhận biết đợc lực là đại lợng vectơ Biểu diễn đợc véc tơ lựcB Chuẩn bị Nhắc HS xem lại bài Lực – Hai lực cân bằng ( SGK Vật lí 6) C ... cho trớc - Véc tơ lực đợc kí hiệu bằng chữ F :F Học bài theo SGK, Làm bài tập trả lời câu hỏi trong SBT Nghiên cứu trớc bài học tiếp theo Bài 5 sự cân bằng lực Quán tính A Mục tiêu (cha sửa

Ngày tải lên: 11/04/2021, 16:14

26 19 0
Báo cáo khoa học: Proteomic identification of all plastid-specific ribosomal proteins in higher plant chloroplast 30S ribosomal subunit PSRP-2 (U1A-type domains), PSRP-3a/b (ycf65 homologue) and PSRP-4 (Thx homologue) doc

Báo cáo khoa học: Proteomic identification of all plastid-specific ribosomal proteins in higher plant chloroplast 30S ribosomal subunit PSRP-2 (U1A-type domains), PSRP-3a/b (ycf65 homologue) and PSRP-4 (Thx homologue) doc

... 5¢-CGGGATC CGGTGGCGACGACTCCTGGAGCCC-3¢; PR, 5¢-CG GGATCCCAACTGGTAATGGTAGCGACCGGC-3¢; P2-1, 5¢-ATGGAYATHGCIACIACICARGC-3¢; P2-2, 5¢-TAGCAACTCATTCGTCACTGTC-3¢; P2-3, 5¢-GGA ATTCTAGATATCGTCGACAATTTGTGTTACTACC ... 5¢-CAGATAGGAAGAGGG GCAAGGA-3¢; P4-3, 5¢-GGAATTCTAGATATCGTC GACTTATCTTCAGAACTTGTTGC-3¢; P4 -4, 5¢-GGA ATTCGTCGACGCGTTTTTCAACAAATCATCATAT A-3¢; TAG1, 5¢-GGAATTCTAGATATCGTCG-3¢; TAG2, 5¢-GGAATTCGTCGACGCG-3¢ ... ATTCTAGATATCGTCGACAATTTGTGTTACTACC AAAATC-3¢; P2 -4, 5¢-GGAATTCGTCGACGCGTTAA AAAAGATAGCAGCATTGACAC-3¢; P3-1, 5¢-ATGG GIAAYGARGTIGAYATHG-3¢; P3-2, 5¢-CTAGACC TATGTTTTTCTCCATCC-3¢; P4-1, 5¢-CCIAARAAYA ARAAYAARGG-3¢; P4-2,...

Ngày tải lên: 17/03/2014, 09:20

16 530 0
w