... avoid dark lip liners with paler lipsticks. About the Author Allison Saunders, self-taught professional make-up artist, founder of Hollywood Makeup Secrets, and creator of the Hollywood Makeup ... Applying makeup usually ends with the lips and there are a few things you'll want to remember. Try not to to choose a shade that's too dark for your mouth. If the effect is dramatic, that's ... Your blusher is meant to add life to your face and it will emphasize your natural beauty when you smile. In fact, smiling will help you apply this makeup! When you smile, you can identify the high...
Ngày tải lên: 16/01/2014, 22:20
Cook Like a Pro
... TARTLET PANS Small metal pans are used to make individual tarts, cakes, and other sweet and savory baked goods. Like tart pans, these are available with both stationary and removable bottoms and ... Bradley, Sharon Silva and Sharron Wood; Proofreader Leslie Evans; Indexer Ken DellaPenta; Consultants Healther Belt and Brittany Williams; and Marisa Halvorson and her staff at the Williams-Sonoma ... heat conduction and unevenly baked foods. By contrast, good-quality bakeware that is cared for properly can last a lifetime. BAKEWARE a RIMMED BAKING SHEETS Made of aluminum or aluminum-coated...
Ngày tải lên: 15/01/2014, 12:17
Trade Like a Pro ppt
... motivations, financial attitude, and psychological makeup made them operate more like amateurs with access to a lot of money, as opposed to professional traders with a strict agenda and ... leverage when you are trading as a way to reflect your actual trading streak and to help you retain your profits as you trade along. There are different ideal account amounts bandied ... Each approach can be an exhausting way to trade that leaves you drained, dazed, and confused at how you got to where you are in your trading. In order to trade like a professional...
Ngày tải lên: 06/03/2014, 00:20
... element affects what the camera sees at a particular focal length, and image sensors are much smaller than film negatives. To capture the same image as a film camera, a digital camera needs a focal ... skilled hands, a cheap point-and-shoot camera can turn out images that are every bit as captivating as those that come from a studio camera costing thousands of dollars. That said, having equipment ... in a digital camera, the image sensor. Focal length affects the angle of view and the size at which your subjects appear. At a short focal length, you can capture a wide area, but objects appear...
Ngày tải lên: 11/03/2014, 19:20
harnect programming like a pro for teens
... available as a programmer. The next topic involved programming languages. Programming languages are the artificial languages that programmers use for creating soft- ware. You saw that several programming ... programming languages are available, and they have a variety of characteristics and uses. You also learned the basic elements of a programming language, using Cỵỵ as an example. After that, you ... use analog means for communication. A n a l o g V e r s u s D i g i t a l Analog and digital refer to the way data is encoded as a signal. An analog signal represents continuous changes of a value...
Ngày tải lên: 19/03/2014, 14:06
The Ultimate IFTTT Guide: Use the best web tool like a pro
... an Instagram and it will get automatically saved to your Dropbox account. No manual selecting and manual uploading. Take care of creating beautiful images; IFTTT will take care of them so that ... service, a trigger goes off and an action takes place automatically on the other. For example: let’s say that you are a photography fan who uses Instagram constantly throughout the day. You love taking photos ... Now celebrate like a proper gentleman/lady. 3.5 The Top 5 Recipes To Automate Your Social Life Recipe #3 – Starred Emails in Gmail To Evernote The result: When you mark an email with a star on Gmail,...
Ngày tải lên: 20/03/2014, 00:07
one more zero. how to trade the forex like a pro in one hour
Ngày tải lên: 23/04/2014, 15:51
Create Your Own Blog: 6 Easy Projects to Start Blogging Like a Pro pptx
Ngày tải lên: 28/06/2014, 17:20
Project management institute a guide to the project management body of knowledge PMBOK project management institute (2013)
Ngày tải lên: 17/08/2013, 11:00
Tài liệu Báo cáo khoa học: Structural insights into the substrate specificity and activity of ervatamins, the papain-like cysteine proteases from a tropical plant, Ervatamia coronaria ppt
... coronaria Raka Ghosh, Sibani Chakraborty, Chandana Chakrabarti, Jiban Kanti Dattagupta and Sampa Biswas Crystallography and Molecular Biology Division, Saha Institute of Nuclear Physics, Kolkata, ... acid at a particular position for this family of plant cysteine pro- teases. The primers used were 5Â-TTGCCTGAGCA TGTT GATTGGAGAGCGA AAG-3 Â (forward) and 5Â-GGGAT AATAAGGTAATCTAGTGATTCCAC-3Â ... S, Sundd M, Jagan- nadham MV & Dattagupta JK (1999) Crystallization and preliminary X-ray analysis of ervatamin B and C, two thiol proteases from Ervatamia coronaria. Acta Crystallogr D 55,...
Ngày tải lên: 18/02/2014, 16:20
Tài liệu Báo cáo khoa học: ˚ The 1.8 A crystal structure of a proteinase K-like enzyme from a psychrotroph Serratia species docx
... Gln15 and the carbonyl oxygen atoms of Asp11 and Asn23 (Fig. 3) in an arrangement similar to what is observed in VPRK. Both PRK and VPRK have calcium bound at Ca3. SPRK also has an aspar- tic acid ... not reveal the classical cold adap- ted features [19], but still initial comparative studies showed that the catalytic turnover was at least twice that of PRK, but substrate affinity was reduced. ... Perrakis A, Harkiolaki M, Wilson KS & Lamzin VS (2001) ARP ⁄ wARP and molecular replacement. Acta Crystallogr Sect D Biol Crystallogr 57, 1445–1450. 40 Jones TA, Zou JY, Cowan SW & Kjeldgaard...
Ngày tải lên: 19/02/2014, 07:20
Tài liệu Báo cáo khoa học: Crystal structure of a subtilisin-like serine proteinase from a psychrotrophic Vibrio species reveals structural aspects of cold adaptation docx
... mother liquor as cryoprotectant on a Rigaku Micromax 007 rotating anode generator (Rigaku- MSC, TX ⁄ USA) operating at 40 kV and 20 mA equipped with a Mar-345 image plate detector (MarReasearch, Epp- endorf, ... glycosylase from Atlantic cod (Gadus morhua) reveals cold-adaptation features. Acta Crystallogr Sect D 59, 1357–1365. 10 Aghajari N, Van Petegem F, Villeret V, Chessa JP, Gerday C, Haser R & Van ... Stability and structural analysis of alpha-amylase from the antarctic psychrophile Alteromonas haloplanctis A2 3. Eur J Biochem 222, 441– 447. 51 Almog O, Gonzalez A, Klein D, Greenblatt HM, Braun S &...
Ngày tải lên: 19/02/2014, 16:20
Tài liệu Báo cáo Y học: Characterization of a cloned subtilisin-like serine proteinase from a psychrotrophic Vibrio species doc
... 5Â-ATGTTAAA GAAAGTATTAAGTTGTTG-TATTGCAGC-3Â and 5Â-AAAGTTTGCTTGGAGCGTCAAGCC-ACTGTAAG CCG-3Â, cloned into the expression vector pBAD-TOPO, transformed into the E.coliTop10 strain and grown on LB agar ... They also had comparable Michaelis– Menten kinetic parameters when their amidase activity against succinyl-AAPF-NH-Np was measured at 25 °C (Table 3). DISCUSSION The extracellular proteinase K -like ... of the proteinase gene primers were designed from the sequence of Vibrio alginolyticus [42]: 5Â-GCG GAATTCTACACCCGCTACATGTGGCGTCG CCAT-3Â and 5Â-CGC GGATCCTGGGGACTAGATC GAATC-GACCAACGTAA-3Â. Underlined...
Ngày tải lên: 21/02/2014, 01:21
Tài liệu Báo cáo khoa học: A zymogen form of masquerade-like serine proteinase homologue is cleaved during pro-phenoloxidase activation by Ca2+ in coleopteran and Tenebrio molitor larvae docx
... Tm-mas. A secondary antibody (alkaline phosphatase-conjugated anti-rabbit IgG, Bio-Rad) was used at a dilution of 1 : 1000. Phage DNA was isolated from phage lysates by using a lambda DNA preparation ... mosquito Anopheles gambiae to bacteria and malaria parasites. Proc. Natl Acad. Sci. USA 94, 11508–11513. 24. Muta,T.,Hashimoto,R.,Miyata,T.,Nishimura,H.,Toh,Y.& Iwanaga, S. (1990) Proclotting ... 440–443. 30. Jiang,H.,Wang,Y.&Kanost,M.R.(1998 )Pro- phenoloxidase activating proteinase from an insect, Manduca sexta: a bacteria- inducible protein similar to Drosophila easter. Proc. Natl Acad. Sci....
Ngày tải lên: 21/02/2014, 03:20
Báo cáo khoa học: Evolutionary changes to transthyretin: structure and function of a transthyretin-like ancestral protein doc
... 0 Loktanella vestfoldensis SKA53 Proteobacteria, Alphaproteobacteria 2 0 Roseovarius sp. HTCC2601 Proteobacteria, Alphaproteobacteria 2 0 Ralstonia eutropha H16 Proteobacteria, Betaproteobacteria ... 1 Comamonas testeroni KF-1 Proteobacteria, Betaproteobacteria 2 1 Klebsiella pneumoniae Kp342 Proteobacteria, Gammaproteobacteria 1 1 Salmonella enterica ssp. I choloraesuis Proteobacteria, Gammaproteobacteria ... 0 Bradyrhizobium sp. Proteobacteria, Alphaproteobacteria 2 0 Sinorhizobium meliloti Proteobacteria, Alphaproteobacteria 2 0 Dinoroseobacter shibae DFL 12 Proteobacteria, Alphaproteobacteria 2...
Ngày tải lên: 07/03/2014, 00:20
Báo cáo Y học: Structural and functional characterization of a C-type lectin-like antifreeze protein from rainbow smelt (Osmerus mordax) potx
... function as an AFP as well as its relationship to other CTLDs. MATERIALS AND METHODS Materials N-Glycosidase F and endoproteinase Glu-C were obtained from Roche Molecular Biochemicals (Laval, Canada). Bis(sulfosuccinimdyl) ... 1997 and stored frozen until use. Approximately 2.5 mL plasma was fractionated on a 1 · 90 cm S-200 Sephacryl (Pharmacia, Uppsala Sweden) gel-filtration c olumn. Fractions contain- ing AFP, as determined ... mLặmin )1 using an HPLC (Waters). The column was calibrated using protein molecular-mass stand- ards. Approximately 15 lg untreated smelt AFP was applied to the column in duplicate runs. Similar samples of...
Ngày tải lên: 24/03/2014, 03:21
báo cáo khoa học: " "Tied together like a woven hat:" Protective pathways to Alaska native sobriety" pot
Ngày tải lên: 11/08/2014, 20:20