we describe the cloning and expression of deoxyhypusine hydroxylase dohh

Tài liệu Báo cáo Y học: Purification, characterization, cloning, and expression of the chicken liver ecto-ATP-diphosphohydrolase pot

Tài liệu Báo cáo Y học: Purification, characterization, cloning, and expression of the chicken liver ecto-ATP-diphosphohydrolase pot

... present in the apical membranes of the oxyntic-peptic cells [37]. The distribution of the ecto- ATPDase on these epithelial cells is distinctly different from theotherATPDaseintheE-ATPasefamily,theCD39s [13,17,19]. Molecular ... on the characterization of the E-ATPases in intact cells and plasma membrane preparations has accumulated since the 1970s (reviewed in [3]). Because of their low abundance and the lability of ... numbers are on the left side and amino-acid residue numbers are on the right side of the figure. The transmembranous domains of the protein at the N- and C-terminus are shaded. The five apyrase...

Ngày tải lên: 22/02/2014, 04:20

10 696 0
Báo cáo khoa học: Cloning and expression of the first nonmammalian interleukin-11 gene in rainbow trout Oncorhynchus mykiss pdf

Báo cáo khoa học: Cloning and expression of the first nonmammalian interleukin-11 gene in rainbow trout Oncorhynchus mykiss pdf

... (ATTTA) were present in the 3¢-UTR as well as in the 5¢-UTR, and four potential poly(A) signals were found in the 3¢-UTR (Fig. 1), two of them just 14 or 23 bp upstream of the poly(A) tail. The remaining ... organization resembles that of mammalian IL-11. The sequences between the trout cDNA and genomic DNA in the coding region are identical, although there were differ- ences in both the 5¢- and 3¢-UTR. The major ... major differ- ences were a 26 bp insertion in the 5¢-UTR of the cDNA and an insertion of 12 repeats with a consensus of CCAATGATGATCCAAGAAATCCACACTACAG (31 bp) in the 3¢-UTR of the cDNA sequence...

Ngày tải lên: 07/03/2014, 16:20

12 519 0
Báo cáo Y học: Cloning and expression of sterol D14-reductase from bovine liver potx

Báo cáo Y học: Cloning and expression of sterol D14-reductase from bovine liver potx

... and plants (55±59%), sug- gesting that the bovine cDNA encodes D14-SR. Northern blot analysis of bovine tissues showed high expression of mRNA in liver and brain. The polypeptide encoded by theclonedcDNAwasexpressedinCOS-7cells.Immu- no¯uorescence ... control cells. These results are consistent with the known subcellular localization of the enzymes involved in cholesterol biosynthesis and with the puri®cation of the bovine protein from the ER. Determination ... [7±9] and fungi [10]. Gene c loning of D14-SR from Ara bidopsis thaliana and analysis o f m utants has h ighlighted the role of the protein in cell growth and embryonic development of the plant...

Ngày tải lên: 08/03/2014, 16:20

8 495 0
Báo cáo khoa học: Cloning and expression of a tomato cDNA encoding a methyl jasmonate cleaving esterase pdf

Báo cáo khoa học: Cloning and expression of a tomato cDNA encoding a methyl jasmonate cleaving esterase pdf

... speculated that the physical role of MeJA is to mobilize JA [ 19]. The proof of this hypothesis might come from a more detailed understanding of how plants form MeJA from JA, and vice versa. ... bands occur o wing to the presence of recognition sites for the utilized restriction enzymes within introns (as assumed f or the HNL from Hevea) [30]. However, during the purification of MJE there ... evidence for the expression of isoenzymes, although, if present, they might have different catalytic properties. Northern blot analysis and induction of MJE expression in cell cultures Northern blot...

Ngày tải lên: 16/03/2014, 18:20

8 458 1
Tài liệu Báo cáo " synthesis, cloning and expression in escherichia coli of a gene coding for Mcoti-ii " ppt

Tài liệu Báo cáo " synthesis, cloning and expression in escherichia coli of a gene coding for Mcoti-ii " ppt

... codon and Xho I restriction site was introduced on the 5’ end of the proposed synthetic trypsin inhibitor gene. The sequences of the forward and reversed primers are shown on fig 3 and of the ... primers and the purified total MCo DNA as template. The conditions for this experiment were established as: 150ng of each primer; 200µM of dNTPs ;400ng of the purified total MCo DNA . Cloning of ... strain was used as the host for cloning and expression of the recombinant gene . The recombinant MCoTI-II was firstly synthesized in a 58kD fusion protein, then released from it and purified following...

Ngày tải lên: 12/02/2014, 10:20

9 499 0
Report of the Special Rapporteur on the promotion and protection of the right to freedom of opinion and expression, Frank La Rue* ppt

Report of the Special Rapporteur on the promotion and protection of the right to freedom of opinion and expression, Frank La Rue* ppt

... technologies, for the exercise of the right to freedom of opinion and expression, including the right to seek, receive and impart information and the relevance of a wide diversity of sources, as well as ... freedom of opinion and expression, but also a range of other human rights, and to promote the progress of society as a whole. Chapter III of the report underlines the applicability of international ... their right to freedom of opinion and expression, the Internet also facilitates the realization of a range of other human rights. 23. The vast potential and benefits of the Internet are rooted...

Ngày tải lên: 06/03/2014, 21:20

22 400 0
Báo cáo khoa học: Cloning and characterization of the genes encoding toxic lectins in mistletoe (Viscum album L) pot

Báo cáo khoa học: Cloning and characterization of the genes encoding toxic lectins in mistletoe (Viscum album L) pot

... intensity of the bands may be the result of a different copy number of the genes in the hybridizing fragments. If so, the number of the bands do not represent the family size. Thus, the mlp gene ... the biological role of the sequence (Fig. 2). The sequences of the catalytic A-chain of the MLp toxins were found to differ. However, the amino acids forming the catalytically active center of ... the other two genes, and that this is probably the reason for the quantitative prevalence of MLI in extract of mistletoe leaves [18]. The A-chains encoded by the three variants of the genes were expressed...

Ngày tải lên: 07/03/2014, 15:20

11 611 0
Báo cáo khoa học: Pulchellin, a highly toxic type 2 ribosome-inactivating protein from Abrus pulchellus Cloning, heterologous expression of A-chain and structural studies ppt

Báo cáo khoa học: Pulchellin, a highly toxic type 2 ribosome-inactivating protein from Abrus pulchellus Cloning, heterologous expression of A-chain and structural studies ppt

... the understanding of the protein structure and function, and lay a solid foundation for its application. This study reports the cloning and characterization of the A-chain gene that encodes the toxic ... controls. The reactions were stopped by the addition of 0.1 vol. of NH 4 OAc and 2.5 vol. of 100% ethanol and frozen before centrifugation for 1 h at 4 °C. The pellets were resuspended in 15 lL of 60% ... The rPAB showed an apparent molecular mass of  60 kDa, similar to the native pulchellin. The toxic activities of the rPAB and native pulchellin were compared by intra- peritoneal injection of...

Ngày tải lên: 07/03/2014, 16:20

10 396 0
Báo cáo khoa học: Identification and expression of the first nonmammalian amyloid-b precursor-like protein APLP2 in the amphibian Xenopus laevis ppt

Báo cáo khoa học: Identification and expression of the first nonmammalian amyloid-b precursor-like protein APLP2 in the amphibian Xenopus laevis ppt

... present in the other members of the APP superfamily, such as the absence of the exon encoding the KPI domain and the lack of a second heparin-binding domain [3,4,13,26]. Comparative analysis of the Xenopus and ... ubiquitously expressed and alternatively spliced forms were detected. However, the expression ratios between the mRNA forms in the various tissues examined were different between Xenopus and mammals, most ... analysis of the APP superfamily To reveal the evolutionary history of the APP superfamily, we used maximum likelihood and Bayesian methods to construct a phylogenetic tree of the members of the APP superfamily...

Ngày tải lên: 16/03/2014, 16:20

7 408 0
The Design and Implementation of a Log-Structured File System

The Design and Implementation of a Log-Structured File System

... shows the relative importance of the various kinds of data written to disk, both in terms of how much of the live blocks they occupy on disk and in terms of how much of the data written to the ... sequen- tially, then writes 100 Mbytes randomly to the existing file, then reads 100 Mbytes randomly from the file, and finally reads the file sequentially again. The bandwidth of each of the five phases ... cleaning the segment and chooses the segments with the highest ratio of benefit to cost. The benefit has two components: the amount of free space that will be reclaimed and the amount of time the space...

Ngày tải lên: 12/09/2012, 15:05

15 1,4K 0

Bạn có muốn tìm thêm với từ khóa:

w