luận văn Toxicity assessment of small molecules using the zebrafish as a model system

luận văn Toxicity assessment of small molecules using the zebrafish as a model systemluận văn Toxicity assessment of small molecules using the zebrafish as a model systemluận văn Toxicity assessment of small molecules using the zebrafish as a model systemluận văn Toxicity assessment of small molecules using the zebrafish as a model system

VIETNAM NATIONAL UNIVERSITY, HANOI

INSTITUTE OF MICROBIOLOGY AND BIOTECHNOLOGY

and UNIVERSITY OF LIÈGE

-

Đinh Duy Thành

TOXICITY ASSESSMENT OF SMALL MOLECULES USING THE

ZEBRAFISH AS A MODEL SYSTEM

Subject: Biotechnology Code: 60.42.02.01

ACKNOWLEDGEMENT

This thesis would not have been possible without all the support, guidance, inspiration, and patience of the following people and organisations during the course of my study It is a privilege to convey my gratefulness to them in my humble acknowledgements First and foremost, I own my deepest gratitude to Prof Marc Muller, who gave me the opportunity to pursue my own interests

as a trainee in the GIGA-Research Your wisdom, guidance, support, and endurance enable me to develop and improve my expertise in both laboratory works and scientific writing Moreover, you did motivate me through my inner pressures as well as outer obstacles

I offer my thankfulness to my co-supervisor, Dr Nguyễn Lai Thành, for continuously encouraging me to explore my own ideas Your knowledge, gentleness, and trust have inspired me and other students to keep following the scientific path

Special thanks to Dr Nguyễn Huỳnh Minh Quyên, Prof Jacques Dommes, the Institute of Microbiology and Biotechnology (VNU- IMBT), and the University of Liège (ULg) for organising this Master Program in Biotechnology It is also an honour for me to

study with devoted professors and lectures within the course They not only gave me the knowledge but also a new vision to perceive the Science of Life

It is my great pleasure to thank Benoist, Yoann, and Audrey in the Toxicology team as well as the Mullerians and members of the BMGG: Thomas, Marie, David, and all others Your supports and helps during my stay in Liège crucially contributed to the completion of my research I would also like to express my thanks to my friends and colleagues: Lung, Tuấn, An, Loan, and others for their cares and encouragements in life and work

My research trip was co-sponsored by the Wallonia-Brussels International (WBI) and the Wallonia-Brussels delegation to Vietnam I would like to thank you for your commitment to supporting scientific innovations as well as strengthening the collaborations between the two laboratories and between our countries

Last, but by no means least, my sincerest admiration and gratitude are dedicated to my dear family, particularly my beloved wife for unconditionally trusting and pushing me to overcome all kinds of difficulty I encounter in the past, present, and future

TABLE OF CONTENTS

TABLE OF CONTENTS i

LIST OF TABLES AND FIGURES v

ABBREVIATIONS vii

PREFACE 1

Chapter 1: BACKGROUND INFORMATION 2

1.1 Small molecules: safety concerns 2

1.1.1 Pharmaceuticals and personal care products (PPCPs) 3

1.1.2 Food additives 4

1.1.3 Household chemicals 5

1.2 The Zebrafish embryo toxicity test (ZET) 6

Chapter 2: METHODS 11

2.1 Substances 11

2.2 Zebrafish maintenance 12

2.3 Chemical exposure and embryo observation 12

2.4 Behavioural analysis 14

2.5 Gene expression analysis 14

2.5.1 Reverse transcription and quantitative polymerase chain reaction 14

2.5.2 Transgenic fluorescent lines 16

2.6 Statistical analysis 16

2.7 Quality control 17

Chapter 3: RESULTS AND DISCUSSION 18

3.1 Morphological and lethal effects 18

3.2 Locomotor defects 29

3.3 Specific transgene expression in living embryos 33

3.4 Reverse transcriptive – qPCR 38

Chapter 4: CONCLUSIONS 41

REFERENCES 43

LIST OF TABLES AND FIGURES Tables

Table 2-1: List of studied chemicals 11

Table 2-2: Lethality endpoints 13

Table 2-3: Quantitative PCR primer set 15

Table 3-1: Concentration ranges selected for the main study 18

Table 3-2: Lethal concentrations, effective concentrations, teratogenic indices, and typical defects of studied substances 25

Figures Figure 1.1: Orthologous genes shared among the zebrafish, human, mouse and chicken genomes (reprinted from Howe et al [33]) 7

Figure 1.2: Literature analysis using the Scopus database in February 2014 8

Figure 1.3: Comparisons between the ZET test and the classical acute fish toxicity test (reprinted from Lammer et al [40]) 10

Figure 2.1: Normal morphological stages of zebrafish development at 28.5 C (photos excerpted from Kimmel et.al [39]) Scale bars = 250 M 13

Figure 3.1: Morphological phenotypes in hatched zebrafish larvae 19

Figure 3.2: Concentration-response curves and frequency of typical phenotypes caused by tested substances 22

Figure 3.3: LC50, EC50 Hill slope values of tested chemicals 27

Figure 3.4: Correlation between LC50s resulting from this study and those obtained using the procedure described in the OECD 236 guideline [59] 28

Figure 3.5: Larval motion measurements during the dark/light cycles 30

Figure 3.6: Comparative analysis of larval activity 31

Figure 3.7: Motoneuron visualisation in 2 dpf hb9:GFP embryos and larvae 33

Figure 3.8: Vascularisation in 2 dpf Tg[fli1:EGFP] embryos and larvae 36 Figure 3.9: Amplification plots of two reference candidates for this study 38 Figure 3.10: Relative expression of five tested genes using ef1α as internal control (mean  SD) 39 Figure 3.11: Expression profiles of five substances on the selected genes 40

ABBREVIATIONS

PPCPs Pharmaceuticals and Personal Care Products

qPCR Quantitative polymerase chain reaction

PREFACE

The human population are increasingly exposed to various chemicals whose beneficial or deleterious properties often remain unexplored The rising public concern about hazardous substances existing in foods and consumer products has forced legislators to tighten chemical management policy that requires extensive toxicity testing However, assessment of chemical toxicity is a challenging task, especially in terms of reliability and efficiency Ethical issues over the use of animal testing also add further complication to the task

The zebrafish (Danio rerio) embryo is an emerging model system for

chemical testing that is attracting scientific and legal attention Its advantages including rapid development, high availability, and easy observation have made the model amenable to high-throughput assays Moreover, as a complex and independent organism retaining the “non-animal” status, the zebrafish embryo is the ideal vertebrate testing model

Inspired by the promising applications of the zebrafish embryo model in toxicology research, with the objectives of developing analysis techniques and applying them in testing of different small molecular compounds, we decided to

carry out the project “Toxicity assessment of small molecules using the zebrafish

as a model system”

Chapter 1: BACKGROUND INFORMATION

1.1 Small molecules: safety concerns

Chemicals have become an integral part of modern daily life They play an important role in almost all industries and economic sectors Consumer goods of our everyday-use are either containing chemicals, or involving them during production Global chemical production has increased from 1 million tonnes in 1930 to 400 million tonnes in 2001 [25], with more than 143,000 substances in the European market* It is undeniable that these chemicals are progressively benefiting people’s life and economy

However, many chemicals are also posing potential deleterious effects on human and environment health, especially those with small molecular size (<900

Daltons) Amongst the most well-known examples is the thalidomide scandal which

involved thousands of cases of stillborn and extreme congenital deformity [38], or

the carcinogenic benzene [73] which may have claimed thousands of deaths around the world Another case is DDT, the insecticide whose extensive use and high

accumulation have greatly threatened both wildlife species and human health [83]

A common theme in these three instances is that large-scale application of these chemicals was conducted without having sufficient knowledge on their adverse impacts, and measures to restrict the uses were taken too late to prevent irreversible damages

Ironically, despite efforts to achieve the world governments’ agreement to use and produce chemicals “…in ways that do not lead to significant adverse effects

on human health and the environment…” by 2020 using scientific assessment procedures [85], the number of compounds and the complexity of the issue lead to the situation that unrecognised or unacknowledged toxic compounds in domestic

*

Source: http://echa.europa.eu/information-on-chemicals/pre-registered-substances , accessed February 2014

products are still present Therefore, the human population are still exposed to a daily mixture of chemicals whose potential harmful effects remain largely unclear

1.1.1 Pharmaceuticals and personal care products (PPCPs)

Pharmaceuticals are chemicals used for diagnosis, prevention and treatment

of disease, or improvement of health condition in human and animal The definition

is extended to excipients and adjuvants included in actual formulations Personal care products, including shampoo, cosmetics, and other products formulated for personal hygiene and beautification, contain a multitude of substances: solvents,

preservatives, disinfectants, fragrances, etc Sometimes a product may fall in both

categories such as sunscreen or the so-called “dietary supplement” Humans expose

to PPCPs through everyday activities e.g bathing, making-up, or essential medical

care Furthermore, PPCPs can be excreted (mainly pharmaceuticals) or directly released (personal care products) to the wastewater system and – without appropriate treatment – introduced to the environment [23, 60, 88], thus becoming

an emerging source of aquatic contaminants [11, 19]

Although designed for a specific mode of action and usually tested for safety, these compounds can also have numerous effects on nonspecific targets and cause undesired outcomes, infamously termed “side effects”, in the target organism Likewise, non-target organisms can possess receptors or metabolic processes non-homologous to the target organisms’, hence unexpected effects may result from unintentional exposure The problem becomes even more complex when taking various metabolites and transformation products derived from PPCPs into account

While it sounds intricate to systematically scrutinise the possible adverse effect of these compounds on human and environmental health, insufficient examination prior to market release may turn out to be costly, sometimes deadly

Severe incidents include the diethylene glycol-containing medicine “Elixir Sulfanilamide” which claimed 107 deaths in 1937 [8], the preservative benzyl alcohol which caused neurologic deterioration and death in low-birth-weight infants

[12], and the association between the antibiotic chloramphenicol and the so-called

“gray baby syndrome” [7] On the other hand, there are concerns over hazardous effects of some PPCP substances upon human health such as the commonly-used

antimicrobial triclosan [18], or the phthalate family of plasticisers [89]

1.1.2 Food additives

Food additives are substances which may intentionally become a component

of food or affect their characteristics Annual direct consumption of food additives

(excluding common ones such as spices, sugars, salt, honey, pepper, mustard, etc.)

is 5 lbs (approx 2.27 kg) per person [30] In Europe, each approved additive is assigned with an “E number” Since the 1970s, scientific and public concerns have arisen surrounding developmental neurotoxic effects of food additives Various studies have been conducted to investigate the potential risks of common additives, especially their relationship with childhood attention deficit hyperactivity disorder (ADHD) [43, 51] In the 2000s, two studies drew public attention: The first one was

undertaken by McCann et al on 297 children (the so-called “Southampton study”)

[51], and demonstrated that consumption of additive mixtures may relate to hyperactivity in children (two mixtures were used in the study: Mix A included

E102/E110/E122/E124/E211, and Mix B contained E104/E110/E122/E129/E211); The second one, the “Liverpool study” performed by Lau et al., showed that synergistic interaction between food additives (two combinations: E104/E951 and E133/L-glutamic acid) may affect differentiation and viability of mouse NB2a

neuroblastoma cells in vitro [43]

On the other hand, recent environmental studies revealed that food additives

are also emerging as water contaminants For instance, the antioxidants butylated hydroxyanisole (BHA, E320) and butylated hydroxytoluene (BHT, E321) are widely

reported to accumulate in freshwater environments [54] while several sweeteners are shown to contaminate waste water as well as surface water [42] Moreover,

some substances, such as propyl gallate (E310) [92], are potentially toxic for

aquatic ecosystems

Internationally, policymakers are still arguing over the threat caused by food additives and policies for controlling them remain diverse among countries [70] Nevertheless, there is a common acceptance for monitoring this group of chemicals:

“All food additives must be kept under continuous observation and must be evaluated whenever necessary in the light of changing conditions of use and new scientific information" as stated by the European Commission Council [26]

re-1.1.3 Household chemicals

A large group of everyday toxins originates from household products

Phthalates [89] occurring in plastic wares, paint, and glue were reported to have developmental and reproductive toxicity Bisphenol A (BPA) residues from various

polycarbonate products were shown to have endocrine-disruptive potential, BPA was outlawed from manufacturing of baby bottles in EU and Canada [49] Cleaning

agents may contain a pool of solvents, detergents, fragrances, disinfectants, etc.,

many of which may cause allergy, asthma, endocrine disruption, or interfere with immunological pathways [22, 69]

The substances mentioned above are just some examples of deleterious small molecules that are posing threats in everyday life Motivated by uprising concerns around the safety of these compounds, numerous governmental agencies and non-governmental organisations have developed their own database of harmful chemicals: the US-EPA (Environmental Protection Agency) list of Extremely hazardous substances; the Danish EPA’s List of Undesirable Substances (LOUS); the SIN (“Substitute it Now”) list by the International Chemical Secretariat; the European Chemical Agency’s (ECHA) substances of very high concern (SVHC)

list, etc Themed with “no data, no market”, legislators in the developed world have

set strict chemical management programs requiring thorough level and model toxicity tests [40]

multi-1.2 The Zebrafish embryo toxicity test (ZET)

There are a lot of challenges to the chemical toxicity testing strategy in the

21st century [16] Firstly, the tremendous number of registered chemicals, together with newly synthesised ones (for instance, the US-NIH’s PubChem database of small molecules contains over 48 million unique structures*, out of a theoretical estimation of 1060), requires very fast and high-throughput screening assays [40, 62] This does not take into account the infinite possible combinations of compounds, which may cause unpredictable synergistic effects Secondly, there is

no perfect model available to predict effects on humans while the closest models (mammals) cannot be used on a large scale due to ethical, practical, and budgetary

issues In silico and in vitro strategies are limited to one or several aspects and are

not able to represent the entire complexity within a whole organism Small

invertebrates such as Drosophila or C elegans are good for high-throughput in vivo

assays, but their body structures and genetic systems are too different from

vertebrates Adult small vertebrates such as zebrafish (Danio rerio) or medaka (Oryzias latipes) are good candidates due to their high similarity with higher

animals, however their use may still be ethically questionable

The zebrafish embryo is a promising toxicology model that may overcome these difficulties First, although being a complete and independent life form, the zebrafish embryo up to the free feeding stage (4~5 days post fertilisation – dpf) is generally not considered as an animal, hence can be used without raising ethical issues Second, zebrafish are easy to maintain and embryo yields are very large (50-

300 embryo/pair/week) Third, the developmental process of a zebrafish embryo represents that of other vertebrates with highly similar embryogenesis and organogenesis, but much faster, which can be observed clearly through the transparent embryo [39] Moreover, being among the earliest sequenced and annotated genomes, the well-known zebrafish genome shows much similarities with

*

Source: http://www.ncbi.nlm.nih.gov/pccompound?term=all%5Bfilt%5D , accessed February 2014

higher vertebrates including human [33], especially in structure and function of some genes belonging to the CYP family which are involved in drug metabolism in mammals [74] Additionally, as an aquatic vertebrate, the zebrafish embryo model can provide predictive value not only for human health risk but also for ecotoxicity assessment

Figure 1.1: Orthologous genes shared among the zebrafish, human, mouse and chicken

genomes (reprinted from Howe et al [33])

Therefore, the last two decades have witnessed an exponential increase of

interest in toxicity testing using zebrafish embryos among scientists (Figure 1.2A)

as well as legislators: The International Organization for Standardization (ISO) has standardized the zebrafish embryo test for waste water quality assessment in 2007 [34], while the Organisation for Economic Co-operation and Development (OECD) has recently approved the zebrafish embryo toxicity test guidelines (ZET) for

chemical toxicity testing [59] As can be seen in Figure 1.2B, applications of the

test cover many topics and serve multiple purposes, including

Pharmaco/Toxicology, Environmental science, Medicine, Materials science, etc

Figure 1.2: Literature analysis using the Scopus database * in February 2014

A Numbers of publications from 1990 to 2013 containing the term set (rerio OR zebrafish OR "zebra fish") AND (embryo* *toxic*) in Title/Abstract/Keywords (1390

in total); B Relative proportions of these publications categorised by subject areas

*

www.scopus.com

ZET assays can be performed using various endpoints [63, 86], each of which can be any “ biological or chemical process, response, or effect, assessed by

a test.” [57] The simplest procedure is survival and morphological observation during and after chemical exposure at different stages, after which concentration-response curves can be created and toxicological indices can be obtained such as LC50 (median lethal concentration, defined as the chemical concentration required

to kill half of the individuals at the end of the test) or EC50 (half maximal effective concentration, the concentration at which 50% of the individuals exhibit response) Obviously, for any chemical, selecting different endpoints will probably result in different EC50 values

Additionally, the ZET practitioner can use specific staining procedures to observe changes in biological processes, such as apoptosis, blood circulation, bone formation, or oxidative stress, in a whole animal setting [31, 63, 78] Gene

expression can be assessed by RT-PCR or in situ hybridisation [68, 84], or even at

the whole genome level by microarray or deep sequencing approaches [4] Immunofluorescent staining can reveal changes in protein translation or modification [55], while behavioural tests can indicate nerve and musculoskeletal damage [67] Moreover, researchers can use transgenic zebrafish lines to study protein expression and organ formation [6, 44, 91], morpholino antisense injection

is also utilised to study gene function and response [70], advanced in vivo gene

targeting methods such as TALEN and CRISPR [28] are also developed, providing even more efficient tools for researchers

Until now, the test is largely employed for screening of chemicals, drugs,

nanomaterial, etc [63, 78, 80] Comparison between the ZET test and other

classical or novel tests were also investigated, proving highly correlated data and

predictive value (Figure 1.3) [20, 31, 40] Various human disease models have been

generated in zebrafish, providing cost-effective systems for drug developers [4, 46] The ZET test is also combined with other specific methods such as xenografting

[66] to study and screen e.g anti-cancer drug

Figure 1.3: Comparisons between the ZET test and the classical acute fish toxicity test

(reprinted from Lammer et al [40]) Left: relationship between ZET and acute zebrafish toxicity (21 chemicals) Right: comparison of ZET to acute fish (all OECD species) toxicity for 70 chemicals

1.3 Aim of this study

This study was conducted to assess toxicity of several small molecules using the zebrafish embryo as a model system We aimed to apply a panel of several test methods, from simple observation of morphological and lethal effects to behavioural test and assessment of gene expressions, to evaluate toxicity of several substances representing different physico-chemical properties Our panel was designed to focus on embryonic neurobehavioural and vascular development, in addition to overall toxicity assessment Tested compounds were selected including standard ones with known toxicity for validation of our approach, and controversial food additives that were reported to affect human health

Chapter 2: METHODS 2.1 Substances

Analytical-grade substances of different chemical classes were selected for

this study (Table 2-1) Stock solutions were prepared by dissolving the pure

chemicals in E3 medium then diluted to the desired concentrations in E3 medium

Table 2-1: List of studied chemicals

Chemical

(other names)

Stock solution

weight

Common use

Flavouring enhancer

Food colouring agent

*

Approximately calculated by isotec/learning-center/mw-calculator.html

Breeding: The day before breeding, males and females were placed in

breeding chambers with a separator to prevent undesired spawning The next morning, fish were placed in fresh system water and the separator was removed to allow mating Eggs were collected after two hours and placed into E3 medium (5 mM NaCl, 0.17 mM KCl, 0.4 mM CaCl2, and 0.16 mM MgSO4) containing 0.01‰ methylene blue The point of divider removal and mating start was marked

as zero hour-post-fertilisation (0 hpf), the breeding date was also marked as day

zero (0 dpf)

Embryo sorting: At around 3-4 hpf, eggs were screened under a stereoscope

to remove unfertilised and/or abnormal ones Healthy embryos that showed normal cleavage were distributed into 6-well plates at 25 embryos/well for subsequent experiments

2.3 Chemical exposure and embryo observation

All test substances were assessed for lethality and developmental toxicity to zebrafish embryos After sorting, E3 medium in each well was replaced with test solution containing the appropriate concentration of test compound in E3 and incubated at 28C, test solutions were renewed daily until 4 dpf Before each renewal, embryos and/or larvae were rinsed twice in E3 and observed under a stereoscope, all embryonic morphology and lethality were recorded At 3- and

4 dpf, the larvae were photographed using an SZX10 stereomicroscope coupled with an XC50 camera (Olympus) Teratogenicity was assessed by determining the percentage of embryos/larvae with any morphological defect over surviving ones

Phenotypes were compared with those described previously by Kimmel et al [39] (Figure 2.1) A list of lethality endpoints during exposure is shown in Table 2-2

Figure 2.1: Normal morphological stages of zebrafish development at 28.5 C (photos

excerpted from Kimmel et.al [39]) Scale bars = 250 M

Table 2-2: Lethality endpoints

For each substance, a preliminary experiment was carried out to bracket lethal and teratogenic concentration ranges, followed by the main experiment testing five to seven concentrations chosen within the defined range

All experiments were carried out at least in triplicate on n=50 embryo per test/condition including control Data was calculated to determine indices such as median lethal concentrations (LC50), median effective concentration (EC50), effective concentration 10% (EC10), and the teratogenic index (TI, defined as the ratio between LC50 and EC50) as well as concentration-response equations

2.4 Behavioural analysis

Five chemicals were chosen for testing of delayed behavioural effects on 6 dpf zebrafish larvae: EtOH, DMSO, DCA, SB, and MSG Embryos were exposed to EC10 of each substance until 4 dpf Chemicals were then washed away and the larvae were raised in E3 until 6 dpf 24 larvae from each test (including control) were put into individual wells in a 96-well plate and analysed using the ZebraBox (ViewPoint, Lyon, France) Each larva’s activity (fraction of active time) and velocity (distance moved per time unit during active phases) were determined according to the manufacturer’s instruction by recording movement during 30-second intervals for 60 minutes of 10/10-min light/dark cycle (three cycles in total)

Each test was performed three times Activity and velocity data are presented after normalisation against those of the corresponding control

2.5 Gene expression analysis

2.5.1 Reverse transcription and quantitative polymerase chain reaction

0 dpf embryos were treated in EC10 of each of five substances: EtOH, DMSO, DCA, MSG, and SB until 4 dpf, then washed and raised in E3 solution until

6 dpf One pool of each treatment and control was analysed Total RNA from

70-100 treated or control larvae fixed in Trizol (Invitrogen, Cergy Pontoise, France)

was isolated using the RNeasy extraction kit (Qiagen, Venlo, Netherlands) and measured using a NanoDrop® ND-1000 Spectrophotometer (NanoDrop Technologies) One g RNA per sample was reverse-transcribed using the iScript™ cDNA Synthesis Kit (Bio-Rad, California, USA) in a reaction volume of 20 L

Table 2-3: Quantitative PCR primer set Gene Marking Forward primer Reverse primer

- actin Housekeeping gene CAGACATCAGGGAGTGATGG ATGGGGTATTTGAGGGTCAG

ef1α Housekeeping gene ACATGCTGGAGGCCAGCTC TACCCTCCTTGCGCTCAATC

hsp70 Stress indicator CCGAAGAGAAGCGACTTGAC GCGATTCCTTTTGGAGAAGAC

foxd3 Autonomic nervous

mbpa Myelin sheath CCGTCGTGGAGACGTCAA CGAGGAGAGGACACAAAGCT

vegfr2 Blood vasculature

Subsequently, cDNA was amplified using the SensiMix SYBR Hi-ROX Kit (Bioline; Meridian Life Science) and the reaction was followed in an ABI PRISM® 7900HT Sequence Detection System (Applied Biosystems) Each reaction was run

in triplicate, consisting of 0.2 L of synthesised cDNA, 0.53 M of each primer and 7.5 µl reaction mix (containing reaction buffer and thermostable polymerase) in a total volume of 15 L The thermal cycle was: 2 min at 50°C, 10 min at 95°C and

40 cycles of 15 sec at 95°C and 20 sec at 62°C A panel of six genes was tested as

described in Table 2-3

An endogenous reference was selected between two housekeeping genes based on their amplification profile in the different conditions Relative quantification of the other genes was performed using the Ct method [64] and presented as fold-change in comparison to the untreated control

2.5.2 Transgenic fluorescent lines

Tg[fli1:EGFP] and Tg[hb9:GFP] embryos were exposed to substances from

4 hpf until 2 dpf, then washed and observed under a MZ16FA fluorescent

stereomicroscope (Leica) Each transgene consisted of a promoter (fli1 or hb9)

controlling a fluorescent reporter cDNA and recapitulated the expression of its corresponding endogenous gene within the organism Phenotypic images for each substance were captured under both normal and fluorescent conditions

2.6 Statistical analysis

Basic and batch-wise calculations for behavioural analysis and Ct method were performed using Microsoft Excel 2010 tables All statistical analyses including regressions and comparison tests were carried out using Graphpad Prism v.5.04 for Windows

Percentages of dead/defective embryos were plotted against the transformed test concentrations of each substance Sigmoidal concentration-response curves were obtained by fitting those data to the four-parameter equation:

log-where top and bottom respectively represents the lowest and highest y-value (%dead/defective), XC50 is either LC50 or EC50 concentration, and HillSlope describes the steepness of the curve at the inflection point LC50, EC50 and EC10 values for each substance were extracted from their corresponding equation

Differences in locomotion/gene expression data between treated and control groups were confirmed by parametric or non-parametric tests based on normality test results When Gaussian requirement was met, one-way ANOVA analysis was employed, followed by individual t-test between each treated group and the control group, otherwise non-parametric tests were used Significance was considered when P-values were lower than 0.05 for all analyses

2.7 Quality control

Several pools of adult fish were bred individually for each assay After sorting, embryos from pools with high fertility (≥80%) were mixed and used for subsequent experiments The experiment was validated only when the control survival rate was ≥90% at 4 dpf For behavioural tests, only larvae showing no morphological defect were selected to measure During cDNA synthesis and qPCR procedure, each sample was paralleled by a corresponding non-reverse transcriptase control to check for the presence of contaminating genomic DNA

Chapter 3: RESULTS AND DISCUSSION

3.1 Morphological and lethal effects

In order to determine the appropriate concentrations for the main experiments, a preliminary test was conducted for lethality and teratogenicity on each chemical (data not shown) The final ranges were defined and are listed in

Table 3-1

Table 3-1: Concentration ranges selected for the main study

Chemical (Unit)

Concentration range

EtOH (% v/v)

1.0 1.5 2.0 2.5 3.0 4.0

DMSO (% v/v)

1.5 2.0 2.5 3.0 4.0 5.0

DCA (mg/L)

SB (mg/L)

MSG.H2O (g/L)

TTZ (g/L)

QY (g/L)

Embryos and larvae treated with the respective concentrations of each

chemical exhibited various morphological defects as illustrated in Figure 3.1 The

most typical phenotypes were:

 Oedema (edema): Abnormal accumulation of fluid inside the embryo,

causing the skin around the affected organ to swell and pressing internal structures into abnormal shape The most common types are heart oedema and yolk sac oedema

 Haemovascular defect: There are two main phenotypes, both appear as red dots due to local red blood cell accumulation Haemostasis is the

accumulation of blood inside the cardiovascular system obstructed by blood

clot (thrombosis) or blood vessel narrowing (stenosis) Haemorrhage is the

bleeding which causes blood to accumulate outside of the cardiovascular system

 Necrosis: Cell and tissue death caused by external factor such as toxin

Typical phenotypes observed during our study were yolk necrosis, head necrosis, and body necrosis

 Abnormal trunk: Including curved/short tail/body

 Retardation: Delayed developmental process

 Small eye

Figure 3.1: Morphological phenotypes in hatched zebrafish larvae

Figure 3.1 (Contd.)

Figure 3.1 (Contd.)

A: Control larvae; 3 dpf larvae have a straight trunk, large eyes, pigmented and clearly

segmented body; At 4 dpf, the bladder is inflated (b) and the jaw is clearly visible B:

Larvae after 4-day exposure to EtOH A larva treated in a 1.5% solution displays small

eyes, short head, short and slightly curved trunk and necrotic body (n); Large oedemas occur around the heart and on the side of the yolk sac (o) A 2.5% EtOH treated larva has very short trunk, small eye, and oedemas; Necroses (n) take place in the head, the trunk,

and the yolk C: A DMSO treated larva shows retardation (no development of jaw, small eye, and unconsumed yolk); yolk necrosis; heavily curved tail D: A 3mg/L DCA treated

larva at 4 dpf has very large oedemas (note the side oedema as seen in dorsal view); Curved tail; Small eyes; Short head; Yolk necrosis Another larva exposed to 4mg/L

solution shows bad yolk necrosis, heart oedema and short head E: A larva treated in SB

has head necrosis, severe yolk necrosis, and haemovascular defect (h) – possibly

haemostasis F: A larva treated in MSG exhibits yolk sac haemostasis and heart oedema

G: Three larvae exposed to TTZ show yolk sac necrosis; Further zooming reveals one

larva with multiple haemorrhagic sites in the head and around the yolk (h) H: A QY

treated larva has short trunk, heart oedema and small eye; the yolk is heavily necrotic, swollen and underutilised

To determine the toxicity of the seven tested compounds, response curves for lethality and developmental defects were generated whenever applicable LC50 and EC50 values were calculated based on the respective curve equation and teratogenicities were determined by comparison of LC50 to EC50: the

concentration-TI = LC50/EC50 A substance is considered to be teratogenic when concentration-TI > 1, otherwise it would be considered as producing embryo lethal effects only For all chemical, concentration-response curves and the proportion of frequent phenotypes

observed at 4 dpf are presented in Figure 3.2