... avoid dark lip liners with paler lipsticks. About the Author Allison Saunders, self-taught professional make-up artist, founder of Hollywood Makeup Secrets, and creator of the Hollywood Makeup ... Applying makeup usually ends with the lips and there are a few things you'll want to remember. Try not to to choose a shade that's too dark for your mouth. If the effect is dramatic, that's ... Your blusher is meant to add life to your face and it will emphasize your natural beauty when you smile. In fact, smiling will help you apply this makeup! When you smile, you can identify the high...
Ngày tải lên: 16/01/2014, 22:20
Cook Like a Pro
... TARTLET PANS Small metal pans are used to make individual tarts, cakes, and other sweet and savory baked goods. Like tart pans, these are available with both stationary and removable bottoms and ... Bradley, Sharon Silva and Sharron Wood; Proofreader Leslie Evans; Indexer Ken DellaPenta; Consultants Healther Belt and Brittany Williams; and Marisa Halvorson and her staff at the Williams-Sonoma ... heat conduction and unevenly baked foods. By contrast, good-quality bakeware that is cared for properly can last a lifetime. BAKEWARE a RIMMED BAKING SHEETS Made of aluminum or aluminum-coated...
Ngày tải lên: 15/01/2014, 12:17
Trade Like a Pro ppt
... motivations, financial attitude, and psychological makeup made them operate more like amateurs with access to a lot of money, as opposed to professional traders with a strict agenda and ... leverage when you are trading as a way to reflect your actual trading streak and to help you retain your profits as you trade along. There are different ideal account amounts bandied ... Each approach can be an exhausting way to trade that leaves you drained, dazed, and confused at how you got to where you are in your trading. In order to trade like a professional...
Ngày tải lên: 06/03/2014, 00:20
one more zero. how to trade the forex like a pro in one hour
Ngày tải lên: 23/04/2014, 15:51
Create Your Own Blog: 6 Easy Projects to Start Blogging Like a Pro pptx
Ngày tải lên: 28/06/2014, 17:20
Tài liệu Báo cáo khoa học: Structural insights into the substrate specificity and activity of ervatamins, the papain-like cysteine proteases from a tropical plant, Ervatamia coronaria ppt
... coronaria Raka Ghosh, Sibani Chakraborty, Chandana Chakrabarti, Jiban Kanti Dattagupta and Sampa Biswas Crystallography and Molecular Biology Division, Saha Institute of Nuclear Physics, Kolkata, ... acid at a particular position for this family of plant cysteine pro- teases. The primers used were 5Â-TTGCCTGAGCA TGTT GATTGGAGAGCGA AAG-3 Â (forward) and 5Â-GGGAT AATAAGGTAATCTAGTGATTCCAC-3Â ... S, Sundd M, Jagan- nadham MV & Dattagupta JK (1999) Crystallization and preliminary X-ray analysis of ervatamin B and C, two thiol proteases from Ervatamia coronaria. Acta Crystallogr D 55,...
Ngày tải lên: 18/02/2014, 16:20
Tài liệu Báo cáo khoa học: ˚ The 1.8 A crystal structure of a proteinase K-like enzyme from a psychrotroph Serratia species docx
... Gln15 and the carbonyl oxygen atoms of Asp11 and Asn23 (Fig. 3) in an arrangement similar to what is observed in VPRK. Both PRK and VPRK have calcium bound at Ca3. SPRK also has an aspar- tic acid ... not reveal the classical cold adap- ted features [19], but still initial comparative studies showed that the catalytic turnover was at least twice that of PRK, but substrate affinity was reduced. ... Perrakis A, Harkiolaki M, Wilson KS & Lamzin VS (2001) ARP ⁄ wARP and molecular replacement. Acta Crystallogr Sect D Biol Crystallogr 57, 1445–1450. 40 Jones TA, Zou JY, Cowan SW & Kjeldgaard...
Ngày tải lên: 19/02/2014, 07:20
Tài liệu Báo cáo khoa học: Crystal structure of a subtilisin-like serine proteinase from a psychrotrophic Vibrio species reveals structural aspects of cold adaptation docx
... mother liquor as cryoprotectant on a Rigaku Micromax 007 rotating anode generator (Rigaku- MSC, TX ⁄ USA) operating at 40 kV and 20 mA equipped with a Mar-345 image plate detector (MarReasearch, Epp- endorf, ... glycosylase from Atlantic cod (Gadus morhua) reveals cold-adaptation features. Acta Crystallogr Sect D 59, 1357–1365. 10 Aghajari N, Van Petegem F, Villeret V, Chessa JP, Gerday C, Haser R & Van ... Stability and structural analysis of alpha-amylase from the antarctic psychrophile Alteromonas haloplanctis A2 3. Eur J Biochem 222, 441– 447. 51 Almog O, Gonzalez A, Klein D, Greenblatt HM, Braun S &...
Ngày tải lên: 19/02/2014, 16:20
Tài liệu Báo cáo Y học: Characterization of a cloned subtilisin-like serine proteinase from a psychrotrophic Vibrio species doc
... 5Â-ATGTTAAA GAAAGTATTAAGTTGTTG-TATTGCAGC-3Â and 5Â-AAAGTTTGCTTGGAGCGTCAAGCC-ACTGTAAG CCG-3Â, cloned into the expression vector pBAD-TOPO, transformed into the E.coliTop10 strain and grown on LB agar ... They also had comparable Michaelis– Menten kinetic parameters when their amidase activity against succinyl-AAPF-NH-Np was measured at 25 °C (Table 3). DISCUSSION The extracellular proteinase K -like ... of the proteinase gene primers were designed from the sequence of Vibrio alginolyticus [42]: 5Â-GCG GAATTCTACACCCGCTACATGTGGCGTCG CCAT-3Â and 5Â-CGC GGATCCTGGGGACTAGATC GAATC-GACCAACGTAA-3Â. Underlined...
Ngày tải lên: 21/02/2014, 01:21
Tài liệu Báo cáo khoa học: A zymogen form of masquerade-like serine proteinase homologue is cleaved during pro-phenoloxidase activation by Ca2+ in coleopteran and Tenebrio molitor larvae docx
... Tm-mas. A secondary antibody (alkaline phosphatase-conjugated anti-rabbit IgG, Bio-Rad) was used at a dilution of 1 : 1000. Phage DNA was isolated from phage lysates by using a lambda DNA preparation ... mosquito Anopheles gambiae to bacteria and malaria parasites. Proc. Natl Acad. Sci. USA 94, 11508–11513. 24. Muta,T.,Hashimoto,R.,Miyata,T.,Nishimura,H.,Toh,Y.& Iwanaga, S. (1990) Proclotting ... 440–443. 30. Jiang,H.,Wang,Y.&Kanost,M.R.(1998 )Pro- phenoloxidase activating proteinase from an insect, Manduca sexta: a bacteria- inducible protein similar to Drosophila easter. Proc. Natl Acad. Sci....
Ngày tải lên: 21/02/2014, 03:20
Báo cáo khoa học: Evolutionary changes to transthyretin: structure and function of a transthyretin-like ancestral protein doc
... 0 Loktanella vestfoldensis SKA53 Proteobacteria, Alphaproteobacteria 2 0 Roseovarius sp. HTCC2601 Proteobacteria, Alphaproteobacteria 2 0 Ralstonia eutropha H16 Proteobacteria, Betaproteobacteria ... 1 Comamonas testeroni KF-1 Proteobacteria, Betaproteobacteria 2 1 Klebsiella pneumoniae Kp342 Proteobacteria, Gammaproteobacteria 1 1 Salmonella enterica ssp. I choloraesuis Proteobacteria, Gammaproteobacteria ... 0 Bradyrhizobium sp. Proteobacteria, Alphaproteobacteria 2 0 Sinorhizobium meliloti Proteobacteria, Alphaproteobacteria 2 0 Dinoroseobacter shibae DFL 12 Proteobacteria, Alphaproteobacteria 2...
Ngày tải lên: 07/03/2014, 00:20
Báo cáo Y học: Structural and functional characterization of a C-type lectin-like antifreeze protein from rainbow smelt (Osmerus mordax) potx
Ngày tải lên: 24/03/2014, 03:21
báo cáo khoa học: " "Tied together like a woven hat:" Protective pathways to Alaska native sobriety" pot
Ngày tải lên: 11/08/2014, 20:20
Báo cáo y học: "School children sufficiently apply life supporting first aid: a prospective investigation" doc
Ngày tải lên: 13/08/2014, 18:22
Báo cáo y học: "Insulin like growth factor-I in acute subarachnoid hemorrhage: a prospective cohort study" potx
Ngày tải lên: 13/08/2014, 20:22
Báo cáo y học: "The epidemiology of medical emergency contacts outside hospitals in Norway - a prospective population based study"
... necessary NACA 4 Development of vital (life threatening) danger possible NACA 5 Acute vital (life threatening) danger NACA 6 Acute cardiac or respiratory arrest NACA 7 Death Zakariassen et al. Scandinavian ... Grønlien, and Jan Nystuen from the area of Innlandet, Unni Eskeland and Olav Østebø from the area of Stavanger, and Leif Landa, Kari Hauge Nilsen, and Trond Kibsgaard in the area of Haugesund. We want ... erik.zakariassen@isf.uib.no 1 National Centre for Emergency Primary Health Care, Uni Health, Bergen, Norway, Kalfarveien 31, 5018 Bergen, Norway Zakariassen et al. Scandinavian Journal of Trauma,...
Ngày tải lên: 25/10/2012, 09:56