local expression of the south

Massacres of the South

Massacres of the South

... great-grandmother Grandma, b. 1901 grandmother/homemaker Gram, b. 1903 grandmother/homemaker Grandad, b. 1903 grandfather/bookkeeper Grandpa, b. 1911 grandfather/doctor Fritz Markley, b. 1929 father-in-law/locksmith ... original family Al, b. 1959 brother/lawyer Dad, b. 1934 father/IT professional Doug, b. 1962 brother/lawyer Drew, b. 1970 dog Mom, b. 1936 mother/writer Sam, b. 1960 brother/artist Chicago circle ... Marco Torez security officer Matt Benjamin IT professional Matthew Martinez supervisor Melanie Bricker office administrator Michelle Jennings office administrator Nikos IT professional Odin...

Ngày tải lên: 07/11/2012, 09:09

11 348 0
Tài liệu Báo cáo khoa học: Homologous expression of the nrdF gene of Corynebacterium ammoniagenes strain ATCC 6872 generates a manganese-metallocofactor (R2F) and a stable tyrosyl radical (Y•) involved in ribonucleotide reduction ppt

Tài liệu Báo cáo khoa học: Homologous expression of the nrdF gene of Corynebacterium ammoniagenes strain ATCC 6872 generates a manganese-metallocofactor (R2F) and a stable tyrosyl radical (Y•) involved in ribonucleotide reduction ppt

... to the catalytic site of the R1E subunit. As reported in the Results, upon completion of substrate conversion, the radical is then rapidly passed back from the R1E subunit to the tyrosyl of the ... RNR and that of other class 1 RNRs or, instead, is a result of the interaction of the R2F with the inactivated (oxidized) form of the R1E. We consider the first option unlikely. Under these cir- cumstances, ... recipient. In the present study, we report data on homologous expression of the nrdF gene of C. ammoniagenes strain ATCC 6872. This is the first report of the successful purification of high amounts of the...

Ngày tải lên: 15/02/2014, 01:20

14 875 0
Tài liệu Báo cáo Y học: Purification, characterization, cloning, and expression of the chicken liver ecto-ATP-diphosphohydrolase pot

Tài liệu Báo cáo Y học: Purification, characterization, cloning, and expression of the chicken liver ecto-ATP-diphosphohydrolase pot

... from that of the oviduct ecto-ATPDase. Immunochemical staining demonstrates the distribution of the ecto-ATPDase in the bile canaliculi of the chicken liver. HeLa cells transfected with the chicken ... Besides oviduct and liver, the chicken ecto- ATPDase is also present in the apical membranes of the oxyntic-peptic cells [37]. The distribution of the ecto- ATPDase on these epithelial cells is distinctly ... different from theotherATPDaseintheE-ATPasefamily,theCD39s [13,17,19]. Molecular cloning of chicken liver ecto-ATPDase The results described above indicate that: (a) the enzymatic properties of the chicken...

Ngày tải lên: 22/02/2014, 04:20

10 696 0
CATHEDRALS AND CLOISTERS OF THE SOUTH OF FRANCE ppt

CATHEDRALS AND CLOISTERS OF THE SOUTH OF FRANCE ppt

... [Pg 1] The South of France. I. known, the gifts of all property that were made to the Church, the abandonment of worldly pursuits, the terrors of many, the anxiety of the calmest, the emotional ... telling of the Cathedrals of the South which was at once accurate and complete. For the Cathedrals of that country are monuments not only of architecture and its history, but of the history of peoples, ... ancients. To Virgil the adventures of the “pious Æneas” were truly heroic. The western shores of the Mediterranean were then the “end of the earth,” and even during the first centuries of our own era,...

Ngày tải lên: 06/03/2014, 03:21

194 312 0
Main results of the South African Innovation Survey 2005 docx

Main results of the South African Innovation Survey 2005 docx

... Some of the methodologies employed and the basic results for these other countries are discussed by Mani (2007). However, it is not the intention of this report to analyse the results of these ... 3.2% of the turnover of these enterprises. In both the industrial and services sector, the bulk of innovation expenditure was devoted to the acquisition of new machinery, equipment and software, ... on benchmarking the results of the South African Innovation Survey with the results of CIS4 undertaken in the various EU countries (as well as Norway and Iceland). The results of innovation surveys...

Ngày tải lên: 07/03/2014, 09:20

196 299 0
Báo cáo khoa học: Expression of the Drosophila melanogaster ATP synthase a subunit gene is regulated by a transcriptional element containing GAF and Adf-1 binding sites pptx

Báo cáo khoa học: Expression of the Drosophila melanogaster ATP synthase a subunit gene is regulated by a transcriptional element containing GAF and Adf-1 binding sites pptx

... processing of the D. melanogaster a -F1-ATPase transcript The expression of the a-F1-ATPase gene during develop- ment is coordinated with the expression of the nuclear- encoded b-F1-ATPase gene and the ... under the control of the actin 5C promoter. The GAGA factor stimulated at least threefold the activity of the promoter in constructs )397/+86 and )146/+86, but had no effect on the activity of the construct ... similar activity in Schneider cells to the promoter of the b-F1-ATPase gene [34] and 10-fold stronger than the promoter of the gene encoding the catalytic subunit of the mitochondrial DNA polymerase...

Ngày tải lên: 07/03/2014, 16:20

11 534 0
Báo cáo khoa học: Cloning and expression of the first nonmammalian interleukin-11 gene in rainbow trout Oncorhynchus mykiss pdf

Báo cáo khoa học: Cloning and expression of the first nonmammalian interleukin-11 gene in rainbow trout Oncorhynchus mykiss pdf

... clearly grouped the trout IL-11 with IL-11 molecules from other species and separate from other members of the IL-6 family. In vivo expression of IL-11 RT–PCR was used to examine the expression of trout IL-11 ... differ- ences were a 26 bp insertion in the 5¢-UTR of the cDNA and an insertion of 12 repeats with a consensus of CCAATGATGATCCAAGAAATCCACACTACAG (31 bp) in the 3¢-UTR of the cDNA sequence (Fig. 1). A ... in the 5¢-UTR, and four potential poly(A) signals were found in the 3¢-UTR (Fig. 1), two of them just 14 or 23 bp upstream of the poly(A) tail. The remaining two poly(A) signals were upstream of the...

Ngày tải lên: 07/03/2014, 16:20

12 517 0
Báo cáo Y học: Expression of the V-ATPase proteolipid subunit of Acetabularia acetabulum in a VMA3-deficient strain of Saccharomyces cerevisiae and study of its complementation pdf

Báo cáo Y học: Expression of the V-ATPase proteolipid subunit of Acetabularia acetabulum in a VMA3-deficient strain of Saccharomyces cerevisiae and study of its complementation pdf

... gene for one of the proteolipid subunits of V-ATPase. Expression of the cDNAs in the strain revealed that four cDNAs from the six complemented the proton transport activity into the vacuole, ... progress. Isoforms of V-ATPase subunits have so far been reported in higher plants as reviewed by Sze et al. [1], three isoforms of the subunit a of mouse enzyme [22,23], four isoforms of the proteolipid ... isoforms as observed in higher plants V-ATPase. We have also isolated two different cDNAs coding for the subunits A and B of V-ATPase. The intracellular localization of these isoforms and the...

Ngày tải lên: 08/03/2014, 23:20

8 392 0
Main results of the South African Innovation Survey 2005 pptx

Main results of the South African Innovation Survey 2005 pptx

... questionnaires. Many of the smaller firms did not see the relevance of the Innovation Survey to their businesses. Because of the relatively low response rate to the survey, some of the smaller sub-strata ... Some of the methodologies employed and the basic results for these other countries are discussed by Mani (2007). However, it is not the intention of this report to analyse the results of these ... turnover of all enterprises and 2.1% of the turnover of innovative enterprises. Intramural and outsourced R&D accounted for 0.69% of the turnover of all enterprises and 1% of the turnover of...

Ngày tải lên: 15/03/2014, 02:20

196 263 0
CLOTELLE: A TALE OF THE SOUTHERN STATES pdf

CLOTELLE: A TALE OF THE SOUTHERN STATES pdf

... them out, take the blacking and brush, and go at them." CHAPTER IV THE BOAT-RACE. At eight o'clock, on the evening of the third day of the passage, the lights of another steamer ... Just at the edge of the city, and sheltered by large poplar-trees was the old homestead in which she resided. There was a splendid orchard in the rear of the house, and the old weather-beaten ... citizen of the first standing among the whites, but even the slaves regarded him as one of the kindest of masters. Having inherited his slaves with the rest of his property, he became possessed of...

Ngày tải lên: 15/03/2014, 03:20

119 353 0
Báo cáo khoa học: Cell type-specific transgene expression of the prion protein in Xenopus intermediate pituitary cells ppt

Báo cáo khoa học: Cell type-specific transgene expression of the prion protein in Xenopus intermediate pituitary cells ppt

... suggesting that the level of GFP–PrP C transgene expression was dependent on the colour of the background of the animal. The fusion protein was found only in the NIL and not in the AL of black- and ... investigate the intracellular fate of PrP C by examining for the first time its biosynthesis in the secretory pathway of neuro- endocrine cells in vivo and the effect of the transgene expression of PrP C on ... approach with the intermediate pituitary melanotrope cells of the South- African claw- toed frog Xenopus laevis. Depending on the colour of the background of the animal (black or white), these cells...

Ngày tải lên: 16/03/2014, 14:20

16 433 0
Báo cáo khoa học: Identification and expression of the first nonmammalian amyloid-b precursor-like protein APLP2 in the amphibian Xenopus laevis ppt

Báo cáo khoa học: Identification and expression of the first nonmammalian amyloid-b precursor-like protein APLP2 in the amphibian Xenopus laevis ppt

... present in the other members of the APP superfamily, such as the absence of the exon encoding the KPI domain and the lack of a second heparin-binding domain [3,4,13,26]. Comparative analysis of the Xenopus and ... andmammalianAPLP2. Overall, the high degree of conservation of APLP2 may help the identification of functionally important domains within this APP superfamily member. Expression pattern of Xenopus APLP2 mRNA The expression ... Xenopus .The availability of the Xenopus APLP2 protein sequence allowed a phylogenetic analysis of APP superfamily mem- bers that suggested the occurrence of APP and preAPLP lineages with their...

Ngày tải lên: 16/03/2014, 16:20

7 408 0
Báo cáo khoa học: Expression of the pyrG gene determines the pool sizes of CTP and dCTP in Lactococcus lactis doc

Báo cáo khoa học: Expression of the pyrG gene determines the pool sizes of CTP and dCTP in Lactococcus lactis doc

... may have acted on the level of pyrG expression has been removed. The strength of the feedback regulation of CTP on pyrG expression, i.e. the elasticity of pyrG expression for the CTP concentration ... pyrG expression of up to 250% of the wild-type level (Fig. 4A). The results show that the feedback inhibition of the CTP synthase enzyme is incomplete in vivo. In conclusion, the homeostasis of the ... downstream of synthetic promoters. Expression from pyrG in the wild type is regulated by the concentration of CTP in the cell by an attenuation mechanism in the 5¢-end of the pyrG mRNA [6]. The primer...

Ngày tải lên: 16/03/2014, 16:20

8 493 0
Báo cáo khoa học: Gain of structure and IgE epitopes by eukaryotic expression of the major Timothy grass pollen allergen, Phl p 1 pdf

Báo cáo khoa học: Gain of structure and IgE epitopes by eukaryotic expression of the major Timothy grass pollen allergen, Phl p 1 pdf

... particles from grass pollens [10,11]. The small size of these sub- cellular particles allows them to reach the deeper air- ways and may explain the frequent occurrence of heavy asthma attacks after rainfalls ... Spectrometer (ThermoQuest Inc.). The spectra were deconvoluted using Thermo Finnigan’s xcali- bur software and the spectra were also verified by hand cal- culations of charge states. The proteolytic ... preincubation of patients’ sera with small recombinant protein fragments suggesting the importance of conformational IgE epitopes [25]. Therefore, we further tested the importance of struc- tural...

Ngày tải lên: 16/03/2014, 18:20

11 360 0

Bạn có muốn tìm thêm với từ khóa:

w