local expression of the midwest

Tài liệu Báo cáo khoa học: Homologous expression of the nrdF gene of Corynebacterium ammoniagenes strain ATCC 6872 generates a manganese-metallocofactor (R2F) and a stable tyrosyl radical (Y•) involved in ribonucleotide reduction ppt

Tài liệu Báo cáo khoa học: Homologous expression of the nrdF gene of Corynebacterium ammoniagenes strain ATCC 6872 generates a manganese-metallocofactor (R2F) and a stable tyrosyl radical (Y•) involved in ribonucleotide reduction ppt

... to the catalytic site of the R1E subunit. As reported in the Results, upon completion of substrate conversion, the radical is then rapidly passed back from the R1E subunit to the tyrosyl of the ... RNR and that of other class 1 RNRs or, instead, is a result of the interaction of the R2F with the inactivated (oxidized) form of the R1E. We consider the first option unlikely. Under these cir- cumstances, ... recipient. In the present study, we report data on homologous expression of the nrdF gene of C. ammoniagenes strain ATCC 6872. This is the first report of the successful purification of high amounts of the...

Ngày tải lên: 15/02/2014, 01:20

14 875 0
Tài liệu Báo cáo Y học: Purification, characterization, cloning, and expression of the chicken liver ecto-ATP-diphosphohydrolase pot

Tài liệu Báo cáo Y học: Purification, characterization, cloning, and expression of the chicken liver ecto-ATP-diphosphohydrolase pot

... from that of the oviduct ecto-ATPDase. Immunochemical staining demonstrates the distribution of the ecto-ATPDase in the bile canaliculi of the chicken liver. HeLa cells transfected with the chicken ... Besides oviduct and liver, the chicken ecto- ATPDase is also present in the apical membranes of the oxyntic-peptic cells [37]. The distribution of the ecto- ATPDase on these epithelial cells is distinctly ... different from theotherATPDaseintheE-ATPasefamily,theCD39s [13,17,19]. Molecular cloning of chicken liver ecto-ATPDase The results described above indicate that: (a) the enzymatic properties of the chicken...

Ngày tải lên: 22/02/2014, 04:20

10 696 0
Tài liệu 2012 GREAT TASTE OF THE MIDWEST doc

Tài liệu 2012 GREAT TASTE OF THE MIDWEST doc

... SHAMES | THE ROC 5 504-571-9807 TAXI SERVICE | UNION CAB | 608-242-2000 Union Cab of Madison Cooperative has been the of cial cab company of the Great Taste of the Midwest for over a decade. The ... and enjoy the bands as you wander about the park. The musicians here today are sharing their gift with us and we hope you’ll enjoy them enough to seek them out in local venues and add them to ... and unload along the frontage road near the park entrance. 2012 FESTIVAL ORGANIZERS AND STAFF The Great Taste of the Midwest is not organized by professionals but if it were, the organizers below...

Ngày tải lên: 22/02/2014, 05:20

66 318 0
Báo cáo khoa học: Expression of the Drosophila melanogaster ATP synthase a subunit gene is regulated by a transcriptional element containing GAF and Adf-1 binding sites pptx

Báo cáo khoa học: Expression of the Drosophila melanogaster ATP synthase a subunit gene is regulated by a transcriptional element containing GAF and Adf-1 binding sites pptx

... processing of the D. melanogaster a -F1-ATPase transcript The expression of the a-F1-ATPase gene during develop- ment is coordinated with the expression of the nuclear- encoded b-F1-ATPase gene and the ... under the control of the actin 5C promoter. The GAGA factor stimulated at least threefold the activity of the promoter in constructs )397/+86 and )146/+86, but had no effect on the activity of the construct ... similar activity in Schneider cells to the promoter of the b-F1-ATPase gene [34] and 10-fold stronger than the promoter of the gene encoding the catalytic subunit of the mitochondrial DNA polymerase...

Ngày tải lên: 07/03/2014, 16:20

11 534 0
Báo cáo khoa học: Cloning and expression of the first nonmammalian interleukin-11 gene in rainbow trout Oncorhynchus mykiss pdf

Báo cáo khoa học: Cloning and expression of the first nonmammalian interleukin-11 gene in rainbow trout Oncorhynchus mykiss pdf

... clearly grouped the trout IL-11 with IL-11 molecules from other species and separate from other members of the IL-6 family. In vivo expression of IL-11 RT–PCR was used to examine the expression of trout IL-11 ... differ- ences were a 26 bp insertion in the 5¢-UTR of the cDNA and an insertion of 12 repeats with a consensus of CCAATGATGATCCAAGAAATCCACACTACAG (31 bp) in the 3¢-UTR of the cDNA sequence (Fig. 1). A ... in the 5¢-UTR, and four potential poly(A) signals were found in the 3¢-UTR (Fig. 1), two of them just 14 or 23 bp upstream of the poly(A) tail. The remaining two poly(A) signals were upstream of the...

Ngày tải lên: 07/03/2014, 16:20

12 517 0
Báo cáo Y học: Expression of the V-ATPase proteolipid subunit of Acetabularia acetabulum in a VMA3-deficient strain of Saccharomyces cerevisiae and study of its complementation pdf

Báo cáo Y học: Expression of the V-ATPase proteolipid subunit of Acetabularia acetabulum in a VMA3-deficient strain of Saccharomyces cerevisiae and study of its complementation pdf

... gene for one of the proteolipid subunits of V-ATPase. Expression of the cDNAs in the strain revealed that four cDNAs from the six complemented the proton transport activity into the vacuole, ... progress. Isoforms of V-ATPase subunits have so far been reported in higher plants as reviewed by Sze et al. [1], three isoforms of the subunit a of mouse enzyme [22,23], four isoforms of the proteolipid ... isoforms as observed in higher plants V-ATPase. We have also isolated two different cDNAs coding for the subunits A and B of V-ATPase. The intracellular localization of these isoforms and the...

Ngày tải lên: 08/03/2014, 23:20

8 392 0
Báo cáo khoa học: Cell type-specific transgene expression of the prion protein in Xenopus intermediate pituitary cells ppt

Báo cáo khoa học: Cell type-specific transgene expression of the prion protein in Xenopus intermediate pituitary cells ppt

... suggesting that the level of GFP–PrP C transgene expression was dependent on the colour of the background of the animal. The fusion protein was found only in the NIL and not in the AL of black- and ... investigate the intracellular fate of PrP C by examining for the first time its biosynthesis in the secretory pathway of neuro- endocrine cells in vivo and the effect of the transgene expression of PrP C on ... physiological manipulation of the biosyn- thetic and secretory activity of the melanotrope cell. In this study, we combined the unique properties of the melanotrope cell with the technique of stable Xen- opus...

Ngày tải lên: 16/03/2014, 14:20

16 433 0
Báo cáo khoa học: Identification and expression of the first nonmammalian amyloid-b precursor-like protein APLP2 in the amphibian Xenopus laevis ppt

Báo cáo khoa học: Identification and expression of the first nonmammalian amyloid-b precursor-like protein APLP2 in the amphibian Xenopus laevis ppt

... present in the other members of the APP superfamily, such as the absence of the exon encoding the KPI domain and the lack of a second heparin-binding domain [3,4,13,26]. Comparative analysis of the Xenopus and ... andmammalianAPLP2. Overall, the high degree of conservation of APLP2 may help the identification of functionally important domains within this APP superfamily member. Expression pattern of Xenopus APLP2 mRNA The expression ... Martens 1 1 Department of Molecular Animal Physiology, Nijmegen Center for Molecular Life Sciences (NCMLS), University of Nijmegen, the Netherlands; 2 Laboratory of Bioinformatics, Wageningen University, the Netherlands The...

Ngày tải lên: 16/03/2014, 16:20

7 408 0
Báo cáo khoa học: Expression of the pyrG gene determines the pool sizes of CTP and dCTP in Lactococcus lactis doc

Báo cáo khoa học: Expression of the pyrG gene determines the pool sizes of CTP and dCTP in Lactococcus lactis doc

... may have acted on the level of pyrG expression has been removed. The strength of the feedback regulation of CTP on pyrG expression, i.e. the elasticity of pyrG expression for the CTP concentration ... pyrG expression of up to 250% of the wild-type level (Fig. 4A). The results show that the feedback inhibition of the CTP synthase enzyme is incomplete in vivo. In conclusion, the homeostasis of the ... downstream of synthetic promoters. Expression from pyrG in the wild type is regulated by the concentration of CTP in the cell by an attenuation mechanism in the 5¢-end of the pyrG mRNA [6]. The primer...

Ngày tải lên: 16/03/2014, 16:20

8 493 0
Báo cáo khoa học: Gain of structure and IgE epitopes by eukaryotic expression of the major Timothy grass pollen allergen, Phl p 1 pdf

Báo cáo khoa học: Gain of structure and IgE epitopes by eukaryotic expression of the major Timothy grass pollen allergen, Phl p 1 pdf

... particles from grass pollens [10,11]. The small size of these sub- cellular particles allows them to reach the deeper air- ways and may explain the frequent occurrence of heavy asthma attacks after rainfalls ... Spectrometer (ThermoQuest Inc.). The spectra were deconvoluted using Thermo Finnigan’s xcali- bur software and the spectra were also verified by hand cal- culations of charge states. The proteolytic ... preincubation of patients’ sera with small recombinant protein fragments suggesting the importance of conformational IgE epitopes [25]. Therefore, we further tested the importance of struc- tural...

Ngày tải lên: 16/03/2014, 18:20

11 360 0
Báo cáo khoa học: Molecular cloning and functional expression of the human sodium channel b1B subunit, a novel splicing variant of the b1 subunit potx

Báo cáo khoa học: Molecular cloning and functional expression of the human sodium channel b1B subunit, a novel splicing variant of the b1 subunit potx

... the intracellular segment of the b 1 subunit is required for the interaction with the a subunit, probably a crucial step for the regulation of channel properties. The tissue distribution of the ... I m /I max obtained from the fit. All data points (E, F) correspond to the mean ± SEM of the averaged normalized currents for the number of oocytes indicated. (G) Effect of b 1B on the current amplitude of Na V 1.2. ... peptide. Functional expression of the human b 1B subunit with Na V 1.2 in Xenopus oocytes To explore the regulatory function of the human b 1B subunit, we injected cRNA of human b 1B ,aswellascRNA of the sodium...

Ngày tải lên: 16/03/2014, 23:20

9 416 0
Báo cáo khoa học: Functional expression of the quinoline 2-oxidoreductase genes (qorMSL) in Pseudomonas putida KT2440 pUF1 and in P. putida 86-1 Dqor pUF1 and analysis of the Qor proteins doc

Báo cáo khoa học: Functional expression of the quinoline 2-oxidoreductase genes (qorMSL) in Pseudomonas putida KT2440 pUF1 and in P. putida 86-1 Dqor pUF1 and analysis of the Qor proteins doc

... estimated from Hanes plots. Determination of the metal contents of the Qor proteins, and detection of the nucleotide moiety of the molybdenum cofactor The contents of molybdenum and iron were determined ... suggested the presence of the MCD form of the pyranopterin cofactor; the CMP contents of the three enzymes were similar. Keywords: quinoline 2-oxidoreductase; molybdenum hydro- xylase; expression ... catalyse the synthesis and insertion of a cytidine dinucleotide cofactor into recombinant Qor as suggested by the release of CMP after hydrolysis of the enzyme, it appears that the assembly of intact...

Ngày tải lên: 17/03/2014, 10:20

11 727 0
Báo cáo khoa học: Expression of the Pycnoporus cinnabarinus laccase gene in Aspergillus niger and characterization of the recombinant enzyme pdf

Báo cáo khoa học: Expression of the Pycnoporus cinnabarinus laccase gene in Aspergillus niger and characterization of the recombinant enzyme pdf

... followed by a Mono Q column. All the characteristics of the recombinant laccase are in agreement with those of the native laccase. This is the first report of the production of a white-rot laccase in A. ... Using the GLA s ignal sequence instead of the laccase one, the laccase activity reached a maximum of 7000 IUÆL )1 , i.e. an increase of 80-fold as compared to the first construction. Considering these ... these results, the expression vector pLac1-B was selected to characterize the recombinant laccase from A. niger . Immunodetection of the recombinant laccase and expression of the corresponding...

Ngày tải lên: 17/03/2014, 11:20

8 496 0
Báo cáo khoa học: A novel pathway for sequential transformation of 7-dehydrocholesterol and expression of the P450scc system in mammalian skin pptx

Báo cáo khoa học: A novel pathway for sequential transformation of 7-dehydrocholesterol and expression of the P450scc system in mammalian skin pptx

... of the product of P450scc-mediated side-chain cleavage of 7-DHC. (A) Spectrum of the enzymatic side-chain cleavage of 7-DHC; (B) spectrum of 7-DHP synthetic standard. Ó FEBS 2004 P450scc in the ... respectively. The methyl group in the s ide chain (21-CH 3 ) gave the singlet at 2.12 p.p.m. because o f the presence of an adjacent keto group at C-20. The signal of the methine proton (3aH) at the secondary ... (Invitrogen), and the isolation of RNA followed the manufacture’s protocol. The synthesis of first-strand cDNA was per- formed using the Superscript preamplification system (Invitrogen). Either 5 lg of t otal...

Ngày tải lên: 23/03/2014, 13:20

11 478 0
Báo cáo Y học: Expression of the aspartate/glutamate mitochondrial carriers aralar1 and citrin during development and in adult rat tissues docx

Báo cáo Y học: Expression of the aspartate/glutamate mitochondrial carriers aralar1 and citrin during development and in adult rat tissues docx

... and whether these isoforms play thesamerole. To address the first of these questions, we have now studied the expression of aralar1 and citrin throughout mouse development and in tissues of the adult ... lines [12,18], therefore it may compensate for the loss of citrin in the kidney of patients with CTLN2. This raises a general question of whether the two isoforms are expressed in the same tissues ... embryos. Note the stronger expression of aralar1 in skeletal muscle, heart and neural tissue. Note also the basolateral localization of the in situ hybridization signal in the cells of the gut. Abbreviations:...

Ngày tải lên: 24/03/2014, 04:21

8 432 0

Bạn có muốn tìm thêm với từ khóa:

w