structure of a user defined data type

... structure of the HOG pathway in S cerevisiae MAP kinase cascades typically composed of three tiers of protein kinases, a MAP kinase (MAPK), a MAPK kinase (MAPKK) and a MAPKK kinase (MAPKKK), are common ... not always achievable due to many practical limitations, we need to consider a new method that can be applicable to time-series experimental data without parameter perturbations and that can make ... can be obtained by properly chosen n parameter perturbations All these approaches are based on parameter perturbation experiments which are, however, not always achievable in many practical cases...

Ngày tải lên: 07/03/2014, 21:20

... is regulated often by a small number of other genes [3,4] so a reasonable representation of a network is a sparse graph A sparse graph is a graph  parametrized by a sparse matrix W, a matrix with ... the class of linear models, the abundance value of a gene is treated as a weighted sum of the abundance values of other genes A high-dimensional transcript profile is a vector of abundance values ... networks Analysis of the statistical and topological properties of learned LP-SLGNs may have practical value; for example, genes with high random walk betweenness, a measure of the centrality of a node...

Ngày tải lên: 12/08/2014, 17:20

... the syntactic structure of language, it prefers placing the function of language as central (what language does and how language does it) rather than placing the elements of language and their ... explore the meaning and structure of Torquay? But I said Turkey! as a text The analysis is based on the framework of Hallidays (1994)An Introduction to Functional Grammar, Halliday and 21 Hasans (1997) ... the meaning of another by qualifying it in one of a number of possible ways There are four types of enhancement: spatio-temporal, manner, causal-conditional, and matter Spatial conjunctions are...

Ngày tải lên: 07/09/2013, 13:48

... declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative ... declarative declarative declarative declarative declarative declarative declarative declarative imperative declarative declarative Modality ability/neg ability/pos ability/neg ability/neg ability/neg ... relational was III Senser mental see Existent relational were Actor material descended Actor material landed Actor material put on Goal Actor material opened Goal Actor material climbed 10 Actor material...

Ngày tải lên: 12/02/2014, 20:20

... atoms of Asp11 and Asn23 (Fig 3) in an arrangement similar to what is observed in VPRK Both PRK and VPRK have calcium bound at Ca3 SPRK also has an aspartic acid residue at position at 200, and ... hexa62 Table Data collection and refinement statistics for SPRK ˚ Resolution (A) Space group Cell parameters ˚ a- axis (A) ˚ b-axis (A) ˚ c-axis (A) b angle (°) Number of observations (24 – maximum ... initial comparative studies showed that the catalytic turnover was at least twice that of PRK, but substrate affinity was reduced SPRK was compared with PRK and was found to be remarkable stable against...

Ngày tải lên: 19/02/2014, 07:20

... Number of ion pairsa Number of hydrogen bonds Main chain–main chain Main chain–side chain Side chain–side chain Total ˚ Exposed surface areab (A2 ) ˚ Apolarc (A2 ) ˚ Buried surface areab (A2 ) ˚ Apolarc ... Structural aspects of cold adaptation surface with their hydrophilic nature may enhance favourable electrostatic interaction with water at low temperature and, at the same time, result in an anionic ... whereas the overall exposed surface areas of the psychro- and the mesophilic enzymes are larger than for the thermophile enzyme, mainly as a result of larger area of apolar atoms, the meso- and...

Ngày tải lên: 19/02/2014, 16:20

... protein was then obtained by negative staining with 2% uranyl acetate (B) Multivariate statistical analysis of NOXtp (a) The average (AV) of 939 translationally, but not rotationally, aligned particles ... Significantly, this structural feature of NOXtp is highly similar to that of valosine-containing protein-like ATPase from Th acidophilum, an archaeal member of the AAA family (ATPases associated ... The standard proteins are ferritin (440 kDa), catalase (232 kDa), albumin (67 kDa) and ovalbumin (43 kDa) obtained from the translationally, but not rotationally, aligned images revealed a six-fold...

Ngày tải lên: 07/03/2014, 04:20

... et al crystal structure of a cellulase was reported; it was a catalytic domain of Hypocrea jecorina Cel 6A (HjeCel 6A, formerly designated cellobiohydrolase II), a GH6 cellobiohydrolase from an ascomycete ... HinCel 6A and CcCel6C (Fig 2) indicated that Asp150 and Asp334 of CcCel6C are the potential catalytic residues and could act as a proton donor and a base, respectively Another aspartic acid residue ... CLUSTALW2 server, and manual adjustment was carried out based on the comparison of the crystal structures The numbering of amino acid residues and secondary structures (a1 a8 and b0–bVII) are given Residues...

Ngày tải lên: 15/03/2014, 10:20

... 380 B Yan, et al.r Inorganic Chemistry Communications (2000) 379–382 Fig Packing view of ŽC H 10 N2 wW3 O10 x along the b-axis 2.4 X-ray Crystallographic Studies X-ray crystallographic data of were ... crystallographic data 7.9% in the temperature range 300–4808C indicating the release of en molecules Ž calc, 8.0% The infrared spectra of present the following information: strong absorption bands at 935 and ... organicrinorganic hybrid phases are obtained and structurally identified using the single crystal X-ray diffraction method Brief crystal data of one of the phases, a mono- Results and Discussion The...

Ngày tải lên: 19/03/2014, 16:48

... observation that heme lyase is unable to mature a bacterial class I c -type cytochrome, Paracoccus denitrificans cytochrome c550 [33] Moreover, many taxa that have heme lyase apparently have separate ... and T brucei apocytochrome c (J W A Allen, unpub2826 A Normalised absorbance of the alanine of the AXXCH motif (Ala25) (in green) and the unsaturated vinyl group of the heme ˚ (cyan) are separated ... free-living phagotrophic flagellates (e.g Bodo saltans), photosynthetic algae (e.g Euglena gracilis), and parasitic trypanosomatids [e.g the causal agents of the tropical diseases African sleeping...

Ngày tải lên: 23/03/2014, 04:21

... precipitant Prior to data collection, a crystal was transferred into Analysis of substrate specificity Substrate specificity was analyzed using xyloglucan tetradecasaccharide, XXXGXXXG, prepared as ... structural refinement of Table Statistics for data collection using the Beamline BL44B2 at SPring-8 and structure refinement of XEG Parameter Data collection ˚ Wavelength (A) ˚ Resolutiona (A) Rmergea,b ... at various concentrations of the substrate, tamarind seed xyloglucan (Dainippon Sumitomo Pharma, Osaka, Japan), in 50 mm sodium acetate buffer (pH 5.5) at 45 °C for 15 The bicinchoninate assay...

Ngày tải lên: 23/03/2014, 05:22

... Glu272–Arg148 21 19 14 092 8248 5844 –1 6.5 No of hydrogen bonds (side chain–side chain) Aromatic stacking ˚ ASA total (A2 ) ˚ ASA apolar (A2 ) ˚ ASA polar (A2 ) Formal global charge Theoretical pIb ... molecular replacement method, based on the structure of the class C b-lactamase from E cloacae P99 (Protein Data Bank code 2BLT) as a search model The model was ˚ solved to a resolution of 2.2 A A ... Grenoble, France) on a MarResearch CCD Data processing, molecular replacement and refinement of Pse fluorescens TAE4 b-lactamase Data were processed with the hkl suite package [45] A molecular replacement...

Ngày tải lên: 23/03/2014, 07:20

... 5’-AAAAGGTCGACATCTGGATGGCGACGAAAGACACGATC-3’ 5’-GATCGTGTCTTTCGTCGCCATCCAGATGTCGACCTTTT-3’ D36N-1 5’-CATCCTTCCCTATCTCAACATCCAGCTGGTTTACT-3’ D341N-1 5’-AAGGGGAGAACTCAACGGAACACCGGAGG-3’ 5’-CACTCTCGAAGAGTTCATAAACGAAGTGAAGAAGAATCTC-3’ ... performed as described previously [17] Table Primer sequences TmIDH mutant Primer sequence R186M 5’-CCTGGAGAAATCGATCATGAGCTTCGCTCAGTCGTG-3’ 5’-CACGACTGAGCGAAGCTCATGATCGATTTCTCCAGG-3’ 5’-AAAAGGTCGACATCTGGATGGCGACGAAAGACACGATC-3’ ... lacked interdomain Structure and thermal stability of T maritima ˚ ionic networks at a cut-off of 4.0 A and the size of the networks were not as dramatically increased at 4.2 and ˚ 6.0 A cut-offs...

Ngày tải lên: 23/03/2014, 10:21

... Statistics for the total amount of experimental data are reported in Table A simulated annealing (SA) procedure was used starting from a randomly generated linear polypeptide chain The actual ... inammation-mediating proteases [16] More recently, a number of patents on the use of BBIs against various apparently unrelated diseases have appeared [1719] The molecular basis of these BBI activities ... by dynamical simulated annealing from a random array of atoms FEBS Lett 239, 129136 Yip P & Case DA (1989) A New Method for Renement of Macromolecular Structures based on Nuclear Overhauser Effect...

Ngày tải lên: 23/03/2014, 10:21

... 2589 R sapE–F 2590 F sapE–R 2590 R mopB–F 3103 F mopB–R 3103 R GGCAACGAGCAAGGTCCGAAG AAGTCGTTGCAATCGGCGTCG GGCAACGAGCAAGGTCCGAAG GACGTCGTGAGTGCCTCCGTG CGACGTGCAGTATTACTTTTCTAGGG AGTATCAAACCGTGCTGGTCTCC ... processing would lead to a mature protein of 732 amino acids with a theoretical molecular mass of 78 kDa A search in the PROSITE database of protein families and domains [12] with MCA2590 revealed two ... not available in the databases, it remains to be elucidated if the sequence similarity of MCA2590 and the M album U74385 ORF extends even further Localization and identification of the mature MCA2590...

Ngày tải lên: 23/03/2014, 11:20

... (GenBank: AAA19802), T reesei (GenBank CAA49596), A niger (GenBank AAF04491), H grisea (GenBank AAD11942) and A aculeatus (GenBank BAA25183) gave sequence identity values of 65%, 64%, 73%, 51% and ... classification of cellulases Eur J Biochem 258, 200–206 68 Takashima, S., Iikura, H., Nakamura, A. , Hidaka, M., Masaki, H & Uozumi, T (1998) Isolation of the gene and characterization of the enzymatic ... distortion was 1.8°, the standard deviation of the hydrogen bond energies was 0.7 and overall G-factor, a measure of the normality of the structure, was 0.0 Fig SDS/PAGE and activity analysis of recombinant...

Ngày tải lên: 23/03/2014, 13:20

... is a kind of lexicalized grammar that consists of lexical items and a small number of composition rules called schema Schemata and lexical items are all described in typed feature structures and ... lexical and compositional, which makes its interface with syntax transparent and straightforward This is a significant advantage for achieving robustness in natural language processing 2.1 type raising ... such as the event and that case, can be treated in the same manner 2.2 PH ON H EAD SU BJ COMPS Head-driven Phrase Structure Grammar John Head-driven Phrase Structure Grammar (Pollard and Sag,...

Ngày tải lên: 23/03/2014, 18:20

... X-ray diffraction data were collected using an in-house Rigaku rotating anode X-ray generator with a MAR Research MAR345 image plate detector The radiation Ê wavelength was 1.5418 A The crystal ... surface area and the interactions in the dimer interface The total buried surface areas of the a a or head± Ê tail geometries were more than 1000 A2 , much larger than the average buried surface area ... the SAK dimer models Accessible surface areas are calculated with a probe radius 1.4 A added to the van der Waals radius Dimer model Buried surface Ê area (A2 ) Hydrogen bonds Salt bridges A 77Arg...

Ngày tải lên: 23/03/2014, 21:21

... Germany) Structure calculation was performed using XPLOR 3.851 and a modified ab initio simulated annealing protocol including floating assignment of prochiral groups and a conformational database ... incorporation J Virol 69, 7032–7044 Mahalingam, S., Khan, S .A. , Murali, R., Jabbar, M .A. , Monken, C.E., Collman, R.G & Srinivasan, A (1995) Mutagenesis of the putative alpha-helical domain of the ... M., Mahalingam, S., Kalyanaraman, V.S., Murali, R & Srinivasan, A (2000) Functional role of residues corresponding to helical domain II (amino acids 35–46) of human immunodeficiency virus type...

Ngày tải lên: 24/03/2014, 04:21

... efficient analytical calculation of the accessible surface area and their gradient for macromolecules J Comput Chem 19, 319–333 12 Kajander T, Cortajarena AL & Regan L (2006) Consensus design as a tool ... pairwise backbone alignment of CTPR3 (Protein Data Bank ID: 1Na0) and FEBS Journal 277 (2010) 1058–1066 ª 2010 The Authors Journal compilation ª 2010 FEBS A L Cortajarena et al A C Structure of designed ... individual units in the ASU (Fig 1B,D) Each CTPR390 unit is composed of three TPR repeats (AB-helix pair) and an additional C-terminal capping helix (Acap) The only way for molecules AB–AB–AB–Acap...

Ngày tải lên: 29/03/2014, 08:20