... Bodies 133 5.9 Scattering by the Assembly of Particles 141 5.10 Effective Dielectric Permittivity of Medium 145 5.11 The Acting Field 148 5.12 Incoherent Scattering by Electrons 150 5.13 Radiowave ... Approximation 268 9.11 Small-Angle Approximation 270 Chapter 10 General Problems of Remote Sensing 275 10.1 Formulation of Main Problem 276 10.1.1 Radar 277 10.1.2 Scatterometer 277 10.1.3 Radio ... as: (1.16)The divergence of this density is described by the transport equation: The value: (1.18)describes the mean for the period losses of the electromagnetic power density, and (1.19) is the
Ngày tải lên: 11/08/2014, 21:21
... and the one held in the morning The afternoon sun slanted in from the other side of the platform and most of the children, feeling too late the smart of sunburn, had put their clothes on The ... the tribe of hunters The lord they serve inhabits their own being If they turn with relief from the burdens of the platform, it is because they cannot transcend the limitations of their own nature ... satirizes the Christian as well as the rationalist point of view In Lord of the Flies, for example, the much discussed last chapter offers none of the traditional comforts A fable, by virtue of its
Ngày tải lên: 29/04/2016, 21:56
The loss of innocence metaphors in the catcher in the rye and lord of the flies from cognitive perspective
... signifying the theme of innocence, or the loss of innocence, are collected in the two 1950s’ novels There are 14 expressions in The Catcher in the Rye and 10 from Lord of the Flies They are the contemplations, ... innocence in the two novels The Catcher in the Rye (1951) and Lord of the Flies (1954), in the light of cognitive semantics The data are investigated within the framework of Lakoff and Johnson’s ... towards the young have compelled such a powerful case of loss of innocence that has inspired this research 3.2.2 William Golding’s Lord of the Flies (1954) Lord of the Flies is the 1954’s debut of
Ngày tải lên: 29/08/2021, 09:28
The loss of innocence metaphors in the catcher in the rye and lord of the flies from cognitive perspective
... William Golding’s Lord of the Flies (1954) Lord of the Flies is the 1954’s debut of Nobel Prize–winning British author William Golding The novel tells the story of a group of schoolboys who ... 2003, Lord of the Flies was voted number 70 on BBC’s The Big Read In 2005, Time hailed it as one of the 100 best English-language novels from 1923 to 2005 Conrad (2011) regards Lord of the Flies ... Incorporating these elements strategically can improve the effectiveness of metaphors in conveying themes and emotions within the story. 4.4.1.2 In Lord of the Flies In *Lord of the Flies*, William
Ngày tải lên: 21/08/2023, 00:49
MANAGING THE RISKS OF PAYMENT SYSTEMS CHAPTER 1 pps
... Section 107 or 108 of the 1976 United States Copyright Act, without either the prior written sion of the Publisher, or authorization through payment of the appropriate per- copy fee to the Copyright ... Procedures 130 Trang 12Chapter 6 Risks of Automated Clearing House Payments 141 Origination of ACH Entries 144 Warranties and Liabilities of the ODFI 150 Reversing Duplicate and Erroneous Files 155 ... Inc., 111 River Street, Hoboken, NJ 07030, 201- 748-6011, fax 201-748-6008, e-mail: permcoordinator@wiley.com. Limit of Liability/Disclaimer of Warranty: While the publisher and author have used their
Ngày tải lên: 02/07/2014, 16:21
An Outline of the history of economic thought - Chapter 1 pdf
... 1 The Birth of Political Economy 1.1. Opening of the Modern World 1.1.1. The end of the Middle Ages and scholasticism The feudal economy rose from the ashes of the slave economy of the Roman ... of the good. And it is not clear whether the propositions concerning the value of the goods are of natural law, as suggested by the theory of the bonitas intrinseca, or should be reduced to the ... disputes around the middle of the fourteenth century, which in turn led to a vast number of theories on the new forms of usury and the problem of the moral legitimacy of profits made on the finance
Ngày tải lên: 06/07/2014, 04:20
Dissertation summary: Foster working capacity of political instructors in the district military commanding committee of the Military Region 1 today
... many difficulties 1.1.2. Working capacity of the political instructors in the district military commanding committee of Military Region 1 1.1.2.1. Conception on the working capacity of the political instructors ... in the district military commanding committee of Military Region 1 1.1.1.1. Overview of the Military Region 1’s situation To prepare for a prolonged resistance war against the aggression of colonialism and imperialism, on October 16, 1945, President Ho Chi Minh signed a decree to establish 12 War Zones, including Military Region 1 ... Trang 11. Overview of the thesis The topic "Foster working capacity of political instructors in the district military commanding committee of the Military Region 1 today",
Ngày tải lên: 16/01/2020, 08:11
Bài Tập Lớn 2 THE LORD OF THE RINGS: THE TWO TOWERS pdf
... là (777_1) Ví dụ 16: Với dữ liệu nhập là 18211 11239 -8883 Trước khi gặp Saruman ở sự kiện thứ 3, cây nhị phân hiện hành là (821_1 (123_9 N)) Khi gặp Saruman, hiệp sĩ có số hiệu 821 gần với ... liệu nhập là 11231 12345 19994 -9985 10565 Khi Gandalf đến Khu rừng Fangorn, cây nhị phân hiện hành đang là (123_1 (N 234_5)), như vậy khi duyệt theo thứ tự RNL sẽ là [234_5, 123_1] Sau đó Gandalf ... tạo, bao Ví dụ 21: Với dữ liệu nhập là 18901 11345 18884 -8338 10690 Khi vị tiên Legolas đến Khu rừng Fangorn, cây nhị phân hiện hành đang là (890_1 (134_5 N)), như vậy khi duyệt theo thứ tự LNR
Ngày tải lên: 22/03/2014, 15:20
Báo cáo khoa học: Regulation of translational efficiency by different splice variants of the Disc large 1 oncosuppressor 5¢-UTR potx
... compilation ª 2 011 FEBS A L Cavatorta et al 8 9 10 11 12 13 14 15 16 17 18 and differentiation of human intestinal epithelial cells J Biol Chem 279, 10 157 10 166 Assemat... S, Satheesha ... Farmace ´ uticas, Suipacha 531, 2000 Rosario, Argentina Fax: +54 341 4390645 Tel: +54 341 4350661 E-mail: gardiol@ibr.gov.ar (Received 23 January 2011, revised 1 May 2011, accepted 17 May 2011) doi:10.1111/j.1742-4658.2011.08188.x Human ... GGAAGCAAGGTGAGAGTTTAT +1 –56 +9 +73 +137 +201 5’UTR DLG Large ATG 191162 43+1–36 –27 –11 G F3 +35 +54 R Exon C Exon A Exon B 5’UTR DLG Short ATG 191 162 R 43+1 G –36–56 –27 –22 +35 +173 F4 F5 R3 Exon C –11 Exon
Ngày tải lên: 22/03/2014, 16:20
Báo cáo khoa học: The C-terminal region of the proprotein convertase 1⁄ 3 (PC1⁄ 3) exerts a bimodal regulation of the enzyme activity in vitro pdf
... Chem 272, 15184–15188 17 Muller L & Lindberg I (1999) The cell biology of the prohormone convertases PC1 and PC2 Prog Nucleic Acid Res Mol Biol 63, 69–108 18 Khan AR & James MN (1998) Molecular ... convertases 1 or 2 J Biol Chem 269, 17440– 17447 11 Lusson J, Benjannet S, Hamelin J, Savaria D, Chretien M & Seidah NG (1997) The integrity of the RRGDL sequence of the proprotein convertase PC1 is ... expressing the recombinant mPC1⁄ 3, the presence of the 87 kDa form in excess of the 66⁄ 71 kDa facilitates isolation of the enzyme and helps in maintaining the enzymatic activity at a proper level The
Ngày tải lên: 30/03/2014, 08:20
Báo cáo khoa học: The C-terminal region of CHD3/ZFH interacts with the CIDD region of the Ets transcription factor ERM and represses transcription of the human presenilin 1 gene pot
... (end points at 1801 and 1810 not shown) Unlike the effects on PS1 transcription (Fig 6A), further deletions with end points at amino acids 1810, 1818, 1830, 839, 1851 and 1861 did not affect interactions ... together with 3 lg of either pC1 vector or pC1.CHD3 Various fragments of CHD3 protein expressed from pC1.CHD3 include amino acids 295–1717, 1005–2000, 1327–2000 and 1676–2000 The relationship of ... Fort Worth, TX 76107, USA Fax: +1 817 735 2091 Tel: +1 817 735 5448 E-mail: hdas@hsc.unt.edu (Received 8 August 2006, revised 2 January 2007, accepted 9 January 2007) doi:10.1111/j.1742-4658.2007.05684.x
Ngày tải lên: 30/03/2014, 09:20
Báo cáo khoa học: Biochemical characterization of the native Kv2.1 potassium channel ppt
... 111315171921232527293133353739 0 0.5 1.0 1.5 2.0 2.5 1 3 5 7 9 111315171921232527293133353739 A B Fraction Number Fraction Number Mono-Q Mono-S 0 1.0 NaCl (M) Protein concentration (A595) 0 1.0 NaCl ... extracts Desalting (PD-10) I. Mono- Q II. Gel Filtration III. Mono-S Kv2.1-enrichment (50X) 5.5 X 2.1 X 4.3 X Kv2.1 Kv4.2 * Kv1.2 150 kDa 100 75 50 37 150 100 75 50 37 150 100 75 50 37 11 12 13 15 17 19 21 23 ... 29 31 i ii Load 3 4 5 7 9 11131517192123 Kv2.1 Load iii 3457 9 1113151719 2123 Kv2.1 Load iii Protein concentration (A595) * * 25 25 25 Fig. 4. Chromatographic fractionation of native Kv2.1 complexes.
Ngày tải lên: 30/03/2014, 20:20
Guideline for Management of the Clinical Stage 1 Renal Mass pptx
... 12 Statistical Model 13 Limitations of Available Data 13 Limitations of study design 13 Confounding variables 14 RESULTS OF THE OUTCOMES ANALYSIS 14 ... Urol 2000; 164: 1153 110 Chan DY, Cadeddu JA, Jarrett TW, Marshall FF, and Kavoussi LE: Laparoscopic radical nephrectomy: cancer control for renal cell carcinoma J Urol 2001; 166: 2095 111 Makhoul ... neoplasms: further observations on growth Radiology 1995; 197: 589 95 Kassouf W, Aprikian AG, Laplante M, and Tanguay S: Natural history of renal masses followed expectantly J Urol 2004; 171: 111 96 Kato
Ngày tải lên: 31/03/2014, 13:20
Báo cáo Y học: Expression of the uncoupling protein 1 from the aP2 gene promoter stimulates mitochondrial biogenesis in unilocular adipocytes in vivo potx
... prevent the development of obesity. ACKNOWLEDGEMENTS This research was supported by the Grant Agencies of the Czech Rep. (311/99/0196 ) a nd the Acad. S ci. of the Czech Rep. (A 5011710 ), CO ST- 918 ... explain the lack of the effect of the transgene on the size of the latter depot [16,17]; this is also associated with the differential effect of the transgene on in situ fatty acid synthesis i ... hromogen (Sigma). The speci®city of the method was tested by the omission of the primary antibody in the staining, and the use of p reimmune serum instead of the ®rst antiserum. Furthermore, tissues
Ngày tải lên: 31/03/2014, 15:20
Báo cáo khoa học: "Fifth Conference of the European Chapter of the Association for Computational Linguistics" potx
... 257 287 198 21 216 83 89 101 89 179 222 257 269 113 119 167 299 185 161 173 257 281 287 125 257 275 149 131 107 8 257 161 263 33 269 198 155 191 269 227 233 21 143 137 269 239 263 269 51 Alberto ... Antonio Zampolli 27 63 303 198 306 15 281 15 173 198 69 137 245 257 194 281 149 39 45 239 95 2 21 309 131 137 155 8 210 287 293 57 27 269 149 293 275 95 257 lOl 173 227 251 8 287 204 75 lOl l ... Trang 1Fifth Conference of the European Chapter of the Association for Computational Linguistics Proceedings of the Conference 9-11 April 1991 Congress Hall, Alexanderplatz
Ngày tải lên: 01/04/2014, 00:20
Sản phẩm - Phân phối - Giá cho Lord of the ring
... thi - 10 bức ảnh có số lượt like cao nhất sẽ giành được giải thưởng trị giá 2 triệu đồng: bao gồm 01 đĩa DVD bộ phim The Lord of the Rings, 01 kính xem phim 3D và 01 bộ kỷ vật của phim (01 chiếc ... (01 chiếc nhẫn có khắc chữ Lord of the rings, 01 huy hiệu ảnh nhân vật, 01 album ảnh nhân vật phim và 01 bộ truyện 3D) - Giải đặc biệt do BTC lựa chọn: 01 iPhone 5 và 01 bộ kỷ vật của phim Cách ... 5 ngày kết thúc cuộc thi Trang 11c. Lễ trao giải “Cuộc thi ảnh cùng Lord of the rings”- Nhằm mục đích trao giải cho người thắng cuộc “Cuộc thi ảnh cùng Lord of the rings” và tạo đòn bẩy cho việc
Ngày tải lên: 17/06/2014, 16:39
AQUATIC EFFECTS OF ACIDIC DEPOSITION - CHAPTER 1 pptx
... Data 237 10.1.1 ELS-I 239 10.1.2 ALSC 239 10.1.3 ELS-II 240 10.1.4 DDRP 240 10.1.5 PIRLA 240 10.1.6 ALTM 240 10.1.7 ERP 241 10.2 Watershed History 241 10.3 Lake-Water Chemistry 244 10.4 Organic ... Mountainous West 259 11.1 Background 259 11.2 Sierra Nevada 265 11.2.1 Atmospheric Deposition 265 11.2.2 Surface Water Chemistry 266 11.2.3 Seasonality and Episodic Processes 267 11.2.4 Weathering and ... Manipulations 179 8.1.1 Gårdsjön, Sweden 179 8.1.2 Sogndal, Norway 181 8.1.3 Lake Skjervatjern, Norway 182 8.1.4 Aber, Wales 184 8.1.5 Klosterhede, Denmark 185 8.1.6 Bear Brook, ME 186 8.2 Whole-System
Ngày tải lên: 18/06/2014, 16:20
AEROSOL CHEMICAL PROCESSES IN THE ENVIRONMENT - CHAPTER 1 pot
... environmentalchemist at the Institute for Occupational Hygiene in Prague (1952 to 1956) and Head of theDepartment of Aerosol Sciences at the Czechoslovak Academy of Sciences in Prague (1957 to1972) He was ... approximately in the same time period, in the second half of the 19th century.Thomas Graham, who was the first to distinguish between crystalloids and colloids in the 1860s, is considered the founder of “classical” ... of the Association forAerosol Research from 1983 to 1984 He wrote three books on aerosols and over 150 originalpublications in aerosol physics and chemistry In 1989, he was the recipient of the
Ngày tải lên: 18/06/2014, 19:20
ENVIRONMENTAL RESTORATION of METALSCONTAMINATED SOILS - CHAPTER 1 pdf
... Methods 7 1.2.1.1 Soil Characteristics 7 1.2.1.2 Rapid Characterization of the Solid Phases Used as Amendments 8 1.2.1.3 Calculation of the Amendment Effect 10 1.2.1.4 Analytical Methods 13 1.3 Results ... 1.1 Introduction 3 1.1.1 Remediation Techniques 4 1.1.2 In Situ Remediation by Adding Solid Phase 4 1.2 Example of Study to Assess the Effectiveness of Several Amendments 7 1.2.1 Methods 7 1.2.1.1 ... Because of the concerns regarding the role of heavy metals in the environment, a series of international conferences was held to explore the emerging issues of the try of trace elements in the environment
Ngày tải lên: 18/06/2014, 19:20
Radionuclide Concentrations in Foor and the Environment - Chapter 1 docx
... 14Radionuclides? Michael Pöschl CONTENTS 1.1 Introduction 2 1.2 History 2 1.2.1 The History of Atomic Theory 2 1.2.2 The History of Radioactivity 3 1.3 Atom, Element, Nuclide, and Isotope 6 1.4 ... 8 1.4.1 Natural Radionuclides 9 1.4.1.1 Primordial Radionuclides 9 1.4.1.2 Secondary Radionuclides 9 1.4.1.3 Cosmogenic Radionuclides 10 1.4.2 Artificially Produced Radionuclides 10 1.4.2.1 Radionuclides ... Nuclear Reactors 10 1.4.2.2 Radionuclides Produced by Particle Accelerators 11 1.4.2.3 Radionuclides Produced by Generators 11 1.5 Radioactivity 12 1.5.1 Fundamentals of Radioactivity 12 1.5.2 Simple
Ngày tải lên: 18/06/2014, 19:20
Bạn có muốn tìm thêm với từ khóa: