... Prevignano, Duane Savage-Rumbaugh, Susan SavageRumbaugh, Zhang Shaojie, Jared Tagliatela, Godfrey Tanner, Amy Tsui, Theo van Leeuwen, Eija Ventola, and David Wallace To my daughter, Ilaria, many thanks ... include Basil Bernstein, Mikhail Bakhtin, Robert de Beaugrande, James J Gibson, Michael Halliday, Ruqaiya Hasan, Walter Kauffman, Lakoff & Johnson, Jay Lemke, Jean Piaget, Stanley Salthe, xii Preface ... that take part in these, and the circumstances that may be attendant upon them Experiential meaning relations are realized in the grammar as particulate or part-whole structures which are based...
Ngày tải lên: 23/03/2014, 15:20
... concentration of Na+ activates pyruvate kinase without K+ [27] The reaction was initiated by an addition of lg enzyme K+-activated phosphatase activity was determined as K+-dependent pNPPase activity ... Yokoyama, T., Kaya, S., Abe, K., Taniguchi, K., Katoh, T., Ê Yazawa, M., Hayashi, Y & Mardh, S (1999) Acid-labile ATP and/or ADP/Pi binding to the tetraprotomeric form of Na/KATPase accompanying ... (n), and Na+-dependent ATPase activities (m) Each activity was measured at various pressures and 37 °C as described in Experimental procedures Speci®c activities of Na+/K+-ATPase, K+-activated...
Ngày tải lên: 24/03/2014, 00:21
Báo cáo Y học: Secretion of a peripheral membrane protein, MFG-E8, as a complex with membrane vesicles A possible role in membrane secretion pptx
... at °C overnight The plate was then incubated with anti-(GST– MFG-E8) serum and peroxidase-labeled goat anti-(rabbit IgG) Ig as the secondary antibody, and peroxidase activity was measured Scanning ... N.I., Lasierra, P., Larrad, L., Pineiro, A. , Alava, M .A & Naval, J (1999) Activated human T cells release bioactive Fas ligand and APO2 ligand in microvesicles J Immunol 163, 1274–1281 27 Mather, ... 5¢-ATTCTAGAG GCTAGGTTGTTGGAAAG-3¢, 5¢-ATTCTAGAGGAT GTCTTGAGCCCCTG-3¢ and 5¢-TTCTCGAGCAGGA CTGAGCATTAACAG-3¢ The two DNA fragments were ligated at the XbaI site and inserted into a cloning vector pBluescript...
Ngày tải lên: 24/03/2014, 03:21
Báo cáo y học: " Primary pulmonary mucinous cystadenocarcinoma presenting as a complex bronchocele: a case report" ppsx
... Hoshikawa Y, Chida M, Sato M, Sasano H, Kondo T: Pulmonary mucinous cystadenocarcinoma: report of a case and review of the literature Ann Thorac Surg 2003, 76:1738-1740 Higashiyama M, Doi O, Kodama ... Kawahara K, Nagano T, Nakagawa K: Pulmonary mucinous cystadenocarcinoma: an extremely rare tumor presenting as a cystic lesion of the lung Gen Thorac Cardiovasc Surg 2007, 55:143-146 Gao ZH, Urbanski ... demonstrated a largely cystic appearance (Hounsfield unit 14) communicating with the sub-segmental dilated bronchi that gave a ‘fingers in glove’ appearance (Figure 2A) There was a notable mural enhancement...
Ngày tải lên: 11/08/2014, 14:20
Báo cáo y học: " Status of complete proteome analysis by mass spectrometry: SILAC labeled yeast as a model system" ppt
... (where applicable) and N-pyroglutamate were allowed as variable modifications Due to the high mass accuracy, the 99% significance threshold (p < 0.01) in the yeast database search was a Mascot ... sequence database This database was complemented with frequently observed contaminants (porcine trypsin, achromobacter lyticus lysyl endopeptidase and human keratins) A 'decoy database' was prepared ... sequence reversing each entry and appending this database to the forward database Search parameters specified a MS tolerance of 10 ppm (see above) and an MS/MS tolerance at 0.5 Da and either full...
Ngày tải lên: 14/08/2014, 16:21
luận văn Toxicity assessment of small molecules using the zebrafish as a model system
... ATGGGGTATTTGAGGGTCAG TACCCTCCTTGCGCTCAATC GCGATTCCTTTTGGAGAAGAC TCGATATCCACATCGTCAGC CCGTCGTGGAGACGTCAA CGAGGAGAGGACACAAAGCT TCCACAACTGCTTCCTGATG CACACGACTCAATGCGTACC Subsequently, cDNA was amplified ... Its advantages including rapid development, high availability, and easy observation have made the model amenable to high-throughput assays Moreover, as a complex and independent organism retaining ... zebrafish embryos among scientists (Figure 1. 2A) as well as legislators: The International Organization for Standardization (ISO) has standardized the zebrafish embryo test for waste water quality...
Ngày tải lên: 15/05/2015, 00:37
Tài liệu Báo cáo Y học: Use of site-specific recombination as a probe of nucleoprotein complex formation in chromatin Micha Schwikardi and Peter Droge ¨ potx
... for a phage l integrase mutant was set as 100% In each case, data were collected from six separate transfection assays, each employing two wells containing about  105 cells (C) Normalized b-Gal ... electroporation b-Galactosidase (b-gal) assays, Southern blotting and PCR b-Gal assays and Southern blotting were performed as described previously [10,17] The 32 P-labelled probe was generated by ... 114-bp targets was significantly impaired in chromatin This impediment was not affected by the transcriptional status of chromatin nor by inhibitors of histone deacetylases and topoisomerases E...
Ngày tải lên: 22/02/2014, 07:20
Therapeutic ultrasound as a potential male contraceptive: power, frequency and temperature required to deplete rat testes of meiotic cells and epididymides of sperm determined using a commercially available system doc
... breeders served as untreated controls Sham-treated animals underwent all preparations for ultrasound treatment as treated animals: anesthesia was administered and maintained at - 2.5% isoflurane/oxygen, ... ME7410 transducer only produced MHz ultrasound Treatment apparatus A Plexiglas cylinder was used as the ultrasound chamber (70 mm diameter, 25 mm tall) The bottom of this chamber was a single layer ... Methods Animals All animal work was approved by the Institutional Animal Care and Use Committee (IACUC) of Integrated Laboratory Systems (ILS, Research Triangle Park, North Carolina, USA) or by...
Ngày tải lên: 05/03/2014, 17:20
Báo cáo khoa học: Nup358, a nucleoporin, functions as a key determinant of the nuclear pore complex structure remodeling during skeletal myogenesis docx
... (5¢-GATCTCCTCTTCAGCTA CCACCGCTTGAGAGACTTACTCTTGATTGTAACGA GGATA-3¢ and 5¢-AGCTTATCCTCGTTACAATCAA GAGTAAGTCTCTCAAGCGGTGGTAGCTGAAGAGG A- 3¢) were annealed and inserted into the BglII and HindIII sites of pEGFP-NLS ... 5¢-AUAAGUAAUUUCUACGACG dTdT-3¢; Nup358, 5¢-CCAGUCACUUACAAUUAAAd TdT-3¢ and 5¢-UUUAAUUGUAAGUGACUGGdTdT-3¢ (siNup358-1), 5¢-UGAAGCACAUGCUAUAAAAdTdT-3¢ and 5¢-UUUUAUAGCAUGUGCUUCAdTdT-3¢ (siNup358-2)] Transfection ... localization of HDAC4 orchestrates muscle differentiation Nucleic Acids Res 29, 3439–3447 22 Yasuhara N, Shibazaki N, Tanaka S, Nagai M, Kamikawa Y, Oe S, Asally M, Kamachi Y, Kondoh H & Yoneda...
Ngày tải lên: 06/03/2014, 01:20
Báo cáo khoa học: "Evaluating language understanding accuracy with respect to objective outcomes in a dialogue system" doc
... addition, this allows us to cast the problem in terms of classifier evaluation, and to use standard classifier evaluation metrics If more detailed annotations were available, this approach could easily ... this task, linking the classification scores with learning gain as measured during the data collection This approach follows the general PARADISE approach (Walker et al., 2000), but while PARADISE ... detailed evaluation results are presented in Table We will focus on two metrics: the overall classification accuracy (listed as “microaveraged recall” as discussed above), and the macro-averaged...
Ngày tải lên: 08/03/2014, 21:20
Báo cáo khoa học: Apoptosis and autophagy: BIM as a mediator of tumour cell death in response to oncogene-targeted therapeutics pptx
... mutant BCR–ABL tyrosine kinase activates several signalling pathways, including the ERK1 ⁄ pathway, the PKB pathway and the Janus kinase ⁄ signal transducer and activator of transcription (JAK-STAT) ... protein kinase ⁄ extracellular signal-regulated kinase kinase ⁄ kinases: mechanism of action in vivo, pharmacokinetic ⁄ pharmacodynamic relationship, and potential for combination in preclinical models ... pathway modulated by cytokines Cancer Biol Ther 6, 912–919 66 Kuroda J, Kimura S, Strasser A, Andreef A, O’Reilly LA, Ashihara E, Kamitsuji Y, Yokota A, Kawata E, Takeuchi M et al (2007) Apoptosis-based...
Ngày tải lên: 16/03/2014, 00:20
Báo cáo khoa học: The multi-replication protein A (RPA) system – a new perspective ppt
... Suzuki T, Yanagawa Y, Yamamoto T, Nakagawa H, Tanaka I, Hashimoto J & Sakaguchi K (2001) Characterization of plant proliferating cell nuclear antigen (PCNA) and flap endonuclease-1 (FEN-1), and their ... little AtRPA70b [12] These results indicated that AtRPA7 0a (probably, the AtRPA7 0a AtRPA32-2–AtRPA14 complex) has an essential role, probably in DNA replication in the chloroplast, whereas AtRPA70b ... Escherichia coli DNA polymerase I from a higher plant, rice (Oryza sativa L.) Nucleic Acids Res 30, 1585–1592 Yanagawa Y, Kimura S, Takase T, Sakaguchi K, Umeda M, Komamine A, Tanaka K, Hashimoto J, Sato...
Ngày tải lên: 23/03/2014, 06:20
Báo cáo khoa học: "A PROLOG IMPLEMENTATION OF LEXICAL LANGUAGE FUNCTIONAL PROCESSING GRAMMAR SYSTEM AS A BASE FOR A NATURAL" pdf
... relations of a sentence But what about the logical relations? Recall that each clause has a unique head end that the functional features of each phrase are identified with those of its head For ... property that the functional features of each phrase are identified with those of its head The head category of a phrase is characterized by d~e assignment of the trivial ft~%ctional-equation and by ... predicates which are goals ca~ give infon~tion to their subgoals In short, once a phrase structure grammr has been translated into a PROIOG pragraune every node is potentially able to grasp information...
Ngày tải lên: 24/03/2014, 05:21
báo cáo hóa học:" Angiostatin anti-angiogenesis requires IL-12: The innate immune system as a key target" docx
... Mat Control AST/Mat AST Mat 0.00 Control AST/Mat AST Mat Control 0.05 1.0 0.8 0.015 0.01 0.010 AST/Mat AST 0.000 Mat AST/Mat AST Mat 0.00 Control AST/Mat AST Control 0.005 Mat Relative expression ... keeps experimental metastasis in a dormant state [5] AST concentrations are elevated in fluids of animals harboring primary tumors [6] and other inflammatory and degenerative diseases [7,8] Following ... S, Santi L, Cassatella M, Noonan D, Albini A: Neutrophils as a key cellular target for angiostatin: implications for regulation of angiogenesis and inflammation FASEB J 2002, 16:267-269 Wahl...
Ngày tải lên: 18/06/2014, 15:20
Báo cáo sinh học: "Comparisons of three polyethyleneimine-derived nanoparticles as a gene therapy delivery system for renal cell carcinoma" doc
... physic-chemical properties (size and charge) of each separate material, including PCFC-g-PEI and FA-PEAs, as well as the FA-PEAs: pVHL complexes Because PCFC-g-PEI and FA-PEAs are amphiphilic ... free FA-PEAs (data not shown) So far as FA-PEAs:pVHL complexes were concerned, as shown in Table 2, the particle size was 277.5 nm at the mass ratio (FA-PEAs versus pVHL) of 5, while the particle ... PEI:pVHL complexes was larger than the FA-PEAs:pVHL complexes obviously at same ratio Generally, the particle size of FA-PEAs:pVHL complexes was decreased along with the increase of the weight ratios...
Ngày tải lên: 18/06/2014, 19:20
báo cáo hóa học: " The microglial NADPH oxidase complex as a source of oxidative stress in Alzheimer''''s disease" ppt
... Shimohama S, Tanino H, Kawakami N, Okamura N, Kodama H, Yamaguchi T, Hayakawa T, Nunomura A, Chiba S, Perry G, Smith MA, Fujimoto S: Activation of NADPH oxidase in Alzheimer's disease brains Biochem ... form the NADPH oxidase complex or RhoGDI The use of statins as a potential treatment for AD has received substantial attention based on two epidemiological studies that showed an association between ... Rho-family of small monomeric GTPases Like all Ras-superfamily members, Rac1 acts as a molecular switch cycling between an inactive guanosine diphosphate (GDP)-bound state and an active guanosine...
Ngày tải lên: 19/06/2014, 22:20
Báo cáo hóa học: "A Unified Transform for LTI Systems—Presented as a (Generalized) Frame" doc
... Philadelphia, Pa, USA, 1992 [7] C K Chui, An Introduction to Wavelets, Wavelet Analysis and Its Applications, Academic Press, Boston, Mass, USA, 1992 [8] O Christensen, An Introduction to Frames and ... Resolution enhancement of digital images and videos (2) Sampling and combined representations of signals and images (3) Adaptive systems in signal processing and control Paul M J Van den Hof was born ... 2a 2a ∞ √ f (t)e− (a+ jω)t dt (23) which is the definition of the (one-sided) Laplace transform (where s = a + jω is the Laplace variable and since we assumed f ∈ L2 ([0, ∞)), a > guarantees that...
Ngày tải lên: 22/06/2014, 23:20
Báo cáo sinh học: "The THO complex as a key mRNP biogenesis factor in development and cell differentiation" potx
... manuscript The work of AA’s laboratory is funded by the Spanish Ministry of Innovation and Junta de Andaluc a Published: 28 January 2010 Page of References Aguilera A: Cotranscriptional mRNP assembly: ... development and differentiation The relevance of THO in cell physiology has been clearly shown from yeast to humans Yeast THO null mutants are sick and slow growers and THO depletion has a negative ... identified as a transcriptional activator that interacts with the SAGA transcription factor, opens up the possibility of a co-transcriptional action of THO in higher eukaryotes [9] The impact of...
Ngày tải lên: 06/08/2014, 19:21