... Two Matrices and Their Applications in the Algebraic Riccati Equation Jianzhou Liu and Juan Zhang Department of Mathematics and Computational Science, Xiangtan University, Xiangtan, Hunan 411105, ... the pair A, R is stabilizable, and the pair Q, A is observable. In practice, it is hard to solve the ARE, and there is no general method unless the system matrices are special and there are ... application in the algebraic Riccati equation. Finally, numerical examples have illustrated that our results are effective and superior. Copyright q 2009 J. Liu and J. Zhang. This is an open access
Ngày tải lên: 22/06/2014, 02:20
... efficiencies of both wild type (VA) and various mutants [VA(AC2M), VA(AC4M) and VA(AC2MAC4M)] of VA/ToLCV constructs in tomato plants (A) Total DNA was isolated from the tomato leaves agroinfiltrated ... Forward: 5'-AAGCTTAACATGGTGGAGCAC-GACACTC-3', and Reverse 5'-GAATTCGTCACTGGATTTT-GGTTTTAG-3') and was cloned in the pCAMBIA1391Z vector at the HindIII - EcoRI site Next, the CR-AC3 frag-ment of ... Trang 1Open AccessResearch A geminiviral amplicon (VA) derived from Tomato leaf curl virus (ToLCV) can replicate in a wide variety of plant species and also acts as a VIGS vector Prerna Pandey,
Ngày tải lên: 12/08/2014, 04:20
Báo cáo y học: " Coordinate enhancement of transgene transcription and translation in a lentiviral vector" pps
... Page 7 of 10 (page number not for citation purposes) ison, WI) was amplified by PCR with primers (5'TTTTTATCGATAAGCTCAATATTGGCCATATTATTCAT TGG3' and 5'TTTTCATATGCAGTTGTTACGACATTTTGGAAAG3') ... data analysis, and the preparation of the manuscript. All authors read and approved the final manuscript. Acknowledgements This work was supported by National Institutes of Health National Cancer ... that SNV PCE increases the translational effi- ciency of lentiviral vector transgene mRNA. In addition, we reasoned that coordinate enhancement of transgene transcription and translation has
Ngày tải lên: 13/08/2014, 09:21
Báo cáo sinh học: "The use of retroviral vectors for gene therapy-what are the risks? A review of retroviral pathogenesis and its relevance to retroviral vector-mediated gene delivery" pptx
... Australia, 2 Department of Paediatrics, University of Adelaide, South Australia, 5005, Australia and 3 Department of Biotechnology, Flinders University, GPO Box 2100, Adelaide, South Australia, 5001, ... 5001, Australia Email: Donald S Anson* - donald.anson@adelaide.edu.au * Corresponding author Abstract Retroviral vector-mediated gene transfer has been central to the development of gene therapy ... some of Separation of the cis and trans functions of a retrovirus in a recombinant, replication defective vector system Figure 2 Separation of the cis and trans functions of a retrovi-rus in a
Ngày tải lên: 14/08/2014, 19:22
Báo cáo sinh học: " Streamlined design of a self-inactivating feline immunodeficiency virus vector for transducing ex vivo dendritic cells and T lymphocytes" ppsx
... Viral and genomic RNAs were treated with RNase-free DNase (Qiagen) to eliminate residual DNA Presence of p∆env1 plasmid and RNA transcripts in super-natants and transduced cells was investigated ... Rev/RRE system was replaced by a CTE and in pGP-RRE pGP-RRE was maintained and Rev provided in trans by cotransfection of pcDNA-RRE plasmid (Fig 1B–1D) Safety evaluation of packaging and vector constructs ... Vannucci, Alessia Ravani, Francesca Bonci, Flavia Chiuppesi, Barbara Del Santo, Giulia Freer and Mauro Bendinelli Address: Retrovirus Center and Virology Section, Department of Experimental Pathology,
Ngày tải lên: 14/08/2014, 19:22
lexical reiteration in the language of ict product advertisements a comparative study in english and vietnamese = lặp từ vựng trong ngôn ngữ quảng cáo sản phẩm công nghệ thông tin và truyền thông
... not cover all the aspects of an advertisement; it states the form and the purpose of an advertisement only According to the American Marketing Association (AMA), an advertisement is “Any announcement ... Advantages and disadvantages of means of advertising Trang 151.2.2 Features of advertising language Advertisers use various linguistic means at their disposal to attract target audience‟s attention ... of language, advertising language should be concise and attractive simultaneously with certain syntactical characteristics This part will cover sentential and clausal features employed in advertisements
Ngày tải lên: 02/03/2015, 14:32
Design of broadband vector sum phase shifters and a phased array demonstrator
... various modern radars and wireless communication systems for space, airborne, surface and ground-based applications There are generally two types of phased arrays: passive and active phased arrays ... further analyze the behavior of the phased array demonstrator and its beam pattern The phased array demonstrator can be modified to use a different radiating element such as the wideband Vivaldi antenna ... with increased array complexity and cost Thus comparing with passive arrays, active arrays can provide added system capability and reliability but are generally more complex and expensive As the
Ngày tải lên: 01/10/2015, 17:27
Impacts of a firms technological diversification on product diversification and performance
... diversification and product diversification (Cantwell and Fai, 1999; Fai and Cantwell, 1999; Fai and von Tunzelmann, 2001; Cantwell, 2004; Suzuki and Kodama, 2004; Miller, 2004; Gambardella and Torrisi, ... implications for strategic management issues (e.g., organizational structure, scope, and performance) (Granstrand and Sjolander, 1990; Argyres, 1996; Granstrand et al., 1997; Gambardella and Torrisi, ... literature Managing a diversified technological base could raise as many challenges and implications for a firm as managing a diversified product portfolio (Torrisi and Granstrand, 2004) For example,
Ngày tải lên: 09/10/2015, 11:06
A study on lexical and syntactic features of cosmetic product advertisements in english and their vietnamese equivalents
... product, but ads also increase the overall market for a class of products For example, a woman who sees an advertisement for mascara might not buy that particular brand of mascara, but would still ... their product as a solution to the insecurity Many people are acutely aware that their Trang 36personal appearance can have a significant effect on how they are regarded and treated by others Advertisement ... because it can reach an audience anywhere, at home, on the road or in the office Two advantages of radio advertising are that radio advertising costs less and people can hear it while they are
Ngày tải lên: 24/06/2016, 21:32
Integrated design of a product family and its assembly system
... design stage Ap after the prel iminary desig n of MagSyst and Box Ap after the pre limi nary desig n for the PF Co ncl usions DETAILED DFA AND AP I A detailed DFA principle for PFS: sta ndardisation ... process and assembly met hod se lection Deta iled AP of the FEns Modification of the ge neric liaison graph Mo dificat ion of the AP of the FEns Ar- and DFA: releasing PCs Modification of the AP for ... Author name: DeLit Title of book: Integrated Design of a Product Family ISBN number: 1402074379 Integrated design of a product family and its assembly system INTEGRATED DESIGN OF A PRODUCT FAMILY
Ngày tải lên: 17/01/2020, 08:51
Integrated design of a product family and its assembly system
... structuring and standardisation 2.4 Preliminary OFA rules 2.5 Summary of the approach 3 Case stud y 3.1 Before the appl ication of the OFA 3.2 Application of the OFA 1.9 FEns and design teams 1.10 ... optimisation and then consid-ering part fabrication and assembly, this approach considers manufacturabilityand design goals, product and process plan together with ease of assembly andcomponent fabrication, ... grouping ofend products requiring similar raw materials and manufacturing processes.An essential characteristic of the family is that all end products share nearidentical features regarding their production
Ngày tải lên: 20/01/2020, 14:49
Integrated design of a product family and its assembly system
... design stage Ap after the prel iminary desig n of MagSyst and Box Ap after the pre limi nary desig n for the PF Co ncl usions DETAILED DFA AND AP I A detailed DFA principle for PFS: sta ndardisation ... process and assembly met hod se lection Deta iled AP of the FEns Modification of the ge neric liaison graph Mo dificat ion of the AP of the FEns Ar- and DFA: releasing PCs Modification of the AP for ... Author name: DeLit Title of book: Integrated Design of a Product Family ISBN number: 1402074379 Integrated design of a product family and its assembly system INTEGRATED DESIGN OF A PRODUCT FAMILY
Ngày tải lên: 02/03/2020, 12:21
Lexical reiteration in the language of ICT product advertisements a comparative study in english and vietnamese
... a special branch of language, advertising language should be concise and attractivesimultaneously with certain syntactical characteristics This part will cover sententialand clausal features ... explore advertising language in general and that of ICT productadvertisements in particular Leech (1966) examines standard advertising language in his research “English in Advertising: A Linguistic ... removal advertisement)The poster designed by Hanumanth, a user interface designer at Singapore-basedHewlett-Packard impressed the audience by the image of a man taking a nap in ahammock on the beach,
Ngày tải lên: 08/11/2020, 14:58
Improving product quality and quality management system to enter polish market a case study of a vietnamese garment factory
... types of shapes in a flow chart are (Wikipedia, 2020): rectangular box and diamond box Ishikawa diagrams (also called fishbone diagrams or cause-and-effect diagrams) are causal diagrams created ... learn and improve the Japanese way of becoming a total quality management (TQM) system (Yang, 2017) Total quality management is seen as a performance management approach both tangible and intangible ... Abundant and cheap human resources are a great driver of a competitive advantage in the market when creating more products at cheaper prices These features are advantages that are not available
Ngày tải lên: 12/05/2022, 11:04
(LUẬN VĂN THẠC SĨ) Lexical reiteration in the language of ICT product advertisements A comparative study in English and Vietnamese
... unchecked or marked as spam Figure 1: Advantages and disadvantages of means of advertising Advertisers employ a range of linguistic techniques to capture the attention of their target audience This ... Virus and Spyware removal service, user interface designer Hanumanth from Hewlett-Packard in Singapore showcases an image of a relaxed man napping in a beach hammock This visual conveys a sense of ... decision-making process, and raises awareness among target audiences about available options Ultimately, advertising benefits producers, educates consumers, and acts as a vital link between them.Advertisements
Ngày tải lên: 28/06/2022, 08:37
mountain product of high biological quality meadows poliflora organic fertilizer and a sustainable mountain economy
... – with an essential role in the formation and maintenance of natural polifloral of mountain grasslands and hayfields.By grasslands, hayfields, cattle,sheep and organic fertilizers it was possible ... grasslands and hayfields Fig 2: Biodiversity in a natural meadow • Romanian Carpathians are one of the great mountain ranges of Europe, being living mountains and the mountain farmers - local ... from ruminant animals have a special importance: -Sheep(goats) -play a major rolein the formation and improvement ofgrasslandsandhayfields (anaerobic fermentation, alkalinity, scattering without
Ngày tải lên: 02/11/2022, 14:40
Comparison of support vector machine and neutral network classification method in hyperspectral mapping of ophiolite mã©langes–a case study of east of iran
... hyperspectral map of coral reefs of Buck Island in central Atlantic Ocean And, using EO-1 satellite data,Beiranvand Pour and Hashim (2011)have prepared the geological map of the southeast-ern part of the ... composed of plagioclase microlites and small crystals of amphiboles and opac minerals In the samples, plagioclases are altered into serisite and carbonate and to a lesser amount to kaolinite and epidote ... image bands using Kernells and, finally, atmospheric correction In organization and filtration of image bands, 87 bands of the total 242 imaged bands wave wiped out due to unsuitable quality of
Ngày tải lên: 19/11/2022, 11:46
topic please work in your groups and construct a report regarding the marketing aspects of a corporation brands product service
... market and attract more customers.Third, the demand for quality products that are beneficial and healthy is increasing Companies that are recognized for food safety standards can take advantage ... https://vtv.vn/xa-hoi/het-nam-2020-dan-so-viet-nam-la-bao-nhieu-20201227164252118.htm * Natural factors: A favorable climate is an advantage for Vinamilk's business, it is a conditionthat helps Vinamilk grow high-quality grasslands and raise dairy cows One Trang 8place chosen ... shareholders and the market The management structure of Vinamilk extends beyond the Board of Directors and Executive Board to encompass departments and divisions at each manufacturing plant and branch Each
Ngày tải lên: 06/05/2024, 15:00
a comparison of organizational factors influencing new product success in internal and alliance based products
... hospitals as professional bureaucracies where exist a core of professionals with a great degree of autonomy and power Control in such organizations is based on bureaucracy and a system of shared values ... fundamental clash between the “ logic of innovation” and the “ logic ofalliances Alliances succeed when goals and responsibilities of partners are clearly detailed (Hausler,Hohn, and Lutz 1994; and ... environmental perceptions frominformants failed.’Successful Alliances The study of alliances is relatively recent, yet a body of empirical understanding has begun toaccumulate (cf Varadarajan and Cunningham
Ngày tải lên: 12/05/2024, 21:58
Luận án tiến sĩ Quản trị kinh doanh: Design and management of a perishable product supply chain in Mekong Delta of Vietnam – a case study of sweetpotato in Vinh Long Province
... 10,500ha-13,900ha concentrated in the communes of Thanh Loi, Thanh Dong, Thanh Hung, Tan Thanh, Tan Hung, Tan Luoc, and TanAn Thanh and a part of My Thuan and Nguyen Van Thanh communes The average productivity ... choosing location, and also handle decision-making problems, vagueness and uncertainty in criteria and has the advantages of easy to use and flexibility.Together with analytical solutions obtained ... such as Japan, South Korea, and Australia.According to the General Statistics Office, the total sweet potato planted area in Vietnam has decreased from 150.8 thousand ha in 2010 to 116.5 thousand
Ngày tải lên: 02/10/2024, 01:18
Bạn có muốn tìm thêm với từ khóa: