... Equation Jianzhou Liu and Juan Zhang Department of Mathematics and Computational Science, Xiangtan University, Xiangtan, Hunan 411105, China Correspondence should be addressed to Jianzhou Liu,liujz@xtu.edu.cn ... product of two matrices Most available results are based on the assumption that at least one matrix is symmetric 7,8,11,12 However, it is important and difficult to get an estimate of the trace ... 2008; Accepted 19 February 2009 Recommended by Panayiotis Siafarikas By using singular value decomposition and majorization inequalities, we propose new inequalities for the trace of the product of
Ngày tải lên: 22/06/2014, 02:20
... presenting occasionalvolumes with a contemporary approach to the classical topics ofphysics at the advanced undergraduate and graduate level Clarityand soundness of treatment will, we hope, mark these ... J D JACKSON Trang 82- 3 Small oscillations of a mechanical system 102- 4 Rotation of axes and orthogonal transformations 152-5 Euler's theorem and principal-axestransformations as eigenvalue ... written (41) Trang 28with coefficients of transformationa~ If we substitute (38) into (41)all al2 alS) A== (aij) == a21 a22 a2S aSI aS2 ass and the rectangular matrices (column vectors), x and x' :
Ngày tải lên: 01/06/2022, 08:38
3 cross selling of banking products and financial services
... Trang 1CROSS SELLINGOF BANKING PRODUCTS & FINANCIAL SERVICES -by Gazal Badlani Ashok Sarkar PGDM 2010-12 Trimester – 4 Trang 3Scope of cross selling• Liability side • Asset side Trang 4Examples ... of cross selling1 Credit insurance 2 Life insurance enhancements to traditional mortgages 3 Auto and homeowners insurance 4 Medical savings accounts 5 Asset management accounts Trang 5• Research ... which product to sell to which customer Trang 21NPTB approach1 Compiling data 2 Selecting statistical method 3 Estimation and evaluation 4 Scoring and targeting approach Trang 221 Develop a true
Ngày tải lên: 26/09/2022, 22:38
báo cáo hóa học:" Barriers to initiation of antiretroviral treatment in rural and urban areas of Zambia: a cross-sectional study of cost, stigma, and perceptions about ART" pdf
... Trang 1R E S E A R C H Open AccessBarriers to initiation of antiretroviral treatment in rural and urban areas of Zambia: a cross-sectional study of cost, stigma, and perceptions about ART Abstract ... Trang 4Table 1 Demographic characteristics of subjects in a cross-sectional survey in rural and urban areas of Zambia*ARVs (N = 200) HBC (N = 200) ARVs (N = 200) HBC (N = 200) Age Marital status ... for HIV/AIDS, but who had not initiated ART, to identify barriers to and facilitators of ART uptake in rural and urban areas of Zambia Methods Study sites The study sites were HIV clinics and the
Ngày tải lên: 20/06/2014, 08:20
báo cáo hóa học: " The comparative burden of mild, moderate and severe Fibromyalgia: results from a cross-sectional survey in the United States" pdf
... Analysis Means, standard deviations (SD), medians, and ranges were calculated for continuous variables and frequency counts and percentages were calculated for categorical variables To evaluate ... identified domains that should be captured in clinical trials for FM therapies and aspects of domains and outcome mea-sures that should be part of a concerted research agenda for FM researchers [12] ... Fibromyalgia Impact Questionnaire (FIQ), Multidimensional Assessment of Fatigue (MAF), Medical Outcomes Study Sleep Scale (MOS-SS), and Hospital Anxiety and Depression Scale (HADS) and questions about
Ngày tải lên: 20/06/2014, 15:20
Báo cáo y học: "A cross-sectional analysis of video games and attention deficit hyperactivity disorder symptoms in adolescents" pps
... Table 4: Academic Performance GAMES INTERNET VIDEO GAMES Trang 6Annals of Last grade in Math Class (as appears on last report card): A+ A A- B+ B B- C+ C C- D+ D D- F Last grade in English Class ... (as appears on last report card): A+ A A- B+ B B- C+ C C- D+ D D- F Overall average grade (as appears on last report card): week with mom or dad Live with legal guardian Average total number of ... copyright reasons Acknowledgements We thank Diantha Howard for statistical assistance and Juliette Chan for her support We are grateful to Linda Barnes and Sarah Smith Conroy for their assistance.
Ngày tải lên: 08/08/2014, 21:20
Báo cáo y học: "Bonding of articular cartilage using a combination of biochemical degradation and surface cross-linking" pdf
... incorporated into the cartilage and can be easily removed and the scar tissue can be remodelled by cell and extracellular matrix turnover Degradation Degradation or swelling of articular cartilage ... the statistical anal-ysis MN and JH participated in the design and coordination of the study All authors read and approved the final manuscript Acknowledgements The authors thank Richard Kujat, ... articular cartilage repair Introduction After trauma, articular cartilage often does not heal due to incomplete bonding of the fractured surfaces The pathophys-iological mechanism of articular
Ngày tải lên: 09/08/2014, 10:20
Báo cáo y học: "A cross-sectional study of the number and frequency of terms used to refer to knowledge translation in a body of health literature in 2006: a Tower of Babel?" pps
... and the relatives of patients who died after euthanasia or assisted suicide Their article is a KT arti-cle and also categorized as being a KT application paper The paper by Shojana and colleagues ... researchers, and practitioners We also created a database of articles categorized as being about KT or not about KT The database and list of KT terms were developed independently The database and list ... training assistance in implementing the reading/categorizing guidelines and inter-rater reliability checks KAM, CL, and NLW planned and carried out the analyses and interpretation of the data All
Ngày tải lên: 11/08/2014, 05:21
báo cáo khoa học: " Health system determinants of infant, child and maternal mortality: A cross-sectional study of UN member countries" doc
... horizontal approaches to health as both have strengths and limitations [6-8] Both private and Trang 54 public systems can employ vertical and horizontal approaches to health care and programming and ... systemic and exists within and across scales and sectors of the government and thus requires anti-corruption efforts that are both broad and sector-specific Private vertical programs are often fast and ... prospectively maintained archive of publicly accessible health statistics, named the Globally Accumulated health Indicator Archive (GAIA) Source data for the outcome and explanatory variables originated
Ngày tải lên: 11/08/2014, 14:21
báo cáo khoa học:" Low Sense of Coherence (SOC) is a mirror of general anxiety and persistent depressive symptoms in adolescent girls - a cross-sectional study of a clinical and a non-clinical cohort" docx
... Physiological health parameters such as body mass index, blood pressure and saliva corti-sol correlate in a similar way to SOC and measures of anxiety and depression [9,10] The association between SOC and ... models showed that symptoms of anxiety and depression explained a major part of the SOC variance in both the non-clinical and clinical samples The SOC scale and measures of anxiety and depression ... Questionnaire (SDQ-em) and self-assessed health-related and physiological parameters were collected from a sample of non-clinical adolescent females (n = 66, mean age 16.5 years with a range of 15.9-17.7
Ngày tải lên: 12/08/2014, 01:21
báo cáo khoa học: " Molecular characterization of a rice mutator-phenotype derived from an incompatible cross-pollination reveals transgenerational mobilization of multiple transposable elements and extensive epigenetic instability" ppt
... Tong211-LP and its progenies, a set of variable AFLP and MSAP bands were isolated, cloned and sequenced (see Additional file 3) It was found that all variable bands were chromosomal DNA sequences of ... plants and animals are faith-fully maintained and perpetuated by coordinated func-tion of at least two classes of DNA methyltransferases (maintenance and de novo), together with active demethy-lases, ... transcriptase (RT)-PCR analysis Isolation of total RNA and cDNA synthesis was essentially as reported [24] Specifically, total RNA was isolated from expanded young leaves at the same developmental stage
Ngày tải lên: 12/08/2014, 03:20
Báo cáo khoa học: " A geminiviral amplicon (VA) derived from Tomato leaf curl virus (ToLCV) can replicate in a wide variety of plant species and also acts as a VIGS vector" pps
... efficiencies of both wild type (VA) and various mutants [VA(AC2M), VA(AC4M) and VA(AC2MAC4M)] of VA/ToLCV constructs in tomato plants (A) Total DNA was isolated from the tomato leaves agroinfiltrated ... Forward: 5'-AAGCTTAACATGGTGGAGCAC-GACACTC-3', and Reverse 5'-GAATTCGTCACTGGATTTT-GGTTTTAG-3') and was cloned in the pCAMBIA1391Z vector at the HindIII - EcoRI site Next, the CR-AC3 frag-ment of ... Trang 1Open AccessResearch A geminiviral amplicon (VA) derived from Tomato leaf curl virus (ToLCV) can replicate in a wide variety of plant species and also acts as a VIGS vector Prerna Pandey,
Ngày tải lên: 12/08/2014, 04:20
Báo cáo y học: " Coordinate enhancement of transgene transcription and translation in a lentiviral vector" pps
... 5'TTTTCATATGCAGTTGTTACGACATTTTGGAAAG3') and ligated with NdeI-ClaI-digested PCE-Luc and U3-Luc in order to create IE-PCE-Luc and IE-U3-Luc, respectively Transient transfection and Luciferase assay ... the statis-tical analysis MDL participated in the preparation of the manuscript KBL coordinated the design and implementa-tion of the study, the data analysis, and the preparaimplementa-tion of ... out the vector construc-tion, experimental evaluaconstruc-tion, and participated in the data analysis and preparation of the manuscript SF partic-ipated in the design of the study and carried
Ngày tải lên: 13/08/2014, 09:21
Báo cáo sinh học: "The use of retroviral vectors for gene therapy-what are the risks? A review of retroviral pathogenesis and its relevance to retroviral vector-mediated gene delivery" pptx
... Australia, 2 Department of Paediatrics, University of Adelaide, South Australia, 5005, Australia and 3 Department of Biotechnology, Flinders University, GPO Box 2100, Adelaide, South Australia, 5001, ... 5001, Australia Email: Donald S Anson* - donald.anson@adelaide.edu.au * Corresponding author Abstract Retroviral vector-mediated gene transfer has been central to the development of gene therapy ... some of Separation of the cis and trans functions of a retrovirus in a recombinant, replication defective vector system Figure 2 Separation of the cis and trans functions of a retrovi-rus in a
Ngày tải lên: 14/08/2014, 19:22
Báo cáo sinh học: " Streamlined design of a self-inactivating feline immunodeficiency virus vector for transducing ex vivo dendritic cells and T lymphocytes" ppsx
... Viral and genomic RNAs were treated with RNase-free DNase (Qiagen) to eliminate residual DNA Presence of p∆env1 plasmid and RNA transcripts in super-natants and transduced cells was investigated ... Rev/RRE system was replaced by a CTE and in pGP-RRE pGP-RRE was maintained and Rev provided in trans by cotransfection of pcDNA-RRE plasmid (Fig 1B–1D) Safety evaluation of packaging and vector constructs ... Vannucci, Alessia Ravani, Francesca Bonci, Flavia Chiuppesi, Barbara Del Santo, Giulia Freer and Mauro Bendinelli Address: Retrovirus Center and Virology Section, Department of Experimental Pathology,
Ngày tải lên: 14/08/2014, 19:22
lexical reiteration in the language of ict product advertisements a comparative study in english and vietnamese = lặp từ vựng trong ngôn ngữ quảng cáo sản phẩm công nghệ thông tin và truyền thông
... not cover all the aspects of an advertisement; it states the form and the purpose of an advertisement only According to the American Marketing Association (AMA), an advertisement is “Any announcement ... Advantages and disadvantages of means of advertising Trang 151.2.2 Features of advertising language Advertisers use various linguistic means at their disposal to attract target audience‟s attention ... of language, advertising language should be concise and attractive simultaneously with certain syntactical characteristics This part will cover sentential and clausal features employed in advertisements
Ngày tải lên: 02/03/2015, 14:32
On applying network coding to wireless ad hoc networks a study of robustness, efficiency and cross layer synergy
... capitalizing onthe synergy between network layer and application layer The availability ofcross-layer information can greatly help both in network layer and in applicationlayer By taking the offered ... coding Trang 12benefits Instead, it should plan ahead and avoid cases when some packets thatcould have been coded are left behind with no coding counterpart Thus, apractical coding-aware packet ... getting a higher overall throughput ar-Our work provides us with a means for intermediate nodes to sense the arrival of a new flow and to participate in the maintenance phase In the maintenance phase,
Ngày tải lên: 09/09/2015, 11:24
Impacts of a firms technological diversification on product diversification and performance
... diversification and product diversification (Cantwell and Fai, 1999; Fai and Cantwell, 1999; Fai and von Tunzelmann, 2001; Cantwell, 2004; Suzuki and Kodama, 2004; Miller, 2004; Gambardella and Torrisi, ... implications for strategic management issues (e.g., organizational structure, scope, and performance) (Granstrand and Sjolander, 1990; Argyres, 1996; Granstrand et al., 1997; Gambardella and Torrisi, ... literature Managing a diversified technological base could raise as many challenges and implications for a firm as managing a diversified product portfolio (Torrisi and Granstrand, 2004) For example,
Ngày tải lên: 09/10/2015, 11:06
A study on lexical and syntactic features of cosmetic product advertisements in english and their vietnamese equivalents
... product, but ads also increase the overall market for a class of products For example, a woman who sees an advertisement for mascara might not buy that particular brand of mascara, but would still ... their product as a solution to the insecurity Many people are acutely aware that their Trang 36personal appearance can have a significant effect on how they are regarded and treated by others Advertisement ... because it can reach an audience anywhere, at home, on the road or in the office Two advantages of radio advertising are that radio advertising costs less and people can hear it while they are
Ngày tải lên: 24/06/2016, 21:32
Ethical Banking And Finance: A Theoretical And Empirical Framework For The Cross-Country And Inter-Bank Analyis Of Efficiency, Productivity, And Financial Performance
... Trang 29ank of Britain (IBB), the first stand-alone full-fledged Islamic commercial bank in the West, against small and large conventional banks in the UK and also against small and large Islamic ... include debt-based financing modes such as: Murabaha, Salam, Istisnaa and Leasing (i.e, pure Ijarah and Ijarah & Iqtina) and referred to as “fixed return financing based on the “mark-up” or ... out relative to small conventional banks in both countries on the one hand, and also relative to small and large Islamic commercial banks from GCC-States, Malaysia, Turkey, and Azerbaijan, on
Ngày tải lên: 10/12/2016, 22:57
Bạn có muốn tìm thêm với từ khóa: