Tài liệu Báo cáo khoa học: Critical roles of Asp40 at the haem proximal side of haem-regulated phosphodiesterase from Escherichia coli in redox potential, auto-oxidation and catalytic control doc

We generated mutants of Asp40, which forms a hydrogen bond with His77 a proximal haem axial ligand via two water molecules, and a salt bridge with Arg85 at the protein surface.. The crys

Critical roles of Asp40 at the haem proximal side of haem-regulated

auto-oxidation and catalytic control

Miki Watanabe, Hirofumi Kurokawa, Tokiko Yoshimura-Suzuki, Ikuko Sagami and Toru Shimizu

Institute of Multidisciplinary Research for Advanced Materials Tohoku University, Sendai, Japan

In haem-regulated phosphodiesterase (PDE) from

Escheri-chia coli(Ec DOS), haem is bound to the PAS domain, and

the redox state of the haem iron regulates catalysis by the

PDE domain We generated mutants of Asp40, which forms

a hydrogen bond with His77 (a proximal haem axial ligand)

via two water molecules, and a salt bridge with Arg85 at the

protein surface The redox potential of haem was markedly

increased from 67 mV vs the standard hydrogen electrode in

the wild-type enzyme to 95 mV and 114 mV in the Ala and

Asn mutants, respectively Additionally, the auto-oxidation

rate of Ec DOS PAS was significantly increased from

0.0053 to 0.051 and 0.033 min)1, respectively Interestingly, the catalytic activities of the Asp40 mutants were abolished completely Thus, Asp40 appears to play a critical role in the electronic structure of the haem iron and redox-dependent catalytic control of the PDE domain In this report, we discuss the mechanism of catalytic control of Ec DOS, based on the physico-chemical characteristics of the Asp40 mutants

Keywords: auto-oxidation; haem axial ligand; haem sensor; phosphodiesterase; redox potential

Haem-regulated phosphodiesterase (PDE) from

Escheri-chia coli (Ec DOS) is a haem sensor enzyme composed

of two functional domains: an N-terminal haem-bound

sensor domain and a C-terminal PDE catalytic domain

[1,2] Catalysis by this enzyme is regulated by the haem

redox state in that PDE is functional in the Fe(II)

haem-bound enzyme, but not the Fe(III) haem-haem-bound enzyme

[2,3] The crystal structure of the haem-bound domain

revealed a typical PAS structure [4,5] PAS proteins

display a characteristic three-dimensional structure with a

glove-like fold consisting of five juxtaposed b-sheets and

flanking a-helices [6–9] The characteristic

three-dimen-sional structure of the PAS domain is commonly used

for discussing the signal transduction mechanism of

numerical signal transducing enzymes [6–9] The crystal

structures of both the Fe(II) and Fe(III) forms of the

isolated haem-bound PAS domain (Ec DOS PAS)

disclose that haem axial ligand switching from His77/ hydroxide anion to the His77/Met95 ligand pair occurs upon haem reduction Moreover, haem ligand switching induces conformational changes in the FG loop region and movement of two subunits These structural changes may play critical roles in catalytic regulation of the PDE domain [4]

Structures of the haem-bound PAS domain have been reported under various conditions, and structure–function relationships are well documented [8–14] FixL is an oxygen sensor enzyme with a haem-bound PAS domain Specific-ally, O2association/dissociation to/from the haem switches off/on catalysis [8,9] Global structural changes at the haem distal side are induced upon O2binding to FixL, and these changes contribute significantly to intramolecular signal transduction [9–11] For Ec DOS, site-directed mutations at Met95, the axial ligand at the distal side in the Fe(II) complex, induced significant changes in the redox potential

of the haem, rate constants of CO, O2and CN binding to haem, and CD spectra in the Soret region [15–18], suggesting that this residue is critical for maintaining the electronic states of haem and ligand access channel However, the catalytic activities of Met95 mutants were comparable to those of wild-type [14], implying no direct involvement in the catalytic control of Ec DOS A number

of site-directed mutagenesis [2,3,16] and crystallographic [4,5] studies show that His77 is the proximal axial ligand of haem Therefore, a residue interacting with His77 may play

an important role in regulation of catalysis Ec DOS forms hydrogen networks at the haem proximal side (Fig 1) including the Asp40 residue that interacts with His77 via two water molecules and Arg85 at the protein surface [4]

In the present study we generated Asp40Ala and Asp40Asn mutants and analysed their physico-chemical

Correspondence to T Shimizu, Institute of Multidisciplinary Research

for Advanced Materials, Tohoku University, 2-1-1 Katahira,

Aoba-ku, Sendai 980-8577, Japan Fax: +81 22 217 5604/5390,

Tel.: +81 22 217 5604/5605 E-mail: shimizu@tagen.tohoku.ac.jp

Abbreviations: PDE, phosphodiesterase; Ec DOS, full-length

haem-bound phosphodiesterase from Escherichia coli or a redox sensor from

Escherichia coli; PAS, an acronym formed from the following names:

Drosophila period clock protein (PER), vertebrate aryl hydrocarbon

receptor nuclear translocator (ARNT) and Drosophila single-minded

protein (SIM); FixL, an oxygen sensor haem protein from Rhizobia

melilori; ant-cAMP, 3¢,5¢-cyclic monophosphate, 2¢-O-anthraniloyl;

Ec, DOS PAS, isolated haem-bound PAS domain of Ec DOS;

SHE, standard hydrogen electrode.

(Received 20 June 2004, revised 9 August 2004,

accepted 12 August 2004)

characteristics, including optical absorption spectra, cyanide

binding, redox potential and auto-oxidation rates of

EcDOS PAS, and catalytic activities of full-length

enzymes We found that the mutations at Asp40 markedly

altered the redox potential and auto-oxidation rate

Fur-thermore, PDE activity was completely abolished in the

Asp40 mutants To our knowledge, this is the first report

showing that mutations in the haem environment

substan-tially influence the catalytic activity of haem-bound

EcDOS

Experimental procedures

Materials

The expression vector, pET28a(+) was from Novagen

E colicompetent cells, XL1-blue (for cloning), and BL21

(for protein expression) were purchased from Stratagene

Site-directed mutagenesis was performed using the

Quikchange Site-Directed Mutagenesis KitTM(Stratagene)

with the following oligonucleotides: Asp40Ala:

5¢-TGTTAATTAACGAAAATGCTGAAGTGATGTTTT

TC-3¢ (forward); 3¢-GAAAAACATCACTTCAGCATTT

CGTTAATTAAC-5¢ (reverse); Asp40Asn: 5¢-GGTGTT

AATTAACGAAAATAACGAAGTGATGTTTTTCA

AC-3¢ (forward); 3¢-GTTGAAAAACATCACTTCGTTA

TTTTCGTTAATTAACA-5¢ (reverse) Mutation sites are

shown in italics Oligonucleotides were synthesized by the

Nihon Gene Research Laboratory (Sendai, Japan)

Restric-tion and modificaRestric-tion enzymes were from Takara Bio (Otsu,

Japan), Toyobo, New England Biolabs and Nippon Roche

K.K The fluorescence substrate, adenosine 3¢,5¢-cyclic

monophosphate, 2¢-O-anthraniloyl (ant-cAMP) was from

Calbiochem Calf intestine alkaline phosphatase was from

Takara Bio DEAE Sephadex was from Amersham

Biosciences Other chemicals were from Wako Pure

Chemicals

Expression and purification ofEc DOS wild-type and Asp40 mutant proteins

Expression and purification procedures were performed as described previously [2,3] Purified proteins were more than 95% homogenous, as verified by SDS/PAGE Yields of

EcDOS and Ec DOS PAS from 1 L E coli culture were

210 nmol and 610 nmol, respectively, in terms of haem absorbance at 417 nm [2,3]

Optical absorption spectra Spectral experiments were performed under aerobic condi-tions on Shimadzu UV-1650, UV-2500 and Hitachi U-2010 spectrophotometers maintained at 25C using a tempera-ture controller [2,3,15,17,18] Anaerobic spectral experi-ments were conducted in the glove box of a Shimadzu UV-160 A spectrophotometer Following reduction of the haem by sodium dithionite, excess dithionite was removed

in the glove box by using a Sephadex G25 column To ensure that the temperature of the solution was maintained

at 25C, the reaction mixture was incubated for 10 min prior to spectroscopic measurements

Cyanide binding The association rate of cyanide to haem was observed by monitoring changes at 417 nm in spectra of the haem protein in 50 mMTris/HCl pH 7.5, as described earlier [17] Redox potential

Anaerobic spectral experiments on Ec DOS PAS proteins were performed in the glove box on a Shimadzu UV-160 A spectrophotometer and an ORION Research (Tokyo, Japan) Model 701 digital pH meter equipped with a TOA (Tokyo, Japan) ORP gold/calomel combination microelec-trode Redox potentials were measured using the same apparatus 2,3,5,6-Tetramethyl phenylenediamine (5 lM), N-ethyl phenazonium ethosulfate (5 lM) and 2-hydroxy-1,4-naphthaquinone (5 lM) were added as mediators to the wild-type protein solution before titration [2,15] The concentration of haem protein used was 15 lM Spectral changes in intensity at 563 nm accompanying redox changes were monitored, as dye absorption hampers the detection of Soret spectral changes To ensure that the appropriate temperature of the solution was maintained, the reaction mixture was incubated for 10 min prior to spectroscopic measurements Titration experiments were repeated at least three times for each complex

Auto-oxidation rate

To measure auto-oxidation rates, Ec DOS PAS proteins were reduced with sodium dithionite in 50 mM Tris/HCl

pH 7.0 containing 1 mM EDTA Excess dithionite was removed in the glove box using a Sephadex G-25 column After removal from the glove box, the mutant was diluted to 1 mL with 50 mM potassium phosphate

pH 7.0 containing 1 mM EDTA The auto-oxidation rates of Asp40Ala and Asp40Asn mutants were meas-ured at 25C Oxidation of the sample was observed by

Fig 1 Structure of ferric Ec DOS PAS (PDB code 1V9Y) Asp40

interacts with the imidazole ring of His77 via two water molecules (W3,

W4) Asp40 additionally forms a salt bridge with Arg85 at the surface

of the molecule The hydrogen bonds and flexible FG loop are depicted

by black dotted and cyan broken lines, respectively The figure was

obtained using PYMOL [20].

recording entire visible spectra or monitoring the decrease

in absorbance at a single wavelength (567 nm) on a

Hitachi U-2010 spectrometer All auto-oxidation

reac-tions were characterized by only two spectral species with

sharp isosbestic points, and the time course patterns

revealed a simple first-order process under each set of

conditions

Enzymatic assay

Full-length Ec DOS protein was incubated at 37C with

ant-cAMP in a reaction mixture of 500 lL containing

50 mMTris/HCl pH 8.5 and 2 mMMgCl2in a glove box

under a nitrogen atmosphere with an O2 concentration

< 50 p.p.m., as described previously [2,3] At least five

experiments were conducted to obtain each value

Results

Optical absorption spectra

Figure 2 depicts the optical absorption spectra of Fe(III),

Fe(II) and Fe(II)-CO complexes of the Asp40Ala and

Asp40Asn mutants Table 1 summarizes the spectral

absorption maxima of these complexes Despite subtle

differences in the spectral maxima in the visible region of

the Fe(III) species, spectra of the Asp40 mutants were

essentially similar to that of the wild-type protein Additionally, spin states of the Fe(III), Fe(II) and Fe(II)-CO complexes of Asp40 mutants were similar to those of the wild-type enzyme in that all mutant proteins were in the six-coordinated low-spin state Therefore, we propose that Asp40 mutations do not significantly affect the haem environment or coordination structures More-over, these mutants are suitable for further spectral and catalytic characterization

Cyanide binding Kinetic and equilibrium studies on cyanide binding provide valuable information on the haem distal structure of

EcDOS PAS [17] As the structure of the cyanide-bound complex of FixL is similar to that of its oxygen-bound complex [10], a cyanide binding study should facilitate elucidation of the structure and catalytic mechanism of

EcDOS Cyanide-bound Fe(III) complexes of the Asp40 mutants displayed optical absorption spectra containing a sharp Soret peak at 421 nm and a broad visible band around 540 nm (data not shown), analogous to that of the wild-type enzyme [17] Optical absorption changes observed for both the Asp40 mutants upon cyanide binding were composed of only one phase The first-order rate constants for cyanide binding to Asp40 mutants were dependent on the cyanide concentration The rates of cyanide association to the Asp40Ala and Asp40Asn mutants were 0.065 and 0.073 mM )1Æs)1, respectively, which are only slightly higher than that (0.045 mM )1Æs)1)

of the wild-type protein (Table 2) The data indicate that mutation of Asp40 at the haem proximal side alters the cyanide binding property only slightly, and may not significantly affect the exogenous ligand binding access channel at the haem distal side and/or structure in terms of cyanide binding in the Fe(III) complex

Redox potentials The redox state of haem is related to the PDE activity of

EcDOS, since it is a haem redox-sensing enzyme [2,3] Thus, it is important to determine the redox potentials of the Asp40 mutants of Ec DOS Asp40 mutant proteins were converted from the Fe(III) complex to the Fe(II) complex

by reductive titration, accompanied by clear isosbestic points, similar to previously documented data for the wild-type and Met95 mutant proteins [2,15] Electrochemical reductive titration of the mutant protein is depicted in Fig 3 The redox potential values of the mutants as well as wild-type protein are summarized in Table 2 Marked increases in the redox potential value from 67 mV vs the standard hydrogen electrode (SHE) (wild-type) up to 95 and

114 mV were observed for the Asp40Ala and Asp40Asn mutants, respectively This tendency is opposite to that observed on mutating Met95 at the haem distal site Specifically, Met95 mutations led to significant decreases in redox potential [15] Oxidative titration experiments were additionally conducted No remarkable differences were detected in the potentials between reductive and oxidative titration Accordingly, we propose that Asp40 is located close enough to the haem iron or axial ligand to influence the haem electronic state of Ec DOS

Fig 2 Soret and visible optical absorption spectra of Fe(III) (solid line),

Fe(II) (broken line) and Fe(II)-CO (dotted line) complexes of the

Asp40Ala (upper) and Asp40Asn (lower) mutants of Ec DOS PAS The

small peak seen around 670 nm is occasionally appears when we

purified mutant enzymes It is likely to be a minor component of a

denatured form.

Auto-oxidation rates

As Ec DOS was initially identified as an O2sensor enzyme

[1], we examined the auto-oxidation rates of the Asp40

mutants As shown in Fig 4, semi-logarithmic

time-dependent changes in optical absorption spectra were linear,

and composed of only one phase Auto-oxidation rates and

half-lives of the O2-bound Fe(II) complexes of Asp40

mutants are summarized in Table 2 Marked increases in

the auto-oxidation rate (from 0.0053 min)1 for the

wild-type enzyme up to 0.033 and 0.051 min)1) were observed in

the Asp40 mutants

PDE activity

Electronic states of haem, such as redox potential and

autoxidation rate, largely regulate the PDE activity of

full-length Ec DOS enzyme Interestingly, no PDE activity was

detected for the two Asp40 mutants analysed in this study

This finding is in contrast with data on mutants of Met95 at

the haem distal side, which disclosed no effect on PDE activity [15]

Discussion

The present study reveals an interesting aspect of the structural and functional relationships of Ec DOS Muta-tions at Asp40 did not essentially affect the optical absorption spectra of this enzyme However, Asp40 muta-tions at the haem proximal side significantly altered the redox potential values, auto-oxidation rates, and PDE activities These results aid in elucidating the transduction mechanism of this enzyme

Recent crystal structure analyses of the isolated haem-bound PAS domain indicate that in the Fe(III) complex, a hydroxide anion (or water molecule) is an axial ligand trans

to His77, the endogenous (proximal) axial ligand [4] Upon haem reduction, ligand switching from the hydroxide anion

to the side chain of Met95 is evident at the haem distal side Met95, in turn, becomes the direct axial ligand for the Fe(II) complex trans to His77 [4,5] The haem redox potential value was decreased from +67 mV vs SHE (wild-type) to )26, )1, and )122 mV in the Met95Ala, Met95Leu and Met95His mutants, respectively [15] The auto-oxidation rate was altered from 0.0058 to 0.0013, 0.0017 and 0.018 min)1 in the Met95Ala, Met95Leu and Met95His mutants, respectively [18] Mutations at Met95 also signi-ficantly affect the binding of exogenous ligands, such as the cyanide anion, to the Fe(III) complex [17], and O2and CO

to the Fe(II) complex [18] However, the PDE activities of these mutants are comparable to that of the wild-type enzyme Based on the data, we propose that Met95

Table 2 Cyanide binding rates, redox potentials and auto-oxidation

rates of the Asp40Ala and Asp40Asn mutants of Ec DOS PAS Cyanide

binding rate, experimental errors are within 20%; k ox , autoxidation

rate; t 1/2 , Half life.

Ec DOS PAS

CN

(m M–1Æs)1)

Redox potential (mV vs SHE)

k ox

(min)1)

t 1/2

(min) Wild-type 0.045 67 (n ¼ 0.93) 0.0053 132

Asp40Ala 0.065 95 (n ¼ 0.92) 0.051 14

Asp40Asn 0.073 114 (n ¼ 0.96) 0.033 21

Table 1 Optical absorption spectral maxima (nm) of the Asp40Asn and Asp40Ala mutants of Ec DOS PAS.

Fig 3 Electrochemical reductive titrations of the Asp40Asn mutant of

Ec DOS PAS Changes in absorption intensity were monitored at

563 nm.

Fig 4 Time-dependent optical absorption changes of the Fe(II)-O 2

complexes of Ec DOS PAS wild-type (solid line, ·), Asp40Ala (broken

line,4) and Asp40Asn (dotted line, s) mutants monitored at 578 nm.

modulates the redox potential to relatively high values

(+61 mV), but is not directly involved in catalytic control

and/or interactions with the PDE domain, which are critical

in catalysis

In contrast to data obtained with Met95Ala and

Met95Leu mutants [15–18], Asp40 mutations increased

the redox potentials and auto-oxidation rates The effects of

Asp40 mutations are opposite to those of Met95 mutations

Asp40 mutants are more easily reduced than the wild-type

enzyme, and favour the Fe(II) state to the Fe(III) state

Accordingly, we suggest that Asp mutations alter the haem

environment to a more cationic state, and the Fe(II) state is

more stabilized

The crystal structure of the PAS domain discloses two

water molecules between His77 and Asp40 (Fig 1)

There-fore, the hydrogen bonding network involving His77, two

water molecules and Asp40 should function in regulating

the electronic state affecting the redox potential and

auto-oxidation rate

A signal transduction mechanism for the PAS domain

has been proposed by Crosson et al [19] to explain

catalytic control The investigators suggested that a

well-conserved salt bridge on the surface of PAS proteins is

important in the signal transduction mechanism

Although a conserved salt bridge exists between Glu59

and Lys104 in Ec DOS [4], the roles of these amino acids

remain to be elucidated In Ec DOS, Asp40–Arg85 salt

bridges (Fig 1) appear to be important for catalytic

control Breakage of the salt bridge by mutations at

Asp40 abolishes PDE activity

In a previous report, we proposed that movement of

the FG loop in Ec DOS accompanying haem reduction

regulates the catalytic switch [4] The FG loop is rigidified

in the Fe(II) haem protein, but very flexible in the Fe(III)

haem protein Ec DOS is active only in the Fe(II) haem

form Notably, Asp40 forms a salt bridge with Arg85,

which is located near the FG loop (Fig 1) [4] Mutations

at Asp40 should break the salt bridge with Arg85 It is

possible that these mutations maintain flexibility of the

FG loop, even when the haem is the Fe(II) state, and thus

lead to inactive enzyme (Fig 1) Thus, switching the FG

loop from the
ordered to
disordered form by

substitu-tions at Asp40 may explain the loss of catalytic activity of

these mutant proteins Our recent study showed that

mutations at Trp residues markedly changed fluorescence

intensities, but did not significantly alter the environment

of the haem [21] A single-Trp containing mutant, in

which only one Trp residue is located near or at the FG

loop region, may be useful to analyse flexibility of the FG

loop in Asp40 mutants Our proposal could also be

substantiated by limited proteolysis to see a change in

signals upon haem reduction These studies remain to be

carried out

In summary, mutations at Asp40 markedly alter the

redox potentials, auto-oxidation rates and catalytic

activities of Ec DOS Breakage of the salt bridge between

Asp40 and Arg85, and the hydrogen bond network

consisting of Asp40, two water molecules and His77,

appear to be critical for these significant changes In the

mutants, the FG loop region may become disordered,

even in the Fe(II) state, resulting in a marked decrease in

catalysis

Acknowledgements

This work was supported in part by a Grand-in-Aid from the Ministry

of Culture, Education, Science, Sports and Technology of Japan to H.K.

References

1 Delgado-Nixon, V.M., Gonzalez, G & Gilles-Gonzalez, M.A (2000) Dos, a heme-binding PAS Protein from Escherichia coli, is a direct oxygen sensor Biochemistry 39, 2685–2691.

2 Sasakura, Y., Hirata, S., Sugiyama, S., Suzuki, S., Taguchi, S., Watanabe, M., Matsui, T., Sagami, I & Shimizu, T (2002) Characterization of a direct oxygen sensor heme proteins from Escherichia coli: effects of the heme redox states and mutations at the heme-binding site on catalysis and structure J Biol Chem.

277, 23821–23827.

3 Yoshimura, T., Sagami, I., Sasakura, Y & Shimizu, T (2003) Relationships between heme incorporation, tetramer formation, and catalysis of a heme-regulated phosphodiesterase from Escherichia coli A study of deletion and site-directed mutants.

J Biol Chem 278, 53105–53111.

4 Kurokawa, H., Lee, D.-S., Watanabe, M., Sagami, I., Mikami, B., Raman, C.S & Shimizu, T (2004) A redox-controlled molecular switch revealed by the crystal structure of a bacterial heme PAS sensor J Biol Chem 279, 20186–20193.

5 Park, H., Suquet, C., Satterlee, J.D & Kang, C (2004) Insights into signal transduction involving PAS domain oxygen-sensing heme proteins from the X-ray crystal structure of Escherichia coli DOS heme domain (Ec DOSH) Biochemistry 43, 2738–2746.

6 Amezcua, C.A., Harper, S.M., Rutter, J & Gardner, K.H (2002) Structure and interactions of PAS kinase N-terminal PAS domain: model for intramoleculr kinase recognition Structure 10, 1349– 1361.

7 Rutter, J., Michnoff, C.H., Harper, S.M., Gardner, K.H & McKnight, S.L (2001) PAS kinase: an evolutionarily conserved PAS domain-regulated serine/threonine kinase Proc Natl Acad Sci USA 98, 8991–8996.

8 Jain, R & Chan, M.K (2003) Mechanisms of ligand discrimina-tion by heme proteins J Biol Inorg Chem 8, 1–11.

9 Chan, M.K (2001) Recent advances in heme-protein sensors Curr Opin Chem Biol 5, 216–222.

10 Hao, B., Isaza, C., Arndt, J., Sotis, M & Chan, M.K (2002) Structure-based mechanism of O 2 sensing and ligand discrimina-tion by the FixL heme domain of Bradyrhizobium japonium Biochemistry 41, 12952–12958.

11 Dunham, C.M., Dioum, E.M., Tuckermann, J.R., Gonzalez, G., Scott, W.G & Gillez-Gonzalez, M.A (2003) A distal argine in oxygen-sensing heme-PAS domain is essential to ligand binding, signal transduction, and structure Biochemistry 42, 7701–7708.

12 Miyatake, H., Mukai, M., Park, S.-Y., Adachi, S., Tamura, K., Nakamura, H., Nakamura, K., Tsuchiya, T., Iizuka, T & Shiro, I (2000) Sensory mechanism of oxygen sensor FixL from Rhizobium meliloti: crystallographic, mutagenesis and resonance Raman spectroscopic studies J Mol Biol 301, 415–431.

13 Mukai, M., Nakamura, K., Nakamura, H., Iizuka, T & Shiro, Y (2000) Roles of Ile209 and Ile210 on the heme pocket structure and regulation of histidine kinase activity of oxygen sensor FixL from Rhizobium meliloti Biochemistry 39, 13810–13816.

14 Miyatake, H., Mukai, M., Adachi, S., Nakamura, H., Tamura, K., Iizuka, T., Shiro, Y., Strange, R.W & Hasnain, S.S (1999) Iron coordination structures of oxygen sensor FixL characterized

by Fe K-edge extended X-ray absorption fine structure and resonance raman spectroscopy J Biol Chem 274, 23176–23184.

15 Hirata, S., Matsui, T., Sasakura, Y., Sugiyama, S., Yoshimura, T., Sagami, I & Shimizu, T (2003) Characterization of Met95

Mutants of a heme-regulated phosphodiesterase from Escherichia

coli Optical absorption, magnetic circular dichroism, circular

di-chroism, and redox potentials Eur J Biochem 270, 4771–4779.

16 Sato, A., Sasakura, Y., Sugiyama, S., Sagami, I., Shimizu, T.,

Mizutani, Y & Kitagawa, T (2002) Stationary and time-resolved

resonance raman spectra of His77 and Met95 mutants of the

isolated heme domain of a direct oxygen sensor from Escherichia

coli J Biol Chem 277, 32650–32658.

17 Watanabe, M., Matsui, T., Sasakura, Y., Sagami, I & Shimizu, T.

(2003) Unusual cyanide binding to a heme-regulated

phospho-diesterase from Escherichia coli: effect of Met95 mutations

Bio-chem Biophys Res Commun 299, 169–172.

18 Taguchi, S., Matsui, T., Igarashi, J., Sasakura, Y., Araki, Y., Ito,

O., Sugiyama, S., Sagami, I & Shimizu, T (2004) Binding of

oxygen and carbon monoxide to a heme-regulated phosphodies-terase from Escherichia coli: kinetics and infrared spectra of the full-length wild-type enzyme, isolated PAS domain and Met95 mutants J Biol Chem 279, 3340–3347.

19 Crosson, S., Rajagopal, S & Moffat, K (2003) The LOV domain family: photoresponsive signaling modules coupled to diverse output domains Biochemistry 42, 2–10.

20 DeLano, W.L (2002) The PyMOL molecular graphics System DeLano Scientific, San Carlos, CA, USA.

21 Hirata, S., Kurokawa, H., Sagami, I & Shimizu, T (2004) Fluorescence spectra of Trp53Phe and Trp110Ile mutations of a heme-regulated phosphodiesterase from Escherichia coli Chem Lett 33, 870–871.