... EGF-1 and EGF-2; Met153 (Fig.5h) cannot fit properly in the same space, bumping against one of the disulfide bonds of EGF-2 (Cys155 and Cys141) and against a loop in EGF-1 (Phe122 and Gly123), ... of Gly105 in EGF-1 (from PDB ID 1PFX); the N-terminus of the domain is labeled b Location of Asp105 in EGF-1; the N-terminus of the domain is labeled c Neighboring residues for Gln143 (from PDB ... snugly against Tyr161 and the disulfide bond formed by C157 and Cys170 (Fig 5c) As Arginine is larger than Glutamine, Arg143 clashes against Tyr161 and the disulfide from the same domain, and with
Ngày tải lên: 25/11/2020, 12:35
... 162.7, 159.6, 157.4, 154.2, 146.1, 144.0, 135.8, 131.7, 130.5, 130.0, 129.2, 127.6, 126.5, 121.9, 85.9, Found: C, 57.55; H, 4.15; N, 12.88; S, 7.31 P-1, а = 9.253(4), b = 10.106(4), c = 12.259(3) ... 7.68-7.56 (m, 5H, ArH), 7.20 (d, J = 7.5 Hz, 2H, ArH), 162.4, 159.5, 157.5, 154.2, 146.6, 139.6, 135.7, 133.5, 130.0, 129.7, 128.9, 127.6, 126.5, 124.7, 85.8, Found: C, 57.48; H, 4.16; N, 12.69; ... 7.50-7.33 (m, 5H, ArH), 6.73 Trang 9139.9, 129.7, 129.0, 128.3, 125.2, 125.1, 123.6, 105.9, 93.1, 51.0, 21.0 MS, m/z: 375 [M+1]+ Anal References 1 Palmer D C., and Venkatraman S (2003) Synthesis
Ngày tải lên: 27/05/2020, 05:30
powerpoint presentation kim’s game period 26 unit 5 cont’ lesson 2 a 34 p 53 54 i vocabulary 3 to watch television xem ti vi 1 to do the housework lµm viöc nhµ 2 to listen to music nghe nh¹c
... Trang 4 3 do the housework 4 listen to music 2 watch television 1 read Trang 5Unit 5: Lesson 2: A3,4 - P.53,54What do you do after school ? I watch television I listen to music I do the housework ... Trang 10 In my group, (Hoa) plays games after school (Nam and Ba) read after school I do my homework after school. Trang 11Unit 5: Lesson 2: A3,4 - P.53,54+ Learn vocabulary + Write the ... 2KIM S GAME’S GAMETrang 3 Period 26 : Unit 5 (Cont ) ’S GAME Lesson 2 : A 3,4 - P 53, 54 I Vocabulary: 3 (to) watch television : xem ti vi 1 (to) do the housework : làm việc nhà 2 (to) listen
Ngày tải lên: 12/04/2021, 05:09
Báo cáo y học: " The Vpr protein from HIV-1: distinct roles along the viral life cycle" potx
... 2005 Retrovirology 2005, 2:11 doi:10.1186/1742-4690-2-11 Received: 17 January 2005 Accepted: 22 February 2005 This article is available from: http://www.retrovirology.com/content/2/1/11 © 2005 ... trans-Three-dimensional structure of the HIV-1 Vpr protein (from [15]) Figure 2 Three-dimensional structure of the HIV-1 Vpr protein (from [15]) The three α-helices (17–33, 38–50, 55–77) are colored in pink, ... 2003, 300:1295-1297. 42. Farnet CM, Haseltine WA: Determination of viral proteins present in the human immunodeficiency virus type 1 pre-integration complex J Virol 1991, 65:1910-1915. 43. Fassati
Ngày tải lên: 13/08/2014, 13:20
Báo cáo y học: " Research In silico modeling of the specific inhibitory potential of thiophene-2,3-dihydro-1,5-benzothiazepine against BChE in the formation of β-amyloid plaques associated with Alzheimer''''s disease" doc
... (r < 4.5 Å)] with O ε 1 of Glu199 at a value of -2.201 kcal/mol (-2.188 kcal/mol for re-docked pose), hav-ing a distance of 4.341 Å (4.354 Å for re-docked pose) In the case of 1P0P, the total ... be -106.542 kcal/mol (-107.498 kcal/mol for re-docked pose) with the distal quaternary nitrogen atom having an energy contribution of -13.259 kcal/mol (-13.436 kcal/mol for re-docked pose) The ... evaluates the affected part of the molecule and chooses the value resulting in the lowest energy contribution The poses generated were added to the population if the energy value was below the 100.0
Ngày tải lên: 13/08/2014, 16:20
Báo cáo sinh học: "Mapping of a milk production quantitative trait locus to a 1.056 Mb region on bovine chromosome 5 in the Fleckvieh dual purpose cattle breed" pps
... Set3 11 BM733 119.95 117125799-117126005 CTGGAGTCTCCTCCGTTGAG AGAGAGGGCCCTTGTGAGAT Set4 12 DIK2035 120.85 119370626-119371127 CAGTCAATGCAGGAAAAGCA GCTGCTAGAGGGAGACAGGA Set3 13 DIK5277 121.53 120099447-120100247 ... 114.68 113216193-113216706 CAACAAACTGTGCGTTGTGA ACTCAGCAGTTGCCCTCAGT Set3 9 BM2830 116.91 115262054-115262075 AATGGGCGTATAAACACAGATG TGAGTCCTGTCACCATCAGC Set0 10 BM49 118.06 116205343-116205972 CACCATATTTGCCAGGATCA ... Set1 6 DIK5238 110.97 111864734-111865363 TGGAACCAGTGAAGTTTAGGG GAAATGCCCACTGAAGCTCT Set3 7 ETH2 112.43 112903902-112909263 ATTTGCCCTGCTAGCTTTGA AAGACTCTGGGCTTCAAAAGG Set1 8 DIK2122 114.68 113216193-113216706
Ngày tải lên: 14/08/2014, 13:21
THỂ DỤC TIỂU HỌC 1 - 5 TUẦN 1
... thực hiện và hướng dẫn HS tập luyện Lần 1-2 GV điều 5 25 HS tập hợp hàng ngang dóng hàng điểm số nghiêm nghỉ - hs thực hiện theo GV - 1 hàng dọc - Thực hiện theo GV, CS Trang 7CS điều sai ĐH: *HĐ3: ... luyện Lần 1-2 GV điều khiển, những lần sau CS điều khiển giáo viên quan sát, 5 2 5 HS tập hợp hàng ngang dóng hàng điểm số nghiêm nghỉ - hs thực hiện theo GV - 1 hàng dọc -Thực hiện theo GV, ... hành: GV chọn BCS theo tinh thần dân chủ ĐH: 5 25 HS tập hợp hàng ngang dóng hàng điểm số nghiêm nghỉ - hs thực hiện theo GV - 4 hàng ngang - Thực hiện theo GV Trang 3
Ngày tải lên: 20/10/2014, 22:00
THỂ DỤC 1- 5 TUẦN 2
... thuật, cho HS làm mẫu 25 - hs thực hiện theo GV - hs tập hợp 3 hàng dọc - Thực hiện theo GV, CS - 3 hàng ngang - Thực hiện theo GV, CS - Tập hợp HS thành vòng tròn Trang 11lần 1-2 GV điều khiển, ... quay trái - Rút kinh nghiệm 5 25 5 HS tập hợp hàng ngang dóng hàng điểm số nghiêm nghỉ - hs thực hiện theo GV - 3hàng dọc -Thực hiện theo GV, CS Hs chơi trò chơi Trang 13Nội dung buổi học sau: ... tập luyện Lần 1-2 GV điều khiển, những lần sau CS điều khiển giáo viên quan sát, sửa sai 25 - hs thực hiện theo GV - 3 hàng ngang - Thực hiện theo GV, CS - 3hàng ngang - Thực hiện theo GV, CS
Ngày tải lên: 20/10/2014, 22:00
giao an the duc 1-5 chuan kt kn
... Trang 1KẾ HOẠCH DẠY HỌCTUẦN 1 Từ ngày 23 đến 27tháng 08năm 2010 1 TD 24/08/201025/08/2010 - Tổ chức lớp-trò chơi - Còi, dụng cụ. 24/08/2010 25/08/2010 26/08/2010 27/08/2010 - Giới thiệu ... động cơ bản, trò chơi vận động và đặc biệt có 5-7’ 18-22’ 3-5’ 3-5’ 3-5’ 5-7’ 4-6’ - Lớp tập hợp thành 4 hàng ngang - Đội hình học tập: Trang 11môn học tự chọn như : Đá cầu,ném bóng,… b/ Phổ ... bài - GV nhận xét giờ học và giao bài tập về nhà - GV hô: “ Giải tán!” HS hô to “khỏe!” 5-7’ 18-22’ 12-15’ 5-7’ 4-6’ - Tập hợp lớp thành 4 hàng ngang: - Đội hình học tập: - Đội hình trò chơi: -
Ngày tải lên: 07/02/2015, 10:00
A STUDY ON HOW SCRIPTWRITERS FLOUT CERTAIN MAXIMS OF GRICE’S COOPERATIVE PRINCIPLE TO CREATE VERBAL IRONY THROUGH THE SITCOM FRIENDS FROM EPISODE 1 TO EPISODE 10
... 1.6 Design of the study 4 PART 2: THE DEVELOPMENT 5 CHAPTER 1: THEORETICAL BACKGROUND 5 1.1 Implicature 5 1.1.1 Definition of implicature 5 1.1.2 Implicature and inference 6 1.1.3 ... PART 1: INTRODUCTION 1 1.1 Rationale 1 1.2 Aims of the study 2 1.3 Research questions 2 1.4 Significance of the study 2 1.4.1 In theory 2 1.4.2 In practice 3 1.5 Scope of the study ... implicature 7 1.2 Grice’s cooperative principle 8 1.2.1 Conversational maxims 8 1.2.1.1 The maxim of quality 8 1.2.1.2 The maxim of quantity 9 1.2.1.3 The maxim of relation 10 1.2.1.4 The maxim
Ngày tải lên: 02/03/2015, 14:22
ĐỔI MỚI PHƯƠNG PHÁP DẠY HỌC BÀI SOẠN DẠY HỌC LỚP 5 MÔN THỂ DỤC TUẦN 1 ĐẾN TUẦN 5 CHI TIẾT, CỤ THỂ CÓ HÌNH ẢNH SINH ĐỘNG VÀ DỄ DÀNG GIẢNG DẠY.
... PHƯƠNG PHÁP LÊN LỚP: LƯỢ NG Trang 16Giậm chân …giâm Đứng lại ……đứng ( Học sinh đếm theo nhịp1,2 ; 1,2 nhịp 1 chân trái, nhịp 2 chân phải) Trò chơi : Diệt các con Trang 17 * Trò chơi: Đua ngựa I/ ... 5 MÔN THỂ DỤC TUẦN 1 ĐẾN TUẦN 5 CHI TIẾT, CỤ THỂ CÓ HÌNH ẢNH SINH ĐỘNG VÀ DỄ DÀNG GIẢNG DẠY. Chân trọng cảm ơn! Trang 4ĐỔI MỚI PHƯƠNG PHÁP DẠY HỌC BÀI SOẠN DẠY HỌC LỚP 5 MÔN THỂ DỤC TUẦN 1 ... Trang 1TƯ LIỆU CHUYÊN MÔN TIỂU HỌC. - -ĐỔI MỚI PHƯƠNG PHÁP DẠY HỌC BÀI SOẠN DẠY HỌC LỚP 5 MÔN THỂ DỤC TUẦN 1 ĐẾN TUẦN 5 Trang 2LỜI NÓI ĐẦU Trong giai đoạn
Ngày tải lên: 22/03/2015, 14:38
ĐỔI MỚI PHƯƠNG PHÁP DẠY HỌC BÀI SOẠN DẠY HỌC LỚP 5 MÔN THỂ DỤC TUẦN 1 ĐẾN TUẦN 10 CHI TIẾT, CỤ THỂ CÓ HÌNH ẢNH SINH ĐỘNG VÀ DỄ DÀNG GIẢNG DẠY.
... Trang 55LƯỢ NG12phút Trang 568 phút 4 phút Trang 57 I/ MỤC TIÊU: Giúp học sinh : -Ôn 4 động tác TD:Vươn thở,tay,chân,vặn mình.Yêu cầu thực hiện cơ bản đúng động tác -Trò chơi:Chạy nhanh theo ... Địa điểm : Sân trường; Còi 1-2 gậy III/ NỘI DUNG VÀ PHƯƠNG PHÁP LÊN LỚP: Trang 43NỘI DUNG ĐỊNH LƯỢ NG 25phút 15phút 3Lần Đội hình học tập Trang 44 4 phútTrang 45 I/ MỤC TIÊU: Giúp học sinh ... III/ NỘI DUNG VÀ PHƯƠNG PHÁP LÊN LỚP: Trang 29LƯỢ NG1lần/tổ 8p Đội hình học tập Đội hình trò chơi Đội Hình xuống lớp Trang 31 Lớp : 5 Bài : 11 * Đội hình đội ngủ * Trò chơi Chuyển đồ vật
Ngày tải lên: 23/03/2015, 05:47
1.5 Thế giới công bằng World''s fair
... Brussels (Belgium) • 1911 Turin (Italy) • 1913 Ghent (Belgium) • 1915 San Francisco (United States) • 1915 San Diego (United States) • 1962 Seattle ( United States) • 1964/65 New York (United ... States) • 1905 Liège (Belgium) • 1906 Milan (Italy) • 1907 Dublin (United Kingdom of Great Britain and Ireland) Trang 21• 1907 Norfolk (United States) • 1909 Seattle (United States) • 1910 Brussels ... Ireland) • 1855 Paris (France) • 1862 London (United Kingdom of Great Britain and Ireland) • 1867 Paris (France) • 1873 Vienna (Austria–Hungary, Austria) • 1876 Philadelphia (United States) • 1878
Ngày tải lên: 10/09/2015, 12:03
1.5 Thế giới công bằng World''s fair
... London, in 1851 Queen Victoria sẽ mở ra triển lãm lớn ở Crystal Palace ở Hyde Park, London, vào năm 1851.Thế giới công bằng-World's fair Trang 141933Trang 15Worlds fair-1939 Trang 16Worlds_Fair_Night_View_1962_SeattleTrang ... (Belgium) • 1911 Turin ( Italy) • 1913 Ghent ( Belgium) • 1915 San Francisco ( United States) • 1915 San Diego ( United States) • 1962 Seattle ( United States) • 1964/65 New York ( United ... 1904 St Louis ( United States) • 1905 Liège (Belgium) • 1906 Milan ( Italy) • Trang 21• 1907 Norfolk ( United States) • 1909 Seattle ( United States) • 1910 Brussels (Belgium) • 1911
Ngày tải lên: 10/09/2015, 12:03
World''s fair Thế giới công bằng (1.5)
... 1851 Thế giới công bằng-World's fair Trang 151833-1933Trang 16Worlds fair-1939 Trang 17Праздник весны и труда-Ngày Lao độngTrang 18Worlds_Fair_Night_View_1962_Seattle ... Victoria opens the Great Exhibition in the Crystal Palace in Hyde Park, London, in 1851 Queen Victoria sẽ mở ra triển lãm lớn ở Crystal Palace ở Hyde Park, London, vào năm 1851 Thế giới công ... Trang 1- Th ế giớ i c ôn g b ằn g W o rl d 's f ai r-World's Trang 2Thế giới công bằng-World's fair1.5 1.5 Trang 3Thế giới công bằng-World's fairTrang 4Thế giới công bằng-World's fairTrang 14Queen
Ngày tải lên: 11/09/2015, 09:03
nvestigating the influences of tidal inundation and surface elevation on the establishment and early development of mangroves for application in understanding mangrove rehabilitation techniques 1 5
... treatments The shorter the inundation duration, the longer the final stem length in the 11th week Inundation treatment A5 (with the shortest inundation period of 5 hours day-1, semi-diurnal) had the ... height across inundation treatments over 11 weeks At the 11th week, the mean Rhizophora stem height for treatments R5, R7 and R9 are 17.0 cm, 16.0 cm and 16.6 cm (Figure 4.4) Avicennia seedlings ... using R 3.1.2 (R development core team, 2014) Using only data from the 11th week, the response variable was defined as the “Status” of each seedling, and assigned a binary code of either 1 (alive)
Ngày tải lên: 22/09/2015, 15:19
5 1 learning about the first americans
... Department, Scott Foresman, 1900 East Lake Avenue, Glenview, Illinois 60025. 1 2 3 4 5 6 7 8 9 10 V0G1 14 13 12 11 10 09 08 07 06 05 Write to It! Write a paragraph comparing either the tepee used by American ... Department, Scott Foresman, 1900 East Lake Avenue, Glenview, Illinois 60025. 1 2 3 4 5 6 7 8 9 10 V0G1 14 13 12 11 10 09 08 07 06 05 Write to It! Write a paragraph comparing either the tepee used by American ... groups These groups included the Mohawk, the Seneca, the Onondaga, and the Oneida The Iroquois were farmers who lived in the forests of the Eastern Woodlands They used trees to build their villages,
Ngày tải lên: 11/02/2017, 04:48
5 1 1 this is the way we go to school
... to: Permissions Department, Scott Foresman, 1900 East Lake Avenue, Glenview, Illinois 60025. 2 3 4 5 6 7 8 9 10 V0G1 14 13 12 11 10 09 08 07 06 05 3 Miss Jacobson sat at her desk and looked ... lot from 1725 to 1830, but there were still a lot of changes that needed to be made.” Greg and Jamie bowed grandly, and the class cheered “Thank you, boys!” Miss Jacobson said Trang 1016 17The ... the front because they need more help and attention from the teacher The older students sit at the back There’s only one teacher, but sometimes she picks one of the older kids to help teach the
Ngày tải lên: 11/02/2017, 05:12
Báo cáo y học: "The HIV-1 Rev/RRE system is required for HIV-1 5’ UTR cis elements to augment encapsidation of heterologous RNA into HIV-1 viral particle" ppsx
... 10 1 10 2 10 3 10 4 0.30% 10 2 10 3 10 4 10 0 10 1 10 2 75 10 3 10 4 25. 92% GFP Neg GFP Neg 50 25 25 10 1 10 0 10 0 50 25 10 1 0.73% GFP Neg 25 75 GFP Neg MLV/HIV RRE + RU5PS 50 10 0 50 25 10 0 10 0 75 GFP Neg 25 ... 25 75 0.20% 75 0.39% 50 10 0 +Rev 50 MLV/HIV RU5PS 75 GFP Neg 25 10 1 10 4 10 0 0.07% 50 10 0 10 0 10 1 MLV/HIV RRE 75 GFP Neg 25 +Rev GFP Neg 25 10 0 -Rev 0.03% 50 10 1 10 2 10 3 10 4 10 0 10 1 10 2 10 3 10 4 ... 10 00 10 00 0.03% 750 P0 27.07% 750 GFP Neg 50 0 GFP Neg 50 0 250 250 10 0 10 00 10 1 10 2 10 4 10 0 10 00 10 3 0.03% 750 P5 MLV/HIV RRE+RU5PS 10 1 10 4 GFP Neg 50 0 250 10 3 11 .80% 750 GFP Neg 50 0 10 2 250 10 0...
Ngày tải lên: 13/08/2014, 01:21
the duc 1-5
... BẢN 25 -HS khởi động khớp -Ôn vượt chướng ngại vật 11 -GV nhắc lại ngắn gọn cách thực -Hs ôn v ợt chứơng ngại v ật -HS vượt chướng ngại vật lần cự li 15 m -GV chia tổ cho hs tập HS t ập theo t ... -HS khởi động khớp 25 2/ PHẦN CƠ BẢN -Ôn vượt chướng ngại vật -Hs ôn v ợt chứơng ngại v ật -GV nhắc lại ngắn gọn cách thực -HS vượt chướng ngại vật lần cự li 15 m HS t ập theo t ổ -GV chia tổ ... x x - Gv chia tổ cho hs tập gv 13 - Gv quan sác theo giỏi sữa sai cho hs hs ôn nhãy dây kiểu chum hai chân - cho hs ôn nhãy dây kiểu chum hai chân hs tập theo tổ theo đội hình chia sẵng tổ x x...
Ngày tải lên: 19/09/2013, 09:10