... (1)(2)KiĨm tra bµi cị 1 Từ sau thay cho từ in đậm câu: Chiếc ô tô bị chết máy? A B hỏng C D qua đời Xác định từ đồng nghĩa nêu tác dụng việc sử dụng từ đồng nghĩa câu thơ sau? - Bác Bác ... ờng bạo ( Tố Hữu) Bàn tay trót nhúng chàm, D¹i råi biết khôn (Nguyễn Du) Nhẹ nh bấc nặng nh chì, Gỡ cho đ ợc duyên (13)Bài tập 1: Tìm từ trái nghĩa câu ca dao, tục ngữ sau đây? - Chị ... (Ngun Du) NhĐ nh bÊc nặng nh chì, Gỡ cho đ ợc duyên (12)VD: Thiếu tất cả, ta giàu dũng khí Sng chẳng cúi đầu, chết ung dung Giặc muốn ta nơ lệ, ta lại hố anh hùng, Sức nhân nghĩa mạnh c ờng
Ngày tải lên: 13/04/2021, 16:47
... C Carol had in March a baby D In March had Carol a baby 31 Although the driver slammed on his brakes, A he was able to avoid hitting the small dog B the small dog was not hit by the car ... most advanced form of communication. 3) According to the passage, what is a signal? A) The most difficult form of communication to describe B) A form of communication which may be used across ... would go to the doctor's." Minh said to Lan This sentence can be rewritten: _ A Minh told Lan to go to the doctor's B Minh advised Lan to go to the doctor's C Minh told Lan that he would
Ngày tải lên: 18/04/2021, 13:44
thuët hoµi ph¹m ngò l o trường thpt quang trung văn học lớp 10 gv trần kim lan c©u1 v¨n häc viöt nam tõ thõ kû x ®õn hõt thõ kû xix ® tr¶i qua mêy giai ®o¹n a mét b hai c ba d bèn c©u 2 nh÷ng t të
... 2) Nỗi lòng tác giả:Nỗi lịng tác giả: Câu 3: “Cơng danh nam tử cịn vương nợ” (Cái chí) * Chí: Chí làm trai mang tinh thần, tư tưởng tích cực: lập công (để lại nghiệp), lập danh (để lại tiếng ... qua hai câu thơ cuối thể hiện? a Lý t ởng công danh b Ước mơ sống bình c Tấm lòng th ¬ng d©n tha thiÕt (23)Hướng d n H t h c nh nhµẫ ự ọ ở : Học thuộc thơ Tỏ lòng: phiên âm , dịch nghĩa ... trấn giữ đất n ớc T hiên ngang mang tầm vóc vũ trụ Đi cứu n ớc bao năm mà ch a mt mi. ã Con ng ời kì vĩ nh át không gian bao la, làm bật ng ời kì vĩ bối cảnh không gian (chiều rộng núi
Ngày tải lên: 12/04/2021, 07:05
bài 7 trình bày và in trang tính bài 9 trình bày dữ liệu bằng biểu đồ câu 1 lệnh nào sau đây dùng để rút 1 gọn biểu biểu thức đại số a plot b make c simplify d expand câu 2 lệnh nào sau đây dùng để đ
... Bài Trình bày liệu biểu đồ Câu 1: Lệnh sau dùng để rút gọn biểu biểu thức đại số? a Plot b Make c Simplify d Expand Câu 2: Lệnh sau dùng để định nghĩa hàm số? a Expand b Make c Graph d ... Các bước cần thực để tạo biểu đồ từ bảng liệu - Biết cách thay thay đổi dạng biểu đồ (5)5 Bài Trình bày liệu biểu đồ Em quan sát bảng liệu sau đưa nhận xét so sánh số lượng học sinh ... đồ 1 Tại bước, em nháy nút Finish (Kết thúc) chưa bước cuối biểu đồ tạo Khi nội dung hay tính chất bị bỏ qua (ở bước sau) đặt theo ngầm định 2 Trên hộp thoại cần em nháy nút Back (Quay lại) để
Ngày tải lên: 17/04/2021, 17:17
practice test 1 practice test 1 present simple – present continuous choose the best answer 1 water at 100 degree centigrades a boil b boils c boiling d is boiling 2 george to the movies very often a
... was seeing 22 A was diving B dived C has dived D had dived 23 A was rescuing B has rescued C rescues D rescued 24 A is B had been C was D has been 25 A gave B had given C was giving D has given ... The ambulance (26) the boy and he policeman to hospital 19 A arrived B arrives C was arriving D had arrived 20 A lay B is lying C was lying D had lain 21 A saw B had seen C has seen D was ... called last night, I TV A am watching B was watching C have been watching D will be watching 21 For the time being, we at a cheap hotel A stay B has stayed C are staying D had stayed
Ngày tải lên: 20/04/2021, 00:45
second term test – 10th adv sentence 1 choose the word with the diferrent pronunciation of the underlined part a variety b animal c provide d environment sentence 2 choose the word with the different
... picnic was cancelled because it rained”. A If it didn’t rain, the picnic wouldn’t be cancelled B If it hadn’t rain, the picnic wouldn’t have been cancelled. C If it didn’t rain, the picnic wouldn’t ... andwell-paid of all time B Macaulay Culkin was of all time the most well-paid child starts famous and one of C Of all time, Macaulay Culkin was one of the well-paid famous and child starts D *Macaulay Culkin ... 53: Choose the best answer be saved/ a lot of/ and/ energy/ by recycling/ resources/ can A By a lot of recycling, can be savedenergyandresources B Energy can be saved by a lot of resources and
Ngày tải lên: 24/04/2021, 15:37
tiết53 độ dài đường tròn cung tròn gi¸o viªn nguyôn thþ mïi tæ khtn kióm tra bµi cò bµi tëp tr¾c nghiöm cho h×nh vï víi sè aob 1000 a sè ®o cung nhá amb lµ a 500 b 1000 c 2000 d 250 b sè ®o cung
... (1)(2)a) Sè ®o cung nhá AmB lµ: A 500 B 1000 C 2000 D 250 b) Sè ®o cung lín AnB lµ: A 1000 B 2000 C 2600 D 1600 c) Sè ®o cung nhá AC lµ: A 300 B 600 C 700 D 800 B C Số ... 53: §9 §é dµi ® êng trßn, cung trßn. (6)a) Đo chu vi ( C ) bốn hình tròn đó ( càng chính xác càng tốt) b) Đo đ ờng kính ( d) của 4 hình tròn c) Điền vào bảng sau ( đơn vị độ dài :cm) d) Nªu nhËn ... C Số đo độ của cung và của cả đ ờng tròn ta đã biết cách tính Vậy độ dài đ ờng tròn, độ dài cung tròn đ ợc tính nh thế nào? B 100 n m B A (3)TiÕt 53: §9 §é dµi ® êng trßn, cung trßn.
Ngày tải lên: 09/04/2021, 21:16
one period – test the first one period – test grade 6 i circle the best answer a b c or d 4ms 1 do you spell your name a what b where c how d who 2 2 x 6 a twenty b eleven c twelve d thirteen 3
... What is your name? A Your name is Ba C Her name is Ba B My name is Ba D His name is Ba ………… does your father do? He is an engineer A Who B What C Where D How Hoa and I ………… students A am ... I’m fine, thanks D L-A-N, Lan ………… name is Hung A His B He C Him D You What is your name? A Your name is Ba C Her name is Ba B My name is Ba D His name is Ba ………… does your father do? He ... A on B in C at D Ø ………… in A Come B Open C Close D Live How are you? A I’m eleven years old C I’m nine B I’m fine, thanks D L-A-N, Lan ………… name is Hung A His B He C Him D
Ngày tải lên: 12/04/2021, 03:08
slide 1 wednesday october 13rd 2009 unit 2 let’s talk p1 1 new words từ mới sick a ốm ®au tired a mệt mỏi hot a nóng sad a buồn cold a c¶m lạnh a cold b sad c hot d tired 1 2 3 4 tuesda
... (1)(2)(3)(4)Wednesday, October 13rd 2009 Unit 2: Let’s talk (p1) 1 New words (Từ mới) - Sick (a) : Ốm ®au - Tired (a) : Mệt mỏi - Hot (a) : Nóng - Sad (a) : Buồn (5)1 2 3 4 (6)Tuesday, October 13rd ... c©u) What’s the matter? I’m + (a) Dùng để hỏi muốn biết ng ời khác bị (8)(9)(10)Tuesday, October 13 rd2009 Unit 2: Let’s talk (p1) 1 New words (Từ mới) 2 Model sentences (MÉu c©u) What’s ... Let’s talk (p1) 1 New words (Từ mới) 2 Model sentences (MÉu c©u) What’s the matter? I’m + (a) (7)Tuesday, October 13rd 2009 Unit 2: Let’s talk (p1) 1 New words (Từ mới) 2 Model sentences
Ngày tải lên: 12/04/2021, 03:42
a. annoying b. arguing c. discussing d. shouting b 22. A good clock always keeps ...………. ppt
... c bere d mercer > c a < /b> gen b guard c gun d gate > a < /b> a obscure b obstacle c obtain d obstructive > b a < /b> studio b dual c dull d duvet > c a < /b> clear b tear c pear d rear > c a < /b> pub b rob c comb ... After the campaign, a < /b> special medal was to all combatants a < /b> gain b awarded c earned d deserved b 29 I to find a < /b> well-paid job but I had no luck a < /b> tried hard b tried hardly c hardly tried ... a < /b> drastic measure be adopted d a < /b> drastic measure to be adopted c 48 The fire spread through the building quickly but everybody a < /b> was able to escape b managed to escape c could escape d both...
Ngày tải lên: 18/06/2014, 17:20
Báo cáo khoa học: Structure of a trypanosomatid mitochondrial cytochrome c with heme attached via only one thioether bond and implications for the substrate recognition requirements of heme lyase potx
... consumption by C fasciculata effectively ceased within a < /b> few seconds (Fig 1) A < /b> very similar result was obtained if mm KCN was added instead of antimycin A;< /b> cyanide inhibits the cytochrome aa3 oxidase ... cysteine cytochromes c be explained? Considerable evidence points to catalyzed formation and subsequent reduction of an intramolecular disulfide bond in the CXXCH motif during cytochrome c biogenesis ... (protein as described in [9]; antibody raised by Covalab, Villeurbanne, France) Unconcentrated E coli soluble cytoplasmic extracts were resolved by SDS ⁄ PAGE and blotted onto Hybond -C Extra nitrocellulose...
Ngày tải lên: 23/03/2014, 04:21
An Introduction to Design Patterns in C++ with Qt™, 2nd Edition doc
... namespace Symbols from the Standard Library (Appendix B, “Standard Headers”) are enclosed in the namespace std A < /b> namespace (Section 20.4) is a < /b> collection of classes, functions, and objects that can ... can be addressed with a < /b> named prefix The using declaration tells the compiler to add all symbols from the specified namespace (std) into the global namespace 1.3.2 Declaring and Initializing Variables ... typing, data abstraction, references, operator and function overloading, and considerable support for < /b> object-oriented programming C+ + retains the key features that have made C such a < /b> popular and...
Ngày tải lên: 24/03/2014, 01:21
Báo cáo sinh học: " Open Access Cloning of the canine RNA polymerase I promoter and establishment of reverse genetics for influenza A and B in MDCK cells" docx
... TGTTTCGGCGACAGGCAGACAGACGACAGGCAGACGTAAAAGACAGCCGGTCCGTCCGTCGCTCGCCTTAGAGATGTGGGCCTCTGGGCGCGGGTGGGGTTCCGGGCTTGACCGCGCGGCCGAGCCGG pK9 Pol I EB (1816) TGTTTCGGCGACAGGCAGACAGACGACAGGCAGACGTAAAAGACAGCCGGTCCGTCCGTCGCTCGCCTTAGAGATGTGGGCCTCTGGGCGCGGGTGGGGTTCCGGGCTTGACCGCGCGGCCGAGCCGG ... GTCTCCACCGACCGCGTATCGCCCCTCCTCACCCCCCCCCCCCCCCGGGTTACCTGGGGCGACCAGAAAGCCCTGGGGGCNGGGGGCTCCGTGGGGTGGGGGTGGGGGGGCGCCGTGGGGCAGGTTTT pK9 Pol I EB (1568) GTCTCCACCGACCG-GTATCGCCCCTCCTCCCCTCCCCCCCCCCCCCCGTTCCCTGGGTCGACCAGATAGCCCTG ... TCCCTGTCCTCGCTCGCTGGAGCCTGAGCCGTCCGCCTGGGCCTGCGCGCCGGCTCTCGTGCTGGACTCCAGGTGGCCCGGGTCGCGGTGTCGCCCTCCGGTCTCCGGCACCCGAGGGAGGGCGGTGT pK9 Pol I EB (1944) TCCCTGTCCTCGCTCGCTGGAGCCTGAGCCGTCCGCCTGGGCCTGCGCGCCGGCTCTCGTGCTGGACTCCAGGTGGCCCGGGTCGCGGTGTCGCCCTCCGGTCTCCGGCACCCGAGGGAGGGCGGTGT...
Ngày tải lên: 18/06/2014, 18:20