cancer stem cells theories and practice_part4 ppsx

Intriguingly, there was one exception: The SW210.5 SCLC cell line registered only a small amount of ALDH activity in the spectrophotometrical assay and expressed only small amounts of AL

concluded that the Aldefluor assay can be adapted successfully to measure ALDH activity

in lung cancer cells, providing real time changes in ALDH activity in viable cells treated with chemotherapy or siRNA They emphasized the importance of the use of mixed populations of cells with high ALDH levels and cells lacking ALDH activity when ALDH activity is measured by the Aldefluor assay in cells known to have high ALDH levels Importantly, they carried out double Aldefluor and propidium iodide (PI) staining to delineate dead cells According to their results, while ALDH expression levels were heterogeneous among the cell lines examined, overall findings revealed low levels of ALDH activity in SCLC cell lines, while higher levels were detected in some, but not all, NSCLC cell lines The results correlated very well with protein and enzymatic activity as measured

by the Western blot analysis and the spectrophotometrical assay, respectively Intriguingly, there was one exception: The SW210.5 (SCLC) cell line registered only a small amount of ALDH activity in the spectrophotometrical assay and expressed only small amounts of ALDH1A1 and ALDH3A1 proteins in the Western blot analysis, whereas the Aldefluor assay showed high levels of ALDH activity (50% of the cells) This SCLC cell line (SW210.5) was shown to express mRNA for ALDH1A1 and ALDH2, but not ALDH3A1, by the semi-quantitative reverse transcription polymerase chain reaction (RT-PCR) assay

Our preliminary experiments revealed very high levels of ALDH1A1 mRNA expression in some SCLC and NSCLC cell lines We also observed considerable discrepancies between mRNA levels detected by the quantitative RT-PCR assay, protein levels analyzed by Western blotting, and the proportion of cells with enzymatic activity measured by the Aldefluor assay in several SCLC and NSCLC cell lines

Aiming to elucidate the mechanism underlying the discrepancies observed in preliminary experiments and the previous study, we carried out the following experiments

ALDH mRNA expression - its correlation with the most common CSC marker CD133 -

The quantitative RT-PCR assay revealed that ALDH1A1 mRNA was expressed at detectable levels in seven out of nine SCLC cell lines (77.8%), three of which expressed it at unequivocally high levels (33.3%), while it was expressed in four of the 18 NSCLC cell lines, two of which expressed it at high levels (11.1%)(Figure 2) On the other hand, ALDH2 was expressed in eight of the nine SCLC cell lines and 17 of the 18 NSCLC cell lines The levels were lower on the whole than those of ALDH1A1 and did not remarkably differ among the cell lines mRNA of CD133, most commonly used CSC marker, was expressed only in SCLC cell lines (66.7%, six out of nine cell lines), and its level in SCLC cell lines tended to be

This is trial version

www.adultpdf.com

associated with the level of ALDH1A1, but not ALDH2 The findings suggested ALDH1A1

to have an important significance in the maintenance of stemness in lung cancer cells, and might account for the highly malignant activity of SCLCs

ALDH protein expression in lung cancer cell lines

ALDH protein was detected by Western blotting using a non-selective antibody, which binds both ALDH1A1 and ALDH2 proteins (clone 44, BD transduction, Palo Alto, CA) The protein was expressed at high levels in two of the nine SCLC cell lines (22.2%), and two of the 18 NSCLC cell lines (11.1%)(Figure 3) The level of protein paralleled well the level of ALDH1A1 mRNA, but not ALDH2 mRNA, in NSCLC cell lines, suggesting that the protein detected by the Western blot analysis was ALDH1A1 rather than ALDH2 (Figure 2 and Figure 3) Thus, we describe the protein detected here by the Western blot analysis as ALDH1A1 Interestingly, one SCLC cell line (Lu134) with a high level of ALDH1A1 mRNA did not express ALDH1A1 (either ALDH1A1 or ALDH2) (Figure 2) This result is similar to

a previous observation that a SCLC cell line, SW210.5, expressed ALDH1 mRNA, but only a very small amount of protein [93] These findings suggest a potential post-translational mechanism to be involved in ALDH1A1 protein expression in some SCLC cells

ALDH activity in lung cancer cell lines

The fraction of cells with ALDH activity was measured with the Aldefluor assay The two SCLC cell lines with high ALDH1A1 protein levels (H1688 and H1618) had fractions of cells with strong ALDH activity (Figure 4) All of the SCLC cell lines with very weak ALDH protein expression (the faint bands detected by Western blotting in these cell lines were presumably ALDH2, because these cell lines expressed only ALDH2, not ALDH1A1, mRNA) had only a small fraction (less than 10%) of cells with ALDH activity On the other hand, among NSCLC cell lines examined (A549, PC1, H441, H2087 and H1299) (not all data shown), only one (PC1) had fraction of cells with strong ALDH activity (Figure 4) One cell line with high ALDH1A1 protein levels (A549) unexpectedly had only a very small fraction

of cells with strong ALDH activity Summarizing the findings, ALDH1A1 protein expression was closely associated with ALDH activity in SCLC cells, but not necessarily in NSCLC cells, suggesting the potential post-translational mechanism to be involved in activation of ALDH1A1 protein in NSCLCs

Primary structure of ALDH1A1 mRNA

To elucidate the possible involvement of a mutation (or polymorphism) or splicing disorder

in the difference among the levels of mRNA, protein and activity, which was observed in Lu134 SCLC and A549 NSCLC cells, the nucleotide sequence of open reading frames of cDNA were analyzed No mutation (or polymorphism) causing an amino acid substitution was found in either cell line (data not shown) However, interestingly, short mRNA variant (258 base pairs in the open reading frame, encoding 86 amino acids: see Figure 5) was found

in the Lu134A cell line This variant was found in three of eight sub-clones (37.5%) in our sub-cloning experiment (part of the result is shown in Figure 5) The result suggested the possible involvement of such a variant in the post-transcriptional regulation of ALHD1A1 expression, and also implied a potential difference between SCLC and NSCLC, although further screening of a larger number of cell lines and primary lung cancers is required to test this idea

This is trial version

www.adultpdf.com

using a non-selective antibody (clone 44, BD transduction, Palo Alto, CA), which binds both ALDH1A1 and ALHD2 proteins (ALDH1/2) The protein expression was detected in three

of nine SCLCs (33.3%) and in 41 of 70 NSCLCs (58.6%)(Table 2) The levels tended to be higher in NSCLC, especially SQC, than in SCLC (Figure 5) The results were similar to those

reported by Patel, et al [96], who found in their immunohistochemical analysis that the

ALDH isozymes 1A1 and 1A3 were expressed at significantly higher levels in NSCLC than

in SCLC [96] However, we have found that there is a discrepancy between the results of Western blotting for cancer cell lines and immunohistochemistry for primary lung cancers The frequency of ALDH1/2 protein expression was considerably higher in primary cancers than in cell lines among NSCLCs, whereas it was similar between the two among SCLCs

(Figure 3 and Table 2) Moreover, non-cancerous airway cells in vivo, i.e., both the bronchial,

bronchiole and alveolar epithelial cells, exhibited high levels of immunohistochemical expression of ALHD1/2 protein compared to cancer cells in all cases examined (Figure 7 and Table 2) Interestingly, the two non-cancerous immortalized airway epithelial cell lines

(NHBE-T and HPL1D) showed very weak expression of ALDH1/2 protein in vitro The

ALDH family is expressed in response to toxic stress [99-101] The marked expression of

ALDH1/2 protein in non-cancerous airway epithelial cells in vivo is supposed to be induced

by external stimuli such as dust, cigarette smoke and so on In NSCLCs, ALDH1/2 protein

tended to be expressed more strongly among in situ parts than invasive parts (data not

shown), in support of our supposition Furthermore ALDH1/2 protein expression tended to decrease in parallel with the dedifferentiation process, as a large proportion of poorly differentiated NSCLCs expressed the protein only faintly (data not shown) In well-

differentiated and in situ NSCLCs, ALDH1/2 expression may still be regulated by the

physiological system (it may be lost during progression process to develop poorly differentiated ones) Although further investigation is required to elucidate the mechanism and significance of such a downregulation of ALDH1/2 protein expression in primary lung cancers, the results obtained here imply that ALDH1/2 protein plays diverse roles in different situations is not a universal stem cell marker The mechanism to induce ALDH1/2 protein expression and its significance are likely to differ among the non-cancerous airway epithelia, NSCLCs and SCLCs

two major subtypes of lung cancer possess different biological properties and that the abundance of CSCs population differs between the two We have here focused upon ALDH

to confirm such a potential difference

The proportion of cells with strong ALDH activity tended to be associated with the CD133

mRNA level especially in SCLC cell lines (Figure 2) Recently, Jiang, et al [52] demonstrated,

in SCLC cell lines, that the ALDH1A1high-CD133high-ASCL1high subpopulation exhibits the

features of CSCs and that ASCL1 directly regulates ALDH1A1 and CD133 both in vitro and

in vivo Previous observations [60] are consistent with our results and also support the

hypothesis that the size of the CSC fraction (population) could be one causes of highly malignant activity of SCLC Importantly, however, not all SCLCs among cell lines and primary tumors were found to have either protein expression or a fraction of cells with high ALDH activity (Figure 4, Figure 7 and Table 2) We thus speculate that the ALDH activity is only one of the factors determining the stemness of CSCs in SCLCs Alternatively, ALDH1A1 protein expression or ALDH activity is just part of the machinery to maintain stemness and might have significance only in some fractions of SCLCs On the other hand,

Ucar, et al [95] proposed ALDH activity to be a CSC marker in a NSCLC cell line (NIH-H522 LCC cell line) Moreover, Jiang, et al [49] reported that, in NSCLCs, cancer cells with strong

ALDH1A1 activity, which were isolated using the Aldefluor assay followed by activated cell sorting, showed CSC features and CD133 expression They proposed that ALDH1A1 is a lung cancer stem cell-associated marker, being a potential prognostic factor and therapeutic target for the treatment of patients with lung cancer In our experiments, one NSCLC cell line (PC1 [SQC]) had a high ALDH1A1 protein level and a large fraction of cells with strong ALDH activity (Figure 3 and Figure 5), but did not express CD133 mRNA Taken together, it is supposed that there is considerable heterogeneity in the mechanism maintaining the stemness of CSCs of SCLCs and NSCLCs

fluorescence-Aside from the maintenance of stemness, another interesting finding of our experiments was that the level of ALDH1A1 mRNA did not always parallel the level of protein in SCLC cell lines, whereas, in NSCLC cell lines (Figure 3 and Figure 4), the level of protein was not

always consistent with that of activity Furthermore, the in vivo findings revealed that either non-cancerous airway epithelia or low-grade neoplasms such as well-differentiated or in situ

NSCLCs showed stronger immunohistochemical expression of ALDH1A1 (possibly ALDH2 too) protein than less-differentiated cancer cells

From the current findings, the mechanism and pathway which regulate the expression of ALDH1A1 mRNA and its protein as well as its enzymatic activity, and its role vary in different situations and among non-cancerous airway cells, NSCLCs and SCLCs, as well as among individual tumors We speculate that ALDH1A1, its expression and/or activity, is only one of the factors determining the stemness in lung cancers

In conclusion, the CSCs in SCLC and NSCLC differ distinctly from each other in terms not only of their abundance (suggested by CD133 mRNA levels) but also of the regulatory mechanism of ALDH1A1 expression and its activity, as well as its role in the maintenance/activation of stemness The investigation of the mechanism of ALDH activation and its role in the maintenance of the stemness not only of CSCs but also of normal stem cells would provide a novel paradigm for stem cell biology and the development of a molecular targeting therapy for lung cancer

Fig 1 Hypothesis for the relationship between cancer stem cells (CSCs) and their niche At least one genetic or epigenetic event (yellow arrow) is required to occur in a normal stem cell (NSC; or progenitor cell, not shown here) for a CSC initiation to develop (closed

arrows) The CSCs may utilize the normal niche (1), require the distinct CSC niche (2), instruct an otherwise quiescent niche to become activated by providing signals (“hijacking the niche”) (3), amplify an already existent activated niche (4), or become niche-independent (5) Furthermore, there may be a discrete niche that is inhibitory for CSC maintenance (6) (Modified from [24])

This is trial version

www.adultpdf.com

Fig 2 Expression of ALDH1, ALDH2 and CD133 mRNA in immortalized human airway cell and lung cancer cell lines Levels of mRNA of ALDH1, ALDH2 and CD133 and β-actin (ACTB) were measured by quantitative RT-PCR The mRNA levels of ALDH1 (upper panel), ALDH2 (second panel) and CD133 (lower panel) relative to that of ACTB in

immortalized human airway cells and lung cancer cells are presented IMC, immortalized human airway cell lines; ADC, adenocarcinoma cell lines; SQC, squamous cell carcinoma cell lines; LCC, large cell carcinoma cell lines; NSCLC, non-small cell lung carcinoma cell lines; SCLC, small cell lung carcinoma cell lines The experimental materials and methods are as follows An immortalized human airway epithelial cell line (16HBE14o, Simian virus

40 (SV40)-transformed human bronchial epithelial cells) described by Cozens AL, et al [102]

was kindly provided by Gruenert DC (California Pacific Medical Center Research Institute, CA) via Kaneko T (Division of Respiratory Disease Center, Yokohama City Medical Center Hospital, Yokohama, Japan) A sub-clone of 16HBE14o cells, described as NHBE-T in this chapter, was used An immortalized airway epithelial cell line (HPL1D, SV40-transformed

human small airway epithelial cells) established by Masuda A, et al [103], was provided by

Takahashi T (Division of Molecular Carcinogenesis, Center for Neurological Disease and

This is trial version

www.adultpdf.com

(FBS) (Sigma), 100 units/ml of penicillin (Sigma), and 100 μg/ml of streptomycin (Sigma) Total RNA was extracted from the cells with Isogen reagents (NIPPON GENE, Tokyo, Japan) First-strand cDNA was synthesizedfrom total RNA using the SuperScript First-Strand SynthesisSystem according tothe protocols of the manufacturer (Invitrogen,

Carlsbad, CA).The cDNA generated was used as a template in real-time PCR with SYBR Premix EXTaq (Takara, Kyoto, Japan) The primer set used for ALDH1A1 was forward (F), 5’- agtgcccctttggtggattc; reverse (R), 5’- aagagcttctctccactcttg That for ALDH2 was, F, 5’- ctacacacgccatgaacctg; R, 5’- caaccacgtttccagttg That for CD133 was, F, 5’-

ttgtggcaaatcaccaggta; R, gatgttgggtctcagtcggt That for ACTB was, F,

5’-tggcacccagcacaatgaa; R, 5’- ctaagtcatagtccgcctagaagca The mean of the copy number of ALDH1A1, ALDH2 or CD133 normalized to the value for ACTB mRNA was obtained from triplicate reactions

This is trial version

www.adultpdf.com

Fig 3 Expression of ALDH1A1/ALDH2 (ALDH1/2) protein in lung cancer cell lines ALDH1/2 (top panel) and β-actin (ACTB) (second panel) protein expressions were analyzed

by Western blotting Levels of ALDH1/2 and ACTB protein were semi-quantified with a densitometer (NIH Image; National Institute of Mental Health at Bethesda, MD) The level

of ALDH1/2 normalized to that of ACTB is presented in a graph (third panel) IMC,

immortalized human airway epithelial cell lines; ADC, adenocarcinoma cell lines; SQC, squamous cell carcinoma cell lines; LCC, large cell carcinoma cell lines; NSCLC, non-small cell lung carcinoma cell lines; SCLC, small cell lung carcinoma cell lines The experimental materials and methods are as follows The cell lines (the details of the experimental

materials are described in the legend for Figure 2) grown to sub-confluence were solved with extraction buffer, as described elsewhere [104] After centrifugation, supernatants were recovered as protein extracts The extracts were mixed with equal volumes of

2×sample buffer [104], and then boiled The samples were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and transferred onto PVDF membranes

(Amersham, Arlington Heights, IL) The membranes were incubated with nonfat dry milk

in 0.01 M Tris-buffered saline containing 0.1% Tween-20 (TBS-T) to block

non-immunospecific protein binding, and then with 0.1 μg/ml of a primary antibody which non-selectively binds to both ALDH1A1 and ALDH2 (clone 44, BD Transduction, San Jones, CA) or a primary antibody against ACTB (Sigma) After washing with TBS-T, the

membranes were incubated with animal-matched horseradish peroxidase-conjugated secondary antibodies (Amersham) Immunoreactivity was visualized with the enhanced chemiluminescence system (ECL, Amersham)

This is trial version

www.adultpdf.com

Fig 4 Measurement of fraction of cells with ALDH activity (Aldefluor assay) in lung cancer cell lines Cells were labeled with Aldefluor (BODIPY-aminoacetaldehyde [BAAA]) (Stem cell technology Inc., Vancouver, Canada) with or without the ALDH inhibitor

diethylaminobenzaldehyde (DEAB) (Stem cell technology) The proportion of fraction of cells with ALDH activity was measured by flow cytometer The X-axis is fluorescence intensity (log scale), and the Y-axis is forward scatter level (linear scale) The fraction of cells with strong ALDH activity is shown (red circle) NSCLC, non-small cell lung carcinoma cell lines; ADC, adenocarcinoma cell lines; SQC, squamous cell carcinoma cell lines; SCLC, small cell lung carcinoma cell lines The experimental materials and methods are as follows The details of the cell lines examined are described in the legend for Figure 1 Cells with ALDH activity was labeled using Aldefluor assay kit (Stem cell technology) according to the manufacturer’s instructions Briefly, 1.0×106 cells in 1 ml of Aldefluor assay buffer with BAAA at a concentration of 1.5 mM were incubated for 45 min at 37C In each experiment, a sample of cells was treated under identical conditions with 50 mM of a specific ALDH inhibitor (DEAB) to serve as a negative control The fraction of cells with ALDH activity labeled by Aldefluor was measured with a flow cytometer (BD Science, San Jose, CA) (excitation wave length 488 nm and emission wave length 525 nm (green fluorescence)) Data for 1.0×105 cells were collected

This is trial version

www.adultpdf.com

Fig 5 Analysis of primary structure of mRNA of ALDH1A1 The protein-coding sequence

in ALDH1A1 mRNA was amplified by RT-PCR using primers, forward,

5’-aggagccgaatcagaaatgtc; reverse, 5’-aagagcttctctccactcttg, according to the method descried in the legend for Figure 2 The PCR product was sub-cloned into the plasmid vector pT7Blue (Novagen, Darmstadt, Germany), and then its size was checked by PCR using universal primers (T7 promoter primer and M13M4 primer (Novagen)) (A) A representative result from A549 (ADC) and Lu134A (SCLC) cells is shown Shorter PCR products (faster

migrating band (asterisk)) were found in some sub-clones from Lu134A Bands of expected size with a full-length coding region of ALDH1A1 (NCBI accession # NM_000689) are indicated with an arrow (B) Schema of the primary structure of the consensus mRNA and

the shorter variant with their mRNA spliced sites in the ALDH1A1 gene, is shown The

shorter novel variant consists of parts of exon 1, exon2, exon 11, exon 12, and exon 13 “ex”

in figure means exon

This is trial version

www.adultpdf.com

Fig 6 Two-dimensional Western blotting analysis of ALDH1A1/ALDH2 (ALDH1/2) protein in a NSCLC cell line (top panel; A549) and SCLC cell line (Bottom panel; H1688) Spots of ALDH1/2 protein were circulated with dashed lines MW, molecular weight; KD, kilo-dalton; pI, isoelectric point plugin The experimental materials and methods are as follows Two-dimensional electrophoresis (2-DE) was carried out using a horizontal

electrophoresis system (Maltiphor II; Amersham) according to the manufacture’s

instruction Briefly, equal amount of protein sample was subjected to the first-dimensional isoelectric focusing, and followed by the second dimensional sodium dodecyl sulfate-polyacrylamide gel electrophoresis The details of method are described elsewhere [105,106] The separated proteins on the 2-DE gels were transferred onto a polyvinylidene difluoride membrane (FluoroTrans® PVDF Membrane, Nippon Genetics, Tokyo, Japan) The

membranes were incubated with nonfat dry milk in 0.01 M Tris-buffered saline containing 0.1% Tween-20 (TBS-T) to block non-immunospecific protein binding, and then with 0.1 μg/ml of a primary antibody, which non-selectively binds to both ALDH1A1 and ALDH2 (clone 44, BD Transduction) After washing with TBS-T, the membranes were incubated with animal-matched horseradish peroxidase-conjugated secondary antibodies

(Amersham) Immunoreactivity was visualized with the enhanced chemiluminescence system (ECL, Amersham)

This is trial version

www.adultpdf.com

This is trial version

www.adultpdf.com

Fig 7 Expression of ALDH1A1/ALDH2 (ALDH1/2) protein in non-cancerous airway epithelia and primary lung cancers (A) Representative photographs of

immunohistochemistry of surgical specimens of non-cancerous airway epithelia (top panels) and lung cancers (the other panels) are shown Magnifications are ×200 in, non-cancerous airway epithelia (bronchus, bronchiole and alveolus), adenocarcinoma (ADC), squamous cell carcinoma (SQC) and small cell lung carcinoma (SCLC), and ×400 in the inset of SCLC Levels of ALDH1/2 expression were evaluated according to a scoring system; negative (score 0), unequivocally strong (score 2), and positive but weaker than a score of 2 (score 1) (B) Seventy-nine tumors (49 ADCs, 16 SQCs, 5 large cell carcinomas, and 9 SCLCs) were examined The mean and standard deviation (error bar) among each histological type are shown in graph Differences were analyzed with Student’s t-test, and P value is indicated The experimental materials and methods are as follows All cases examined were of lung cancer patients who underwent surgical resection at the Kanagawa Prefectural

Cardiovascular and Respiratory Disease Center Hospital (Yokohama, Japan) between 2001 and 2008 Informed consent for research use was obtained from all the subjects providing materials Tissue sections (4 μm thick), cut from the formalin-fixed and paraffin-embedded tissue block with largest tumor dimension, were deparaffinized and rehydrated, and incubated with 3% hydrogen peroxide to block endogenous peroxidase activities The sections were incubated with 5% goat serum to block non-immunospecific protein binding After antigen retrieval treatment, boiling in citrated buffer (0.01 M, pH6.0) to restore the masked epitope, the sections were incubated with a primary antibody, which non-

selectively binds to both ALDH1A1 and ALDH2 (clone 44, BD Transduction)

Immunoreactivity was visualized with an Envision detection system (DAKOcytomation, Carpinteria, CA), and the nuclei were counterstained with hematoxylin

This is trial version

www.adultpdf.com

Table 1 Cancer stem cell markers in small cell lung carcinoma amd non-small cell lung carcinoma

This is trial version

www.adultpdf.com

Table 2 Positive rate of immunohistochemical ALDH1/2 expression among NSCLC and SCLC

Abbreviations

SCLC: small cell lung carcinoma; NSCLC: non-small cell lung carcinoma; SQC: squamous cell carcinoma; ADC: adenocarcinoma; LCC: large cell carcinoma; RB: retinoblastoma; TP53: tumor protein 53; EGFR: epidermal growth factor receptor; ASCL1: achaete-scute complex homolog 1; TTF-1: thyroid transcription factor-1; ALDH: aldehyde dehydrogenase; CSC: cancer stem cell; ABCG2, ATP binding cassette transporter superfamily member G2; CIC: cancer initiating cell; SP: side population; FACS: fluorescence activating cell sorting; UV: ultraviolet; uPAR: urokinase plasminogen activator receptor; uPA: urokinase plasminogen activator; Shh: Sonic hedgehog; BMP: bone morphogenetic protein; Bmi1: B cell-specific Mo-MuLV integration site 1; PODXL-1: podocalyxin-like protein 1; RT-PCR: reverse transcription polymerase chain reaction; mRNA, messenger ribonucleic acid: cDNA; complementary deoxyribonucleic acid; siRNA: small interfering RNA; PI: propidium iodide

12 References

[1] Parkin, M., Tyczynski, JE., Boffetta, P., Samet, J., Shields, P., Caporaso, N Lung cancer

epidemiology and etiology In: Travis, W.D., Brambilla, E., Muller-Hermelink, H.K.,

Harris, C.C (eds) Tumours of the lung Tumours of the lung, pleura, thymus and heart

World Health Organization Classification of Tumours Pathology & Genetics Lyon, IARC

Press 2004; 12-15

[2] Travis, W.D., Brambilla, E., Muller-Hermelink, H.K., Harris, C.C (eds) IARC Press:

Lyon, 2004; 9-124 Working group that convened for an editorial and consensus

conference in Lyon, France, March 12-16, 2003 Tumours of the Lung In: World

Health Organization Classification of Tumours Pathology and Genetics of Tumours of the Lung, Pleura, Thymus and Heart

[3] Otto, W.R (2002) Lung epithelial stem cells J Pathol, 197, 527-535

[4] Giangreco, A., Groot, K.R., Janes, S.M (2007) Lung cancer and lung stem cells: strange

bedfellows? Am J Respir Crit Care Med, 175, 547-553

This is trial version

www.adultpdf.com

[5] Giangreco, A., Arwert, E.N., Rosewell, I.R., Snyder, J., Watt, F.M., Stripp, B.R (2009) Stem

cells are dispensable for lung homeostasis but restore airways after injury Proc Natl

Acad Sci USA, 106, 9286-9291

[6] Blanpain, C., Horsley, V., Fuchs, E Epithelial stem cells: turning over new leaves (2007)

Cell, 128, 445-458

[7] Kitamura, H., Yazawa, T., Shimoyamada, H., Okudela, K., Sato, H (2008) Molecular and

genetic pathogenesis of lung cancer: differences between small-cell and

non-small-cell carcinomas Open Pathol J, 2, 106-114 Doi:10.2174/1874375700802010106

[8] Kitamura, H., Yazawa, T., Sato, H., Okudela, K., Shimoyamada, H (2009) Small cell lung

cancer: significance of RB alterations and TTF-1 expression in its carcinogenesis,

phenotype, and biology Endcr Pathol, 20, 101-107

[9] Nuciforo, P., Fraggetta, F (2004) Cancer stem cell theory: pathologists’ considerations

and ruminations about wasting time and wrong evaluations J Clin Patho1, 7,

782-783

[10] Clarke, M.F., Dick, J.E., Dirks, P.B., Eaves, C.J., Jamieson, C.H., Jones, D.L (2006) Cancer

stem cells perspectives on current status and future directions: AACR Workshop

on cancer stem cells Cancer Res, 66, 9339-9344

[11] Lobo, N.A., Shimono, Y., Qian, D., Clarke, M.F (2007) The biology of cancer stem cells

Annu Rev Cell Dev Biol, 23, 675-699

[12] Rapp, U.R., Ceteci, F., Schreck, R (2008) Oncogene-induced plasticity and cancer stem

cells Cell Cycle, 7, 45-51

[13] Kim, C.F., Dirks, P.B (2008) Cancer and stem cell biology: how tightly intertwined? Cell

Stem Cell, 3, 147-150

[14] Yang, Y.M., Chang, J.W (2008) Current status and issues in cancer stem cell study

Cancer Invest, 26, 741-755

[15] Li, X., Lewis, M.T., Huang, J., Gutierrez, C., Osborne, C.K., Wu, M.F (2008) Intrinsic

resistance of tumorigenic breast cancer cells to chemotherapy J Natl Cancer Inst,

100, 672-679

[16] Li, L., Borodyansky, L., Yang, Y (2009) Genomic instability en route to and from cancer

stem cells Cell Cycle, 8, 1000-1002

[17] Hill, R.P (2006) Identifying cancer stem cells in solid tumors: case not proven Cancer

Res, 66, 1883-1890

[18] Kelly, P.N., Dakic, A., Adams, J.M., Nutt, S.L., Strasser, A (2007) Tumor growth need

not be driven by rare cancer stem cells Science, 317, 337

[19] Lewis, M.T (2008) Faith, heresy and the cancer stem cell hypothesis Future Oncol, 4,

[22] Rowan, K (2009) Are cancer stem cells real? After four decades, debate still simmers J

Natl Cancer Inst, 101, 546-547

[23] Sneddon, J.B., Werb, Z (2007) Location, location, location: the cancer stem cell niche

Cell Stem Cell, 1, 607-611

This is trial version

www.adultpdf.com

Discovery of an oncogenic activity in p27Kip1 that causes stem cell expansion and a

multiple tumor phenotype Genes Dev, 21, 1731-1746

[28] Yin, A.H., Miraglia, S., Zanjani, E.D., Almeida-Porada, G., Ogawa, M., Leary, A.G., et al

(1997) AC133, a novel marker for human hematopoietic stem and progenitor cells

Blood, 90, 5002-5012

[29] Wuchter, C., Ratei, R., Spahn, G., Schoch, C., Harbott, J., Schnittger, S., et al (2001)

Impact of CD133 (AC133) and CD90 expression analysis for acute leukemia

immunophenotyping Haematologica, 86, 154-161

[30] Shmelkov, S.V., St Clair, R., Lyden, D., Rafii, S (2005) AC133/CD133/Prominin-1 Int J

Biochem Cell Biol, 37, 715-719

[31] Uchida, N., Buck, D.W., He, D., Reitsma, M.J., Masek, M., Phan, T.V., et al (2000) Direct

isolation of human central nervous system stem cells Proc Natl Acad Sci USA, 97,

14720-14725

[32] Pưtgens, A.J., Bolte, M., Huppertz, B., Kaufmann, P., Frank, H.G (2001) Human

trophoblast contains an intracellular protein reactive with an antibody against

CD133 a novel marker for trophoblast Placenta, 22, 39-645

[33] Salven, P., Mustjoki, S., Alitalo, R., Alitalo, K., Rafii, S (2003) VEGFR-3 and CD133

identify a population of CD34+ lymphatic/vascular endothelial precursor cells

Blood, 101, 168-172

[34] Richardson, G.D., Robson, C.N., Lang, S.H., Neal, D.E., Maitland, N.J., Collins, A.T

(2004) CD133, a novel marker for human prostatic epithelial stem cells Cell Science,

117 pt16, 3539-3545

[35] Piechaczek, C (2001) CD133 J Biol Regul Homeost Agents, 15, 101-102

[36] Yu, Y., Flint, A., Dvorin, E.L., Bischoff, J (2002) AC133-2, a novel isoform of human

AC133 stem cell antigen J Biol Chem, 277, 20711-20716

[37] Marzesco, A.M., Janich, P., Wilsch-Bräuninger, M., Dubreuil, V., Langenfeld, K.,

Corbeil, D., et al Release of extracellular membrane particles carrying the stem cell marker prominin-1 (CD133) from neural progenitors and other epithelial cells J Cell

Science, 118 pt13, 2849-2858

[38] Tạeb, N., Maresca, M., Guo, X.J., Garmy, N., Fantini, J., Yahi, N (2009) The first

extracellular domain of the tumour stem cell marker CD133 contains an antigenic

ganglioside-binding motif Cancer Lett, 278, 164-173

This is trial version

www.adultpdf.com

[39] Choi, D., Lee, H.W., Hur, K.Y., Kim, J.J., Park, G.S., Jang, S.H., et al Cancer stem cell

markers CD133 and CD24 correlate with invasiveness and differentiation in

colorectal adenocarcinoma World J Gastroenterol, 15, 2258-2264

[40] Ahn, S.M., Goode, R.J., Simpson, R.J (2008) Stem cell markers: insights from membrane

proteomics? Proteomics, 8, 4946-4957

[41] Klonisch, T., Wiechec, E., Hombach-Klonisch, S., Ande, S.R., Wesselborg, S.,

Schulze-Osthoff, K., et al Cancer stem cell markers in common cancers - therapeutic implications Trends Mol Med, 14, 450-460

[42] Eramo, A., Lotti, F., Sette, G., Pilozzi, E., Biffoni, M., Di Virgilio A., et al (2008),

Identification and expansion of the tumorigenic lung cancer stem cell population

Cell Death Differ, 15, 504-514

[43] Wang, J., Sakariassen, P.Ø., Tsinkalovsky, O., Immervoll, H., Bøe, S.O., Svendsen, A., et

al (2008) CD133 negative glioma cells form tumors in nude rats and give rise to

CD133 positive cells Int J Cancer, 122, 761-768

[44] Ogden, A.T., Waziri, A.E., Lochhead, R.A., Fusco, D., Lopez, K., Ellis, J.A., et al (2008)

Identification of A2B5+CD133- tumor-initiating cells in adult human gliomas

Neurosurgery, 60, 505-514

[45] Shmelkov, S.V., Butler, J.M., Hooper, A.T., Hormigo, A., Kushner, J., Milde, T., et al

(2008) CD133 expression is not restricted to stem cells, and both CD133+ and

CD133- metastatic colon cancer cells initiate tumors J Clin Invest, 188, 2111-2120 [46] Mizrak, D., Brittan, M., Alison, M.R CD133: molecule of the moment J Pathol, 214, 3-9

[47] Bidlingmaier, S., Zhu, X., Liu, B (2008) The utility and limitations of glycosylated

human CD133 epitopes in defining cancer stem cells J Mol Med, 86, 1025-1032

[48] Meng, X., Wang, X., Wang, Y (2009) More than 45% of A549 and H446 cells are cancer

initiating cells: evidence from cloning and tumorigenic analyses Oncol Rep, 12,

995-1000

[49] Jiang, F., Qiu, Q., Khanna, A., Todd, N.W., Deepak, J., Xing, L, et al (2009) Aldehyde

dehydrogenase 1 is a tumor stem cell-associated marker in lung cancer Mol Cancer

Res, 7, 330-338

[50] Levina, V., Marrangoni, A.M., DeMarco, R., Gorelik, E., Lokshin, A.E (2008)

Drug-selected human lung cancer stem cells: cytokine network, tumorigenic and

metastatic properties PLoS ONE, 2, e3077

[51] Chen, Y.C., Hsu, H.S., Chen, Y.W., Tsai, T.H., How, C.K., Wang, C.Y., et al (2008) Oct-4

expression maintained cancer stem-like properties in lung cancer-derived

CD133-positive cells PLoS ONE, 3, e2637

[52] Jiang, T., Collins, B.J., Jin, N., Watkins, D.N., Brock, M.V., Matsui, W., et al (2009)

Achaete-scute complex homologue 1 regulates tumor-initiating capacity in human

small cell lung cancer Cancer Res, 69, 845-854

[53] Ito, T., Udaka, N., Okudela, K., Yazawa, T., Kitamura, H (2003) Mechanisms of

neuroendocrine differentiation in pulmonary neuroendocrine cells and small cell

carcinoma Endocr Pathol, 14, 133-139

[54] Goodell, M.A., Brose, K., Paradis, G., Conner, A.S., Mulligan, R.C (1996) Isolation and

functional properties of murine hematopoietic stem cells that are replicating in

vivo J Exp Med, 183, 1797-1806

This is trial version

www.adultpdf.com

analysis using a violet-excited cell-permeable DNA dye Stem Cells, 25, 1029-1036

[60] Ho MM, Ng AV, Lam S, Hung JY Side population in human lung cancer cell lines and

tumors is enriched with stem-like cancer cells Cancer Res 2007; 67:4827-4833

[61] Sophos, N.A., Vasiliou, V (2003) Aldehyde dehydrogenase gene superfamily: the 2009

update Chem Biol Interact, 143-144, 5-22

[62] Huang, E.H., Hynes, M.J., Zhang, T., Ginestier, C., Dontu, G., Appelman, H., et al (2009)

Aldehyde dehydrogenase 1 is a marker for normal and malignant human colonic

stem cells (SC) and tracks SC overpopulation during colon tumorigenesis Cancer

Res, 69, 3382-3389

[63] Jones, R.J., Barber, J.P., Vala, M.S., Collector, M.I., Kaufmann, S.H., Ludeman, S.M., et al

(1995) Assessment of aldehyde dehydrogenase in viable cells Blood, 85, 2742-2746 [64] Armstrong, L., Stojkovic, M., Dimmick, I., Ahmad, S., Stojkovic, P., Hole, N., et al (2004)

Phenotypic characterization of murine primitive hematopoietic progenitor cells

isolated on basis of aldehyde dehydroganse activity Stem Cells, 22, 1142-1151 [65] Corti, S., Locatelli, F., Papadimitriou, D., Donadoni, C., Salani, S., Del Bo, R., et al (2006)

Identification of a primitive brain-derived neural stem cell population based on

aldehyde dehydrogenase activity Stem Cells, 24, 975-985

[66] Ginestier, C., Hur, M.H., Charafe-Jauffret, E., Monville, F., Dutcher, J., Brown, M., et al

(2007) ALDH1 is a marker of normal and malignant human mammary stem cells

and a predictor of poor clinical outcome Cell Stem Cell, 1, 555-567

[67] Dylla, S.J., Beviglia, L., Park, I.K., Chartier, C., Raval, J., Ngan, L., et al (2008) Colorectal

cancer stem cells are enriched in xenogeneic tumors following chemotherapy PLoS

ONE, 3, e2428

[68] Storms, R.W., Trujillo, A.P., Springer, J.B., Shah, L., Colvin, O.M., Ludeman, S.M., et al

(1999) Isolation of primitive human hematopoietic progenitors on the basis of

aldehyde dehydrogenase activity Proc Natl Acad Sci USA, 96, 9118-9123

[69] Koch, L.K., Zhou, H., Ellinger, J., Biermann, K., Höller, T., von Rücker, A., et al (2008)

Stem cell marker expression in small cell lung carcinoma and developing lung

tissue Hum Pathol, 39, 1597-1605

[70] Lanza, F., Healy, L., Sutherland, D.R Structural and functional features of the CD34

antigen: an update J Biol Regul Homeost Agents, 15, 1-13

This is trial version

www.adultpdf.com

[71] Nielsen, J.S., McNagny, K.M (2008) Novel functions of the CD34 family J Cell Sci,

121pt22, 3683-92

[72] Doyonnas, R., Nielsen, J.S., Chelliah, S., Drew, E., Hara, T., Miyajima, A., McNagny,

K.M (2005) Blood, 105, 4170-4178

[73] Gutova, M., Najbauer, J., Gevorgyan, A., Metz, M.Z., Weng, Y., Shih, C.C., et al (2007)

Identification of uPAR-positive chemoresistant cells in small cell lung cancer PLoS

ONE, 2, e243

[74] Alfano, D., Franco, P., Vocca, I., Gambi, N., Pisa, V., Mancini, A., Caputi, M., Carriero,

M.V., Iaccarino, I., Stoppelli, M.P (2009) The urokinase plasminogen activator and

its receptor: role in cell growth and apoptosis Thromb Haemost, 93, 205-211

[75] Van der Flier, L.G., Clevers, H (2009) Stem cells, self-renewal, and differentiation in the

intestinal epithelium Annu Rev Physiol, 71, 5.1-5.20

[76] Liao, X., Siu, M.K., Au, C.W., Chan, Q.K., Chan, H.Y., Wong, E.S., et al (2009) Aberrant

activation of hedgehog signaling pathway contributes to endometrial

carcinogenesis through β-catenin Mod Pathol, 22, 839-847

[77] Watkins, D.N., Berman, D.M., Burkholder, S.G., Wang, B., Beachy, P.A., Baylin, S.B

(2003) Hedgehog signalling within airway epithelial progenitors and in small-cell

lung cancer Nature, 422, 313-317

[78] Yagui-Beltrán, A., He, B., Jablons, D.M (2008) The role of cancer stem cells in neoplasia

of the lung: past, present and future Clin Transl Oncol, 10, 719-725

[79] Peacock, C.D., Watkins, D.N (2008) Cancer stem cells and the ontogeny of lung cancer J

Clin Oncol, 26, 2883-2889

[80] Lemjabbar-Alaoui, H., Dasari, V., Sidhu, S.S., Mengistab, A., Finkbeiner, W., Gallup, M.,

et al (2006) Wnt and Hedgehog are critical mediators of cigarette smoke-induced

lung cancer PLoS ONE, 1, e93

[81] Alison, M.R., Islam, S (2009) Attributes of adult stem cells J Pathol, 217, 144-160

[82] Polakis, P (2000) Wnt signaling and cancer Genes Dev, 14, 1837-1851

[83] Reya, T., Clevers, H (2005) Wnt signalling in stem cells and cancer Nature, 434, 843-850

[84] Valk-Lingbeek, M.E., Bruggenman, S.W.M., van Lohuizen, M (2004) Stem cell and

cancer: poly-comb connection Cell, 118, 409-418

[85] Dovey, J.S., Zacharek, S.J., Kim, C.F., Lees, J.A (2008) Bmi1 is critical for lung

tumorigenesis and bronchioalveolar stem cell expansion Proc Natl Acad Sci USA

105, 11857-11862

[86] Ovitt, C.E., Schöler, H.R (1998) The molecular biology of Oct-4 in the early mouse

embryo Mol Hum Reprod, 4, 1021-1031

[87] Basak, S.K., Veena, M.S., Oh, S., Huang, G., Srivatsan, E., Huang, M., Sharma, S., Batra,

R.K (2009) The malignant pleural effusion as a model to investigate intratumoral

heterogeneity in lung cancer PLoS One, 4, e5884

[88] Collins, A.T., Berry, P.A., Hyde, C., Stower, M.J., Maitland, N.J (2005) Prospective

identification of tumorigenic prostate cancer stem cells Cancer Res, 65, 10946-10951

[89] Annabi, B., Lachambre, M.P., Plouffe, K., Sartelet, H., Béliveau, R (2009) Modulation of

invasive properties of CD133(+) glioblastoma stem cells: a role for MT1-MMP in

bioactive lysophospholipid signaling Mol Carcinog, 48, 910-919

This is trial version

www.adultpdf.com

Res Ther, 3, 237-46

[95] Ucar, D., Cogle, C.R., Zucali, J.R., Ostmark, B., Scott, E.W., Zori, R., et al (2009)

Aldehyde dehydrogenase activity as a functional marker for lung cancer Chem Biol

Interact, 178, 48-55

[96] Patel, M., Lu, L., Zander, D.S., Sreerama, L., Coco, D., Moreb, J.S (2008) ALDH1A1 and

ALDH3A1 expression in lung cancers: correlation with histologic type and

potential precursors Lung Cancer, 59, 340-349

[97] Carpentino, J.E., Hynes, M.J., Appelman, H.D., Zheng, T., Steindler, D.A., Scott, E.W.,

Huang, E.H (2008) Aldehyde dehydrogenase-expressing colon stem cells

contribute to tumorigenesis in the transition from colitis to cancer Cancer Res, 69,

8208-8215

[98] Christ, O., Lucke, K., Imren, S., Leung, K., Hamilton, M., Eaves, A., Smith, C., Eaves, C

(2007) Improved purification of hematopoietic stem cells based on their elevated

aldehyde dehydrogenase activity Haematologica, 92, 1165-1172

[99] Sisson, J.H (2007) Alcohol and airways function in health and disease Alcohol, 41,

293-307

[100] Moriwaki, Y., Yamamoto, T., Higashino, K (1997) Distribution and pathophysiologic

role of molybdenum-containing enzymes Histol Histopathol, 12, 513-524

[101] Yin SJ Alcohol dehydrogenase: enzymology and metabolism Alcohol Alcohol Suppl

1994;2:113-9

[102] Cozens, A.L., Yezzi, M.J., Kunzelmann, K., Ohrui, T., Chin, L., Eng, K., Finkbeiner,

W.E., Widdicombe, J.H., Gruenert, D.C CFTR expression and chloride secretion in

polarized immortal human bronchial epithelial cells Am J Respir Cell Mol Biol, 10,

38-47

[103] Masuda, A., Kondo, M., Saito, T., Yatabe, Y., Kobayashi, T., Okamoto, M., Suyama, M.,

Takahashi, T., Takahashi, T (1997) Establishment of human peripheral lung epithelial cell lines (HPL1) retaining differentiated characteristics and responsiveness to epidermal growth factor, hepatocyte growth factor, and

transforming growth factor β1 Cancer Res, 57, 4898-4904

[104] Okudela, K., Hayashi, H., Ito, T., Yazawa, T., Suzuki, T., Nakane, Y., Sato, H., Ishi, H.,

KeQin, X., Masuda, A., Takahashi, T., Kitamura, H (2004) K-ras gene mutation enhances motility of immortalized airway cells and lung adenocarcinoma cells via

This is trial version

www.adultpdf.com