a gallery of graphs of discrete functions

Báo cáo khoa học: "A Class of Submodular Functions for Document Summarization" pot

Báo cáo khoa học: "A Class of Submodular Functions for Document Summarization" pot

... submodularity naturally arises Concept-based summarization (Filatova and Hatzivassiloglou, 2004; Takamura and Okumura, 2009; Riedhammer et al., 2010; Qazvinian et al., 2010) usually maximizes ... is that of Problem 3.3 Automatic summarization evaluation Automatic evaluation of summary quality is important for the research of document summarization as it avoids the labor-intensive and potentially ... on Artificial Intelligence (IJCAI07), Hyderabad, India, January H Narayanan 1997 Submodular functions and electrical networks North-Holland G.L Nemhauser, L .A Wolsey, and M.L Fisher 1978 An analysis...

Ngày tải lên: 23/03/2014, 16:20

11 440 0
Báo cáo toán học: " New proofs of Schur-concavity for a class of symmetric functions" potx

Báo cáo toán học: " New proofs of Schur-concavity for a class of symmetric functions" potx

... motivated by Ceng et al [2], Takahashi and Zembayashi [14], Takahashi and Zembayashi [9], the main aim of this paper is to introduce and investigate a new iterative method for finding a solution of ... et al Fixed Point Theory and Applications 2011, 2011:91 http://www.fixedpointtheoryandapplications.com/content/2011/1/91 Page of 11 and Takahashi [10] and Takahashi et al [13], Takahashi and ... 17 Takahashi, W: Nonlinear Functional Analysis-Fixed Point Theory and Its Applications Yokohama Publishers (2000) 18 Xu, HK: Inequalities in Banach spaces with applications Nonlinear Anal (TMA)...

Ngày tải lên: 20/06/2014, 21:20

11 413 0
Báo cáo hóa học: " Research Article Schur-Convexity for a Class of Symmetric Functions and Its Applications" pptx

Báo cáo hóa học: " Research Article Schur-Convexity for a Class of Symmetric Functions and Its Applications" pptx

... Engineering, Academic Press, New York, NY, USA, 1979 19 S.-H Wu, “Generalization and sharpness of the power means inequality and their applications,” Journal of Mathematical Analysis and Applications, ... Stepolhkepniak, “An effective characterization of Schur-convex functions with applications,” Journal of Convex Analysis, vol 14, no 1, pp 103–108, 2007 J S Aujla and F C Silva, “Weak majorization inequalities ... important applications in analytic inequalities 2–7 , combinatorial optimization , isoperimetric problem for polytopes , linear regression 10 , graphs and matrices 11 , gamma and digamma functions...

Ngày tải lên: 22/06/2014, 02:20

15 302 0
Báo cáo hóa học: "EXISTENCE FOR A CLASS OF DISCRETE HYPERBOLIC PROBLEMS" pdf

Báo cáo hóa học: "EXISTENCE FOR A CLASS OF DISCRETE HYPERBOLIC PROBLEMS" pdf

... Agarwal and D O’Regan, Difference equations in abstract spaces, Journal of Australian Mathematical Society Series A 64 (1998), no 2, 277–284 [2] R P Agarwal, D O’Regan, and V Lakshmikantham, Discrete ... Editura Academiei, Bucharest, 1988 [14] A Rousseau, R Temam, and J Tribbia, Boundary conditions for an ocean related system with a small parameter, Nonlinear Partial Differential Equations and Related ... and D W Krumme, Differential-difference equations and nonlinear initial-boundary value problems for linear hyperbolic partial differential equations, Journal of Mathematical Analysis and Applications...

Ngày tải lên: 22/06/2014, 22:20

14 284 0
A study of the functions and politeness of the discourse marker ORH in spoken singapore mandarin

A study of the functions and politeness of the discourse marker ORH in spoken singapore mandarin

... Fraser, “What are discourse markers?”, Journal of Pragmatics, 31, (1999), pp.931 Bruce Fraser, “An Account of Discourse Markers”, International Review of Pragmatics, (2009), pp 297 17 Diane Blakemore, ... meanings and functions of discourse particles Moreover, the studies available so far are hardly comparable; the approaches vary with respect to very many difference aspects: the language(s) under ... was shown that “/orh/” has a total of functions, namely: serves as a minimal response (53%), serves as an indicator when quoting others (7%), serves as an indicator to secure the conversational...

Ngày tải lên: 26/09/2015, 10:13

380 537 0
Local property of a class of msubharmonic functions

Local property of a class of msubharmonic functions

... investigated intensively in recent years by many authors, see [6], [14], [24] We also recall the Cegrell classes of m-subharmonic functions Fm (Ω ) and Em (Ω ) Local property of a class of m-subharmonic ... comments that led to improvements in the exposition of the paper Local property of a class of m-subharmonic functions 23 References Bedford, E., Taylor, B A. : A new capacity for plurisubharmonic functions ... next lemma is a crucial tool for the proof of the local property of the class Em,χ (Ω ) Lemma Let Ω be a hyperconvex domain in Cn and ≤ m ≤ n Assume that u ∈ Em0 (Ω ) and χ ∈ K such that χ (t)...

Ngày tải lên: 12/10/2015, 10:37

23 284 0
An experimental investigation of heat transfer and fluid flow in a rectangular duct with inclined discrete ribs

An experimental investigation of heat transfer and fluid flow in a rectangular duct with inclined discrete ribs

... [1] Saini J.S Use of artificial roughness for Enhancing Performance of Solar air heater Proceedings of XVII National and VI ISHME/ASME Heat and Mass Transfer Conference, IGCAR, Kalpakkam India 2004; ... separated at the rib appears to be reattached with the surface at around times of the rib height It is seen that the separated boundary layer behind the rib results in a dead zone as marked A , ... observation of the maximum value of the Nusselt number at a certain value of gap width namely relative gap width of 1.0 only Figure Variation of Nusselt number with Reynolds number as a function of relative...

Ngày tải lên: 05/09/2013, 16:10

12 832 0
A LIST OF SOME PR FUNCTIONS

A LIST OF SOME PR FUNCTIONS

... enter the data in and analyze if you have access to SPSS If you not have access to SPSS, the data can also be converted to other data analysis programs by your campus research department ... media of team-related news and events and can serve as a summary prior to news conferences in order to help them frame questions If a press release contains a great deal of background statistics, ... media for a pre-season look at the team Don't underestimate the importance and potential impact of non-media channels Word -of- mouth can be considerably important in generating enthusiasm for a...

Ngày tải lên: 17/10/2013, 12:15

6 367 0
Báo cáo khoa học: Two types of replication protein A in seed plants Characterization of their functions in vitro and in vivo ppt

Báo cáo khoa học: Two types of replication protein A in seed plants Characterization of their functions in vitro and in vivo ppt

... the manufacturer’s procedures, and used as templates for PCR, with 70b F1 (ATGGAGAACTCAGT GACCCAAGATGGTAT) and 70b R1 (AGAATTCTGAG GTTGAAGAAGCTAGTAA) primers, and 70b F2 (TACT ATCAGCAGAAGCAATGTGGTGATA) ... mutants of A thaliana homologs of OsRPA7 0a and OsRPA70b (AtRPA7 0a and AtRPA70b) A thaliana was used for genetic analysis of the functions of OsRPA7 0a and OsRPA70b because it has closely related ... (AtRPA7 0a and AtRPA70b, respectively) and because many T-DNA insertion mutants of A thaliana are already available [26] We were able to obtain one T-DNA insertion line each for AtRPA7 0a and AtRPA70b...

Ngày tải lên: 07/03/2014, 21:20

12 588 0
DISCRETE WAVELET TRANSFORMS - A COMPENDIUM OF NEW APPROACHES AND RECENT APPLICATIONS pdf

DISCRETE WAVELET TRANSFORMS - A COMPENDIUM OF NEW APPROACHES AND RECENT APPLICATIONS pdf

... Sinha, Devanshu Chakravarty, Rajkumar Patra and Rohit Raja Chapter Density Estimation and Wavelet Thresholding via Bayesian Methods: A Wavelet Probability Band and Related Metrics Approach to Assess ... Gholamreza Anbarjafari, Hasan Demirel, Sara Izadpenahi, Cagri Ozcinar, Dr Awad Kh Al-Asmari, Farhaan Al-Enizi, Fayez El-Sousy Published by InTech Janeza Trdine 9, 51000 Rijeka, Croatia Copyright ... Hsia, Jen-Shiun Chiang, Nader Namazi, Tilendra Shishir Shishir Sinha, Rajkumar Patra, Rohit Raja, Devanshu Chakravarty, Irene Lena Hudson, In Kang, Andrew Rudge, J Geoffrey Chase, Gholamreza Anbarjafari,...

Ngày tải lên: 23/03/2014, 03:20

232 422 0
gallery of best resumes for people without a four-year degree

gallery of best resumes for people without a four-year degree

... example, those for Alabama (AL), Alaska (AK), American Samoa (AS), Arizona (AZ), and Arkansas (AR) are easy to mix up You can prevent confusion and delay simply by using the correct postal abbreviation ... accounts payable and receivable Calculated payroll Prepared all related tax payments and documentation Grand Rapids, MI Packaging Converting, Inc 1990–1993 Office Manager / Assistant to Plant Manager ... Administrative Assistant/Office Manager 42 11 Secretary Technical Assistant 43 12 Secretary Secretary 44 13 Administrative Assistant Administrative Assistant 45 14 Administrative Assistant Administrative...

Ngày tải lên: 01/06/2014, 10:19

433 514 0
báo cáo sinh học:" A review of the application and contribution of discrete choice experiments to inform human resources policy interventions" docx

báo cáo sinh học:" A review of the application and contribution of discrete choice experiments to inform human resources policy interventions" docx

... increasing primary care physicians in rural areas Fam Med 1990, 22:350-355 Inoue K, Hirayama Y, Igarashi M: A medical school for rural areas Medical Education 1997, 31:430-434 Lea J, Cruickshank ... Applied Health Economics and Health Policy 2003, 2:55-64 Ryan M, Gerard K, Amaya-Amaya M: Using Discrete Choice Experiments to Value Health and Health Care Springer; 2008 Lancaster K: A New Approach ... to make trade-offs, thereby revealing and quantifying their underlying hierarchy of preferences Although increased salaries always come up as a key determinant of job satisfaction, studies based...

Ngày tải lên: 18/06/2014, 17:20

10 651 0
Báo cáo hóa học: " A study of Pescar’s univalence criteria for space of analytic functions" doc

Báo cáo hóa học: " A study of Pescar’s univalence criteria for space of analytic functions" doc

... article as: Faisal and Darus: A study of Pescar’s univalence criteria for space of analytic functions Journal of Inequalities and Applications 2011 2011:109 Submit your manuscript to a journal and ... Faisal and Darus Journal of Inequalities and Applications 2011, 2011:109 http://www.journalofinequalitiesandapplications.com/content/2011/1/109 Page of Lemma 1.4 (Schwarz Lemma) Let the analytic ... univalence criteria Abstr Appl Anal 2011, 13 (2011) Article ID759175, Faisal and Darus Journal of Inequalities and Applications 2011, 2011:109 http://www.journalofinequalitiesandapplications.com/content/2011/1/109...

Ngày tải lên: 20/06/2014, 22:20

7 433 0
Báo cáo hóa học: " On a boundary value problem of a class of generalized linear discrete-time systems" ppt

Báo cáo hóa học: " On a boundary value problem of a class of generalized linear discrete-time systems" ppt

... and uniqueness of solutions for generalized linear discrete- time boundary value problems of a class of linear rectangular matrix difference equations whose coefficients are square constant matrices ... Singular Systems of Differential Equations Cole Publishing Company (1980) Gantmacher, FR: The Theory of Matrices, Volume I and II Chelsea (1959) Datta, BN: Numerical Linear Algebra and Applications ... GI, Psarrakos, P, Karcanias, N: On the computation of the Jordan canonical form of regular matrix polynomials Linear Algebra Appl 385, 117–130 (2004) doi:10.1186/1687-1847-2011-51 Cite this article...

Ngày tải lên: 20/06/2014, 22:20

9 389 0
Báo cáo hóa học: " Letter to the Editor Remarks on “On a Converse of Jensen’s Discrete Inequality” of S. Simic ´" doc

Báo cáo hóa học: " Letter to the Editor Remarks on “On a Converse of Jensen’s Discrete Inequality” of S. Simic ´" doc

... → A1 A af bg aA f bA g A2 if f ∈ L, f t ≥ for all t ∈ E, then A f ≥ positivity If in addition A 1 is satisfied, then we say that A is a positive normalized linear functional Peˇ ari´ and Beesack ... increasing function of M and a decreasing function of m Remark Analogous discrete version of Theorem can be found in pages 9-10 5, Theorem 8, Journal of Inequalities and Applications Remark The ... Peˇ ari´ , F Proschan, and Y L Tong, Convex Functions, Partial Orderings, and Statistical Applications, c c vol 187 of Mathematics in Science and Engineering, Academic Press, Boston, Mass, USA,...

Ngày tải lên: 21/06/2014, 05:20

4 266 0
Báo cáo hóa học: " Research Article Inclusion Properties for Certain Classes of Meromorphic Functions Associated with a Family of Linear Operators" pptx

Báo cáo hóa học: " Research Article Inclusion Properties for Certain Classes of Meromorphic Functions Associated with a Family of Linear Operators" pptx

... Liu and Srivastava Further, we remark in passing that this Journal of Inequalities and Applications operator L a, c is closely related to the Carlson-Shaffer operator defined on the space of analytic ... functions associated with the Choi-Saigo-Srivastava operator,” Journal of Mathematical Analysis and Applications, vol 320, no 2, pp 779–786, 2006 17 R W Barnard and Ch Kellogg, “Applications of convolution ... strongly starlike functions, ” Annales Universitatis Mariae Curie-Skłodowska Sectio A, vol 45, pp 89–97, 1991 J.-L Liu and H M Srivastava, A linear operator and associated families of meromorphically...

Ngày tải lên: 21/06/2014, 20:20

12 291 0
Báo cáo hóa học: " Research Article A New Subclass of Analytic Functions Involving Al-Oboudi Differential Operator" docx

Báo cáo hóa học: " Research Article A New Subclass of Analytic Functions Involving Al-Oboudi Differential Operator" docx

... Sumer Eker and H Ozlem Guney ¨ ¨ Integral means inequalities for fractional derivative We will make use of the following definitions of fractional derivatives by Owa , and Srivastava and Owa Definition ... Journal of Mathematics and Mathematical Sciences, vol 2004, no 27, pp 1429–1436, 2004 G S S˘ l˘ gean, “Subclasses of univalent functions, ” in Complex Analysis—5th Romanian-Finnish seminar, aa Part ... Owa, “On the distortion theorems I,” Kyungpook Mathematical Journal, vol 18, no 1, pp 53–59, 1978 H M Srivastava and S Owa, Eds., Univalent Functions, Fractional Calculus, and Their Applications,...

Ngày tải lên: 21/06/2014, 22:20

10 253 0
Báo cáo hóa học: " Research Article Some Subclasses of Meromorphic Functions Associated with a Family of Integral Operators" pptx

Báo cáo hóa học: " Research Article Some Subclasses of Meromorphic Functions Associated with a Family of Integral Operators" pptx

... Y C Kim, and H M Srivastava, “The Hardy space of analytic functions associated with certain one-parameter families of integral operators,” Journal of Mathematical Analysis and Applications, vol ... Mathematical Analysis and Applications, vol 3, no 1, article 8, 11 pages, 2006 25 T N Shanmugam, S Sivasubramanian, B A Frasin, and S Kavitha, “On sandwich theorems for certain subclasses of analytic ... classes of analytic functions, ” International Journal of Mathematics and Mathematical Sciences, vol 2006, Article ID 29684, 13 pages, 2006 28 T N Shanmugam, S Sivasubramanian, and H M Srivastava,...

Ngày tải lên: 22/06/2014, 02:20

18 309 0
Báo cáo hóa học: " Research Article Stability of a Quadratic Functional Equation in the Spaces of Generalized Functions" docx

Báo cáo hóa học: " Research Article Stability of a Quadratic Functional Equation in the Spaces of Generalized Functions" docx

... domains, and applied the result to the study of an interesting asymptotic behavior of the quadratic functions As a matter of fact, we reformulate 1.1 and related inequality in the spaces of generalized ... functional equation in the spaces of generalized functions, ” Journal of Inequalities and Applications, vol 2007, Article ID 79893, 13 pages, 2007 15 Pl Kannappan, “Quadratic functional equation and ... Journal of Inequalities and Applications in the spaces of generalized functions Also, we obtain the general solution and prove the Hyers-Ulam stability of 1.1 in the spaces of generalized functions...

Ngày tải lên: 22/06/2014, 02:20

12 312 0
w