... SPECIFICATIONS OF EXPERIMENTAL CIRCUIT FOR POWER FLOW A1 CONTROL Transformer power rating Transformer voltage rating Transformer rated excitation current Inductor rating MERS Capacitor rating Virtual ... faster than the increase C Steady State Current Flow Control The relationship between the loop current flow and the primary control set-point, Uset, was investigated for three different power supply ... Feedback Control In order to test a simple secondary control system with the given primary control, a current flow control loop was implemented as illustrated in Fig 16 The q-axis current calculated...
Ngày tải lên: 15/10/2013, 16:12
... the higher local recurrence since the patients were well matched in respect of these prognostic factors Such factors may be either patient-related or treatment-related Patient-related factors ... chemo-radiation resulting in local tumor control (LC) rates and disease-free survival (DFS) in HIV-seronegative patients approaching 72 % and 73 %, respectively [5-7] Few data exist on treatment ... and the Union International Contre le Cancer (UICC) before the primary treatment [19] Post-treatment evaluation included a clinical examination including digital palpation at each visit and regular...
Ngày tải lên: 09/08/2014, 10:21
Hidria Air flow control units
... Manual control B Power driven but without actuator B1 Actuator LM 24A ActuatorLM 230A Actuator LM 24A SR (continous regulation) AIR FLOW CONTROL UNITS 200 SOUND ATTENUATORS, SOUND ATTENUATING ... VENTILATING GRILLES, VENTILATING VALVES wire control AIR DISPLACEMENT UNITS Continuous wire control AIR FLOW CONTROL UNITS wire control SOUND ATTENUATORS, SOUND ATTENUATING LOUVRES wire control ... ELEMENTS L AIR FLOW CONTROL UNITS V SOUND ATTENUATORS, SOUND ATTENUATING LOUVRES 100 V 50 Size SUPPLY AIR NOZZLES The controller can be installed at any location of the ventilation system Access...
Ngày tải lên: 02/06/2015, 08:11
STUDY OF LOCAL ENVIRONMENTAL CONTROL OF ROOT SYSTEM ARCHITECTURE
... constant high nitrate growth environment reduces lateral root elongation, while temporary exposure to high nitrate concentration induces lateral root elongation in plants grown in low nitrate condition ... signal that regulates the differential elongation of epidermal tissues on the apical and basal sides under gravity stimulation and differential auxin localization is dependent on transportation ... al., 2009) These data indicates that auxin polar transporters are important in regulating root gravitropic responses 1.3.3 Nutrients Nutrients such as nitrate, phosphate, sulfate and iron are...
Ngày tải lên: 10/09/2015, 09:28
Slide môn học PHP session 2d flow control in PHP
... Jump Statements Controls the execution of the loop statements Different jump statements are: break statement continue statement exit statement PHP / Session / Slide 18 of 29 Break Statement ... for break statement - II Here, the break statement is used with the for loop The condition is specified in the if statement The break statement controls the loop If the break statement is ... Conditional statements execute a set of statements only when a specified condition is satisfied if statement executes a block of code only when the specified condition is true switch statement executes...
Ngày tải lên: 30/11/2016, 22:11
báo cáo khoa học: " A cluster randomized controlled trial aimed at implementation of local quality improvement collaboratives to improve prescribing and test ordering performance of general practitioners: Study Protocol" docx
... required data format This format is based on rational criteria for laboratory test registration to facilitate the integration of the individual databases into one main database All datasets on diagnostics ... http://www.implementationscience.com/content/4/1/6 division into levels as a parameter for pre-randomization stratification To determine the critical conditions for effective nationwide implementation Participation ... the prescriptions database Randomization LQIC groups will be randomized as such (cluster randomisation) The intervention is aimed at these groups Pre-randomization stratification will be performed...
Ngày tải lên: 11/08/2014, 16:21
Combined flow prediction and reservoir control system optimizes production at Hoa Binh docx
... Optimization of reservoir rule curves The control variables to be optimized consist of the reservoir water level curves and water level targets at the flood control point at Hanoi The operation ... is adopted for simulating the flow in the river system and reservoir operations The structure operation module in MIKE 11 allows for the implementation of complex control strategies, whereby reservoirs ... numerical optimization tool that is used to optimize different control variables defined for the reservoir operation strategies The optimization tool includes a general multi-objective optimization framework...
Ngày tải lên: 13/08/2014, 22:21
Combined flow prediction and reservoir control system optimizes production at Hoa Binh ppt
... Optimization of reservoir rule curves The control variables to be optimized consist of the reservoir water level curves and water level targets at the flood control point at Hanoi The operation ... sluice gates, spillways and turbines, are specified as control structures in MIKE 11 The control structures are implemented with control strategies which determine how the structures are operated, ... the water level at a downstream flood control point in Hanoi The operations consist of specifying the discharge through turbines as well as opening and closing bottom gates and spillways The control...
Ngày tải lên: 13/08/2014, 22:21
C++ Basics - More Flow of Control
... following ways to specify flow of control if-else-statements while-statements do-while-statements New methods described in this chapter include switch-statements for-statements Copyright ... Pearson Education, Inc Publishing as Pearson Addison-Wesley Slide 3- 18 Function appropriate To use function appropriate in the if-statement if (appropriate (rate)) { … } appropriate could be ... bool appropriate(int rate) { return (((rate >=10) && ( rate < 20)) || (rate == 0)); } Copyright © 2007 Pearson Education, Inc Publishing as Pearson Addison-Wesley Slide 3- 19 Enumeration Types...
Ngày tải lên: 12/09/2012, 22:47
Formation of Aerobic Granular Sludge in a Continuous-Flow Reactor – Control Strategy for the Selection of Well-Settling Granular Sludge
... 0.8 Aeration rate (L/min) Fig - Sludge washout index under different surface loading and aeration rates Formation of Aerobic Granular Sludge by Controlling Surface Loading and Aeration Rates Surface ... feeding pattern, i.e continuous flow and sequencing batch flow modes, on the formation of aerobic granular sludge was investigated MATERIALS AND METHODS Reactor Configuration In this study, AUFB reactors ... 100 Time [day] Fig - Time courses of MLVSS at two operational modes (a) Continuous flow mode (Run 1) Aeration rate [L/min] 0.30 0.50 500 Aeration rate [L/min] 0.30 0.50 SVI [1 min] SVI [30 min]...
Ngày tải lên: 05/09/2013, 10:15
Controlling Program Flow
... requires an interest rate that’s nonnegative (a mathematical law) and less than some maximum (a judiciary law — we can only wish that credit cards had an interest rate limit) This if statement uses the ... interest rate is // negative, then generate an error message // and don’t proceed with the calculation using System; namespace CalculateInterestWithEmbeddedTest { public class Program { public static ... the flow of execution The three basic types of flow control are the if statement, the loop, and the jump I describe one of the looping controls, the foreach, in Chapter Controlling Program Flow...
Ngày tải lên: 04/10/2013, 21:20
Tài liệu Controlling a Script''''s Flow docx
... the statement are executed; if the circumstance is false, the actions are ignored When you create an if statement, you state, essentially: if ( what is shown here is true) { Do this; } The data ... values for each case in the structure If a match exists, the block of code associated with that case is executed If no match is found, the default statement at the end is executed break is used in ... statement is executed (because a value of 450 is greater than 300) If money has a value less than 300, both parts of this statement are ignored You can create several lines of if/else if statements...
Ngày tải lên: 14/12/2013, 22:15
Tài liệu controlling flow in PL / SQL pdf
... Executes a statement or sequence of statements conditionally Basic loop Repeats a statement or sequence of statements indefinitely EXIT statement Terminates a loop FOR loop Repeats a statement or ... for iterative control of actions based upon a count D WHILE loops to provide iterative control of actions based on a true statement D EXIT statement to terminate loops For more information, see ... This uncontrolled loop is an infinite loop that is to be avoided To avoid an infinite loop, add an EXIT statement The EXIT Statement You can terminate a loop using the EXIT statement Control...
Ngày tải lên: 21/12/2013, 06:17
Tài liệu Local Switch Security for Controlled User Access ppt
... security for local AAA authentication a Configure the security for local authentication ALSwitch(config)#aaa new-model ALSwitch(config)#aaa authentication login default local b Configure the local user ... security for local AAA authentication a Configure the security for local authentication DLRouter(config)#aaa new-model DLRouter(config)#aaa authentication login default local b Configure the local user ... nonegotiate dot1q 1-1005 trunk 2/2 nonegotiate dot1q 1-1005 trunk 2/3 nonegotiate dot1q 1-1005 spantree portfast 2/4 enable port channel 2/1-2 mode on Configure local security You will notice that...
Ngày tải lên: 21/12/2013, 19:15
Tài liệu Báo cáo khoa học: Neuropeptide Y and osteoblast differentiation – the balance between the neuro-osteogenic network and local control ppt
... sympathetic and parasympathetic innervations [20–24] In adult rats, the calvarial periosteum and diploe were found to be innervated by sympathetic fibers immunoreactive to VIP and NPY, originating ... clearly demonstrating that the inhibitory action of leptin on bone formation is mediated by a central circuit [25] Further supporting the importance of leptin in the control of bone formation, mice ... formation, strongly suggesting that the increased NPY expression in ob ⁄ ob mice does not mediate their increased bone density [25] Moreover, NPY ablation in ob ⁄ ob mice further demonstrated that...
Ngày tải lên: 18/02/2014, 04:20
Tài liệu Báo cáo khoa học: Critical roles of Asp40 at the haem proximal side of haem-regulated phosphodiesterase from Escherichia coli in redox potential, auto-oxidation and catalytic control doc
... 3¢-GAAAAACATCACTTCAGCATTT CGTTAATTAAC-5¢ (reverse); Asp40Asn: 5¢-GGTGTT AATTAACGAAAATAACGAAGTGATGTTTTTCA AC-3¢ (forward); 3¢-GTTGAAAAACATCACTTCGTTA TTTTCGTTAATTAACA-5¢ (reverse) Mutation sites ... and auto-oxidation rates of Ec DOS PAS, and catalytic activities of full-length enzymes We found that the mutations at Asp40 markedly altered the redox potential and auto-oxidation rate Furthermore, ... ensure that the appropriate temperature of the solution was maintained, the reaction mixture was incubated for 10 prior to spectroscopic measurements Titration experiments were repeated at least...
Ngày tải lên: 19/02/2014, 16:20