FULL ĐỀ THI OLYMPIC SINH HỌC QUỐC TẾ 2014 PART A

FULL ĐỀ THI OLYMPIC SINH HỌC QUỐC TẾ 2014 PART A Khi có mặt estrogen, protein thụ thể α của estrogen (kí hiệu ERα) điều hòa biểu hiện của khoảng 10.000 gen ở người. Để nghiên cứu khả năng tương tác giữa protein X với ERα, em phải tạo ra những tế bào thiếu gen x (dòng tế bào này gọi là KO). Em xử lý các dòng KO và kiểu dại (WT) với estrogen (+E) hoặc không (-E). Rồi sau đó, em tiến hành phản ứng kết tủa miễn dịch chất nhiễm sắc (phương pháp này gọi là ChIP, như minh họa ở hình dưới); theo đó, trước tiên các protein ERα liên kết vào các vị trí gắn kết trong hệ gen của chúng (kiểu liên kết này có thể nghịch đảo). Hệ gen sau đó được phân mảnh rồi các phân đoạn chất nhiễm sắc chứa ERα được chiết tách nhờ các kháng thể đa dòng kháng ERα.

25th INTERNATIONAL BIOLOGY OLYMPIAD

5 – 13 July, 2014 INDONESIA

THEORETICAL TEST

PART A

ĐỀ THI LÝ THUYẾT PHẦN A

Total points (Tổng điểm): 50

Duration (Thời gian): 180 minutes (phút)

COUNTRY:

NƯỚC VIETNAM

STUDENT ID:

SỐ BÁO DANH

INSTRUCTIONS:

1 Fill in your STUDENT ID and your country in the Answer Sheet

2 Each question contains four statements which you must indicate as True or False

 If you answer correctly to all four statements, you will receive 1 point

 If you answer correctly to only three statements, you will receive 0.6 point

 If you answer correctly to only two statements, you will receive 0.2 point

 If there is only one statement with the correct answer, you will not receive any points (0)

 There is no minus system

3 Tick (√) the correct answer in your Answer Sheet using a pen (in ink) If you need to change an answer, you should strikethrough the wrong answer and write in the new one (see the example below) In the table, T=True, F=False

1 Nhớ ghi SỐ BÁO DANH vào trang bìa PHIẾU TRẢ LỜI

2 Mỗi câu hỏi gồm 4 lựa chọn, đều phải chỉ rõ mỗi lựa chọn là ĐÚNG hay SAI

 Nếu cả 4 lựa chọn đều đúng, được 1 điểm

 Nếu 3 lựa chọn đúng, được 0,6 điểm

 Nếu 2 lựa chọn đúng, được 0,2 điểm

 Nếu chỉ có 1 hoặc 0 lựa chọn đúng, Không được điểm (0)

 Không trừ điểm nếu lựa chọn sai

3 Đánh dấu (√) vào phương án lựa chọn của mình trong Phiếu trả lời rõ ràng bằng bút mực (hoặc bút bi) Nếu muốn thay đổi phương án lựa chọn trước

đó, hãy gạch ngang câu trả lời sai, rồi viết lại câu trả lời (lựa chọn) mới rõ ràng (xem ví dụ dưới đây) Trong tất cả các bảng, T = True (ĐÚNG), còn F=False (SAI)

CELL AND MOLECULAR BIOLOGY / SINH HỌC PHÂN TỬ VÀ TẾ BÀO

1 In the presence of estrogen, the estrogen receptor α (ERα) regulates around 10,000 genes in humans

To study the interaction of protein X with ERα, you have generated cells that lack gene x (KO)

You treat KO and wild type (WT) cells with estrogen (+E) or not (-E) You next perform Chromatin Immunoprecipitation (ChIP, see figure below) , in which ERα proteins are first temporarily cross linked to their current binding location in the genome The genome is fragmented and fragments containing Erα are extracted with polyclonal antibodies against ERα

Khi có mặt estrogen, protein thụ thể α của estrogen (kí hiệu ERα) điều hòa biểu hiện của khoảng 10.000 gen ở người Để nghiên cứu khả năng tương tác giữa protein X với ERα, em phải tạo ra những tế bào thiếu

gen x (dòng tế bào này gọi là KO) Em xử lý các dòng KO và kiểu dại

(WT) với estrogen (+E) hoặc không (-E) Rồi sau đó, em tiến hành phản ứng kết tủa miễn dịch chất nhiễm sắc (phương pháp này gọi là ChIP, như minh họa ở hình dưới); theo đó, trước tiên các protein ERα liên kết vào các vị trí gắn kết trong hệ gen của chúng (kiểu liên kết này có thể nghịch đảo) Hệ gen sau đó được phân mảnh rồi các phân đoạn chất nhiễm sắc chứa ERα được chiết tách nhờ các kháng thể đa dòng kháng ERα

[Ghi chú hình: Antibody = Kháng thể; Chromatin = Chất nhiễm

sắc; DNA ladder = Thang chuẩn kích thước ADN]

After releasing Erα, the DNA fragments are isolated and amplified with primers for the promoter

region of a gene a, known to be upregulated by estrogen Electrophoresis results are shown below

Sau khi được xử lý giải phóng khỏi ERα và các protein khác, các phân đoạn ADN này được phân lập rồi khuếch đại (theo kiểu định

lượng) bằng cặp mồi đặc hiệu với vùng promoter của gen a vốn bình

thường được tăng cường biểu hiện bởi estrogen như một yếu tố phiên

mã Kết quả điện di sản phẩm khuếch đại thu được như dưới đây

Indicate if each of the following statements is true or false

This experiment suggests that protein X interferes with the binding of ERα to :

Mỗi phát biểu dưới đây là đúng hay sai?

Thí nghiệm trên đây cho thấy protein X ảnh hướng đến sự liên kết của protein ERα tới :

A the promoters of all gene regulated by ERα

vùng promoter của tất cả các gen trong hệ gen được điều hòa bởi ERα

B the promoter of gene a

vùng promoter của riêng gen a

C all its possible protein partners

tất cả các protein thành phần có thể có của nó

D the protein product of gene a

sản phẩm protein của gen a

2 An experiment was performed to study the relation between H concentration and ATP synthesis in mitochondria Mitochondria were isolated from the cell and placed into a pH 8 media (test tube A), then immediately transferred into a pH 7 media (test tube B) Later, ATP synthesis was verified in test tube B

Người ta tiến hành một thí nghiệm để tìm hiểu mối quan hệ giữa nồng độ

H+ và sự sinh tổng hợp ATP ở ti thể (mitochondria) Ti thể được phân lập từ tế bào rồi được đặt vào môi trường có pH 8 (ống nghiệm A), rồi tức thì được chuyển sang môi trường có pH 7 (ống nghiệm B) và sự tổng hợp ATP ở ống nghiệm B được ghi nhận

[Ghi chú hình: Outer membrane=Màng ngoài ti thể; Intermembrane space= Khoảng giữa

màng trong và màng ngoài ti thể; Inner membrane=Màng trong ti thể; Matrix=Chất nền] Indicate if each of the following statements is true or false

Mỗi phát biểu dưới đây là đúng hay sai?

A In tube B, ATP was synthesized in the matrix of mitochondria

Ở ống B, ATP được tổng hợp trong chất nền ti thể

B In tube B, ATP was synthesized without the help of electron transport system

Ở ống B, ATP được tổng hợp mà không nhất thiết cần chuỗi chuyền điện tử

C If mitochondria in tube A was transferred into a pH 9 media, ATP synthesis will occur in the intermembrane space of mitochondria

Nếu ti thể ở ống A được chuyển sang môi trường có pH 9, sự tổng hợp ATP sẽ xuất hiện trong vùng giữa hai lớp màng của ti thể

D If mitochondria remains in tube A but glucose is added, there will be ATP synthesis Nếu tiếp tục giữ ti thể trong ống A và glucôzơ được bổ sung thì ATP được tổng hợp

3 You plan to insert the gene PhoQ from Tobibacterium sp into a plasmid vector containing

an artificial promotor followed by a restriction site for NcoI (CCATGG) and a restriction site for EcoRI (GAATTC)

Em dự kiến cài gen PhoQ phân lập từ loài thuộc chi Tobibacterium vào một

vectơ plazmit chứa một promoter nhân tạo ở phía sau (xuôi dòng) nó

có một vị trí giới hạn của enzym NcoI (CCATGG) và một vị trí giới hạn của EcoRI (GAATTC).

To conduct this experiment you are required to design forward (the sense strand) and reverse

(antisense strand) primers of 20 nucleotides that do not affect the reading frame Part of the 561 nucleotide long coding sequnce is shown below

Để thực hiện thí nghiệm này, bạn phải thiết kế một cặp mồi xuôi (mạch mã hóa) và mồi ngược (mạch đối mã) gồm 20 nucleotit nằm phía ngoài khung đọc mở Một phần của đoạn trình tự mã hóa thuộc gen này dài

561 nucleotit như sau

5’-ATGCGACAGTTCATCACCGA GCGGGACCGGACTGGGGTAA-3’

Indicate if each of the following statements is true or false

Mỗi phát biểu dưới đây là đúng hay sai?

A The use of two restriction sites avoids wrong orientation of the inserted fragment Hai vị trí giới hạn với trình tự trên đây giúp đoạn cài được gắn đúng chiều vào vectơ

B A possible forward primer for amplification and recombination of PhoQ gene will have

the following sequence: 5’ –CCATGGGAATGCGACAGTTC –3’

Một mồi xuôi để khuếch đại và tái tổ hợp gen PhoQ vào vectơ nêu trên có

thể có trình tự sau đây: 5’ –CCATGGGAATGCGACAGTTC –3’

C A possible reverse primer for amplification and recombination of PhoQ gene will have

the following sequence: 5’ – GAATTCAATGGGGTCAGGCC – 3’

Một mồi ngược để khuếch đại và tái tổ hợp gen PhoQ vào vectơ nêu trên có thể có trình

tự sau đây: 5’ – GAATTCAATGGGGTCAGGCC – 3’

D The final gene product will consist of at least 189 amino acids

Sản phẩm của gen này được biểu hiện bởi vectơ có ít nhất 189 axit amin

Plasmid vector

Promoter NcoI

EcoRI

4 Indicate if each of the following statements about posttranslational modification of

eukaryotic proteins is true or false

Mỗi phát biểu dưới đây là đúng hay sai khi nói về sự biến đổi sau dịch

mã của các protein ở sinh vật nhân thực?

A Disulfide bond formation on a protein occur in the endoplasmic reticulum

Sự hình thành cầu đisunphit trên phân tử protein diễn ra

ở lưới nội chất

B Glycoproteins may be found in viruses that infect human

Glycoprotein có thể tìm thấy ở virut lây nhiễm ở người

C Oligosaccharide group addition to a protein may occur in both Golgi apparatus and endoplasmic reticulum

Việc bổ sung nhóm oligosacarit vào protein có thể diễn ra ở cả bộ máy Golgi và lưới nội chất

D Palmitoylation of a protein can change its intracellular localization

Việc gắn thêm nhóm (gốc) palmitoyl vào phân tử protein có thể làm thay đổi vị trí định vị nội bào của protein

5 An experiment was performed to create a recombinant DNA between plasmid X and DNA

insert Y Plasmid X contains leu2 gene for leucine biosynthesis while DNA fragment Y contains kanamycin-resistance gene KanR The diagram for X and Y are shown below

Người ta tiến hành một thí nghiệm để tạo ADN tái tổ hợp giữa plazmit X và đoạn

cài ADN kí hiệu Y Plazmit X mang gen leu2 cần cho sinh tổng hợp Lơxin trong khi phân đoạn Y chứa gen kháng kháng sinh kanamycin KanR Hình

dưới biểu diễn sơ đồ cấu trúc của X và Y với các vị trí giới hạn

[Ghi chú hình: DNA insert Y (contains KanR) = Đoạn cài ADN kí hiệu Y (chứa gen KanR);

Ori1 = Trình tự khởi đầu tái bản]

Plasmid X and DNA insert Y were added to a reaction mix containing restriction enzymes BglIII

(5’-A*GATCT-3’), BamHI (5’-G*GATCC-3’), and the resulting fragments then transferred to a new reaction mix

containing ligase The resulting DNA was transformed into bacterial culture Z which is sensitive to kanamycin and unable to survive in leucine-deficient medium Selection for transformed Z cells containing the

recombinant plasmid (plasmid X with DNA insert Y) was performed by growing the culture on a selective medium containing kanamycin and no leucine The recombinant plasmid was then isolated from the culture Assume that all isolated plasmids are in circular conformation and there is no partial restriction reaction, all plasmids are cut completely by the restriction enzyme. (Note: (*) indicates the location of bond hydrolysis)

Plazmit X và đoạn cài Y được bổ sung vào hỗn hợp phản ứng chứa các enzym

giới hạnBglIII (với trình tự giới hạn 5’-A*GATCT-3’), BamHI (5’-G*GATCC-3’)

rồi các phân đoạn ADN thu được sau đó được chuyển sang một hỗn hợp phản ứng mới chứa ligaza Phân tử ADN tái tổ hợp nhận được sau đó được biến nạp vào chủng vi khuẩn Z vốn mẫn cảm với Kanamycin và không thể sống trong môi trường thiếu lowxxin Để chọn ra các tế bào Z chứa plazmit tái tổ (gồm cả plazmit Z và đoạn cài Y), vi khuẩn Z sau biến nạp được nuôi trên môi trường chọn lọc chứa kháng sinh Kanamycin và không có lơxin Từ các vi khuẩn sống sót, plazmit tái tổ hợp được phân lập Giả sử tất cả các plazmit phân lập được đều có dạng vòng và mọi phản ứng cắt giới hạn đều xảy ra hoàn toàn (nghĩa là tất cả các plazmit đều được cắt bởi enzym giới hạn) [Lưu ý: dấu (*) ở các trình tự giới hạn trên là vị trí thủy phân của enzym giúp xác định khả năng bổ sung giữa các phân đoạn cắt giới hạn)

Plasmid X

DNA insert Y

(contains KanR)

Indicate if each of the following statements is true or false

Mỗi phát biểu dưới đây là đúng hay sai?

A Cutting the recombinant plasmid using EcoRI will result in single 2800 bp DNA

fragment on the electrophoresis gel

Dùng EcoRI để cắt plazmit tái tổ hợp sẽ thu được một phân

đoạn ADN có kích thước 2800 bp duy nhất trên gel điện di

B If in the reaction mix HindIII (5’-A*AGCTT-3’) was used instead of BglIII, the

transformed bacteria are capable of growing on a medium containing Kanamycin

Nếu trong hỗn hợp phản ứng, HindIII (5’-A*AGCTT-3’) được dùng thay thế cho BglIII, vi khuẩn sau khi biến nạp

với vectơ tái tổ hợp cũng có khả năng sinh trưởng trên môi trường chứ Kanamycin

C The 500 bp insert DNA can be removed from the recombinant plasmid by using

restriction enzyme BglIII

Có thể tách đoạn cài ADN dài 500 bp khỏi plazmit tái tổ

hợp bằng enzym BglIII

D The migration pattern of the recombinant plasmid on an electrophoresis gel is different when it is cut with EcoRI or BamHI

Kiểu hình điện di của plazmit tái tổ hợp sẽ khác so với khi

nó được cắt bằng hỗn hợp EcoRI và BamHI

6 Consider a protein containing four epitopes: an oligosacharide ( O ) and three peptides (P1, P2, P3) The following figure illustrates the interaction between B and T cells

Xem xét một protein chứa 4 epitop (vùng định dạng kháng nguyên) gồm

1 gốc oligosacarit (kí hiệu O) và 3 peptit (kí hiệu P1, P2, P3) Hình sau

minh họa mối tương tác giữa các tế bào lympho B và T.

[Ghi chú hình: Antigen = Kháng nguyên; Membrane bound antibody = Kháng thể liên kết

màng; T cell receptor = Thụ thể tế bào T; MHC class II = Phức hệ tương hợp mô lớp II;

T cell = Tế bào T; B cell = Tế bào B]

Indicate if each of the following statements is true or false

Mỗi phát biểu dưới đây là đúng hay sai?

A Antibody production for epitope O by B cells may occur only when the O epitope is

presented by B cells to T cells

Tế bào B chỉ tạo ra kháng thể kháng epitop O khi epitop

O được tế bào B trình diện tới tế bào T

B All of the four epitopes could be recognized by the population of B cells

Cả 4 loại epitop đều có thể được nhận biết bởi quần thể

lớn các tế bào B

C A single B cell produces antibodies recognizing only one of the four epitopes

Một tế bào B riêng lẻ chỉ nhận biết 1 trong 4 loại epitop

D Via MHC II proteins, a single B cell can present diverse protein fragments to the T cells Qua phức hệ protein tương hợp mô MHC lớp II, một tế

bào B riêng lẻ có thể trình diện nhiều phân đoạn protein

khác nhau đến các tế bào T

7 The diagram below shows the distribution of proteins X and Y on a small area on outer surface of cell membrane

Hình dưới minh họa sự phân bố của các protein X và Y trên một vùng nhỏ của mặt ngoài màng tế bào

[Ghi chú hình: Lipid bilayer = Lớp lipit kép; Actin filament = Sợi actin]

Protein Y is bound to immobile actin filaments on the inner surface of cell membrane There is no similar domain found in protein X An experiment is conducted to show the mobility of Protein X and Y in cell membranes Those proteins are labeled by different fluorescent dye (red for protein X and green for protein Y with only one fluorescent molecule for each protein) and then analyzed by Fluorescence Loss In

Photobleaching (FLIP) In this technique, a small region of the surface is continuously irradiated to bleach the dye molecules, and the intensity of cell’s fluorescence is followed over time

Protein Y có miền cấu trúc với chức năng đính kết vào sợi Actin cố định ở mặt trong của màng tế bào Không có miền cấu trúc tương tự ở protein X Người

ta tiến hành thí nghiệm cho thấy sự di chuyển của các protein X và Y trên màng Các protein này được đánh dấu bằng các thuốc nhuộm huỳnh quang khác nhau (màu đỏ cho protein X và màu xanh cho protein Y, với chỉ một phân tử huỳnh quang duy nhất gắn vào mỗi protein) rồi được phân tích bằng

kỹ thuật Tẩy Huỳnh Quang (FLIP) Trong kỹ thuật này, một vùng nhỏ của bề mặt tế bào được chiếu xạ làm mất các phân tử thuốc nhuộm và mật độ huỳnh quang được theo dõi qua thời gian

Indicate if each of the following statements is true or false

Mỗi phát biểu dưới đây là đúng hay sai?

A After long term irradiation only green fluorescence will be preserved

Sau một thời gian chiếu xạ đủ dài, chỉ có huỳnh quang màu xanh được nhìn thấy ở vùng chiếu xạ

B If the short time irradiation is conducted, the fluorescence of both colors will recover to their initial state in the bleached region

Nếu thời gian chiếu xạ đủ ngắn, mật độ huỳnh quang của cả hai màu sẽ được phục hồi nguyên vẹn về trạng thái ban đầu ở các vùng được tẩy huỳnh quang

C If the actin cytoskeleton was disrupted with cytochalasin, the fluorescence of the cell is bleached completely after long term irradiation

Nếu khung xương tế bào chứa sợi actin bị phá vỡ bởi chất cytochalasin, huỳnh quang trên bề mặt tế bào sẽ bị tẩy hoàn toàn sau một thời gian chiếu xạ đủ dài

D Cooling down the cells to 20oC will accelerate the bleaching of the red fluorescence on the cell surface

Làm lạnh tế bào về 20oC sẽ làm gia tăng tốc độ tẩy huỳnh

quang màu đỏ trên bề mặt tế bào

8 Six isolates of anaerobic soil bacteria (A-F) were analyzed to study their role in the nitrogen cycle Each isolates were grown on four different broths: (1) Peptone (short polypeptides), (2) Ammonium, (3) Nitrate, and (4) Nitrite Only the nitrate broth contained carbohydrate as a carbon source After 7 days of incubation, the bacterial culture were biochemically tested to observe changes in the medium and the results are shown below:

Có 6 chủng vi khuẩn kị khí được phân lập từ đất (kí hiệu từ A đến F) được phân tích để tìm hiểu vai trò của chúng trong chu trình nitơ Mỗi chủng được nuôi trong 4 môi trường nước thịt khác nhau: (1) Peptone (các polypeptit ngắn), (2) Amôniăc, (3) Nitrat và (4) Nitrit Sau 7 ngày nuôi, các mẫu vi khuẩn được phân tích hóa sinh để quan sát sự thay đổi trong môi trường và kết quả thu được như sau:

+ = bacterial growth was observed (Vi khuẩn mọc)

- = bacterial growth was not observed (Vi khuẩn KHÔNG mọc)

pH+ = Increased pH of the medium (pH môi trường tăng)

NO2- = Positive result of nitrite test (Có nitrit)

NO3- = Positive result of nitrate test (Có nitrat)

Gas = Gas production in the medium (by using durham tube) = Có chất khí (phát hiện bằng ống durham)

Indicate if each of the following statements is true or false

Mỗi phát biểu dưới đây là đúng hay sai?

A Isolate C belongs to the group of nitrifying bacteria (oxidize ammonium to nitrite then nitrate)

Chủng C thuộc nhóm vi khuẩn sinh nitrit (oxy hóa amôniăc thành nitrit rồi sau đó thành nitrat)

B Isolates B and D are denitrifying bacteria

Các chủng B và D thuộc nhóm khử (sử dụng được) nitrit

C Isolates C and E are chemoheterothropic bacteria

Các chủng C và E thuộc nhóm Hóa dị dưỡng

D Isolates A and F are able to use nitrate to produce energy

Các chủng A và F có thể sử dụng Nitrat để sản sinh năng lượng

9 The figure below shows part of the DNA sequence of the autosomal gene GRB10 from a mother and her

child (fetal) The mRNA was obtained from fetal heart and brain and then sequenced (see figure below)

Hình dưới biểu diễn một đoạn trình tự ADN của gen X trên NST thường từ

một người mẹ và em bé (thai nhi) của cô ta mARN được phân lập từ

các mô tim và não của thai nhi, sau đó được giải trình tự Trước khi

giải trình tự mARN được chuyển thành cADN rồi được khuếch đại

bằng PCR (xem Hình dưới đây).

[Ghi chú hình: Maternal DNA = ADN của mẹ; Fetal DNA = ADN thai nhi;

Fetal Brain DNA = ADN não thai nhi; Fetal Heart DNA = ADN tim thai nhi]

Indicate if each of the following statements is true or false

Mỗi phát biểu dưới đây là đúng hay sai?

A The father must be heterozygous at this locus

Bố chắc chắn có kiểu gen dị hợp tử về locut này

B In the fetal brain, the GRB10 gene was expressed from the maternal chromosome

Ở não thai nhi, gen X được biểu hiện có nguồn gốc từ mẹ.

C In the fetal heart, the GRB10 gene was expressed from both parents

Ở tim thai nhi, gen X được biểu hiện ở cả hai bản sao có nguồn

gốc từ bố và mẹ

D This result suggests tissue specific splicing of X

Kết quả này cho thấy gen X được cắt nối intron khác nhau giữa

hai mô

10 There are several mechanisms in eukaryotic cells to generate a diversity of proteins from a single gene Alternative splicing of the Down Syndrome Cell Adhesion Molecule (DSCAM) gene, for instance, may result

in 38,000 different protein products , VDJ recombination in the formation of mouse immunoglobulin may result in 144,000 different heavy-chain proteins

Sinh vật nhân thực có một số cơ chế cho phép chúng tạo ra các protein khác nhau từ một gen duy nhất Chẳng hạn như, các cách cắt-nối

intron khác nhau ở gen gây bệnh Phân tử Dính kết Tế bào Hội chứng Đao (DSCAM) có thể dẫn đến hình thành 38.000 sản phẩm protein khác nhau Sự tái tổ hợp các phân đoạn V-D-J trong sự hình thành globulin miễn dịch (kháng thể) ở chuột có thể tạo được 144.000 chuỗi nặng khác nhau

Indicate if each of the following statements is true or false

Mỗi phát biểu dưới đây là đúng hay sai?

A Protein diversity on the immunoglobulin heavy-chain is generated by RNA

recombination while on the DSCAM proteins is generated by DNA recombination

Sự đa dạng protein về chuỗi nặng kháng thể là do sự tái

tổ hợp ARN trong phiên mã, trong khi sự đa dạng của protein DSCAM là do tái tổ hợp ADN hệ gen

B Only one type of heavy-chain protein is produced by a plasma cell, while there are often more than one protein types produced by a single cell in which the DSCAM gene is actively expressed

Mỗi tương bào chỉ sản sinh một loại chuỗi nặng của

kháng thể, trong khi một tế bào có thể tạo ra nhiều hơn một loại protein DSCAM nếu gen này được hoạt hóa

C Disorder in the VDJ recombination maybe related to immunodefficiency diseases Rối loạn về tái tổ hợp giữa các phân đoạn V-D-J có thể gây các bệnh liên quan đến miễn dịch

D Although alternative splicing of DSCAM results in various mRNA sequences, and these are all of the same length

Tuy sự cắt-nối intron trong các bản phiên mã mARN của gen DSCAM có thể khác nhau, song tất cả các sản phẩm phiên mã của gen này đều có chiều dài giống hệt nhau

PLANT ANATOMY AND PHYSIOLOGY

11 The following diagram shows representative end products of plant cell differentiation from

a meristematic cell

Hình dưới đây minh họa sự phân hóa các tế bào thực vật từ tế bào

mô phân sinh

(Ghi chú trong hình : Differentiation = Phân hóa; Meristematic Cell:

Tế bào mô phân sinh)

Indicate if each the following statements is true or false

Hãy xác định câu đúng, sai

A B, F, and G are living cells

B, F và G là các tế bào sống

B Differentiation of a meristematic cell into A, B, C and D requires lignin biosynthesis Phân hóa của mô phân sinh A, B, C và D cần có Sinh tổng hợp lignin

C Cell E can differentiate into Cell D

Tế bào E có thể phân hóa thành Tế bào D

D Cell B can dedifferentiate with particular hormone treatment

Tế bào B có thể phân hóa khi xử lý hocmon đặc hiệu.

Indicate if each the following statements is true or false

Vận chuyển trong mạch gỗ của thực vật chỉ có thể được hiểu bằng cơ chế sinh học Đường kính và chiều dài của mạch là nhân tố chủ yếu đưa đến hiệu quả hoạt động, theo công thức Hagen–Poiseuille sau:

(Chú thích trong công thức: volumetric flow rate = tốc độ dòng tính theo thể tích; viscosity : độ nhớt; Duong kinh ong = Đường kính ống)

Hãy chỉ câu đúng, câu sai

A The largest difference between vessels and tracheids is in the length, rather than diameter

Sự khác nhau lớn nhất giữa mạch gỗ và quản bào là ở chiều dài, hơn là đường kính

B Movement rate in vessels is approximately equal to that is stem tracheid

Tỷ lệ vận chuyển trong mạch gỗ là xấp xỉ bằng tỷ lệ vận chuyển nước trong quản bào thân

C Root tracheids can be wider than stem tracheids because they do not need as much reinforcement to hold

up the foliage and to resist bending of the axis

Quản bào rễ có thể rộng hơn quản bào thân do chúng không cần tăng cường độ cứng để giữ tán lá và chống bị bẻ cong

D The bigger the diameter of vessels, the smaller its frictional resistance

Mạch gỗ càng lớn, lực chống lại lực ma sát của mạch càng nhỏ

13 Two developmental mutants of Arabidopsis thaliana were used to investigate whether the control of cell

differentiation and the pattern of cell division were linked A balance between cell production and cell

differentiation can be achieved by controlling the rate of cell division in meristematic cells The TTG (transparent testa glabra) gene alters early events in root epidermal cell differentiation, while glabra2 (gl2)

acts later Developing root epidermal tissues contain two cell types, atrichoblast (A), which form mature hairless cells and trichoblast (T), which form root hairs Longitudinal periclinal division of the epidermis is necessary for maintenance of root radial structure The figures below show the comparison between differentiation and cell division of T cells versus A cells in root epidermis

Hai thể đột biến đã phát triển của cây Arabidopsis thaliana được sử dụng để

điều tra xem sự điều chỉnh phân hóa tế bào và kiểu phân chia tế bào có liên quan với nhau không Sự cân bằng giữa sinh sản tế bào và phân hóa tế bào

có thu được bằng cách điều chỉnh tỷ lệ phân chia ở các tế bào mô phân sinh

Gen TTG (transparent testa glabra) tác động lên các hoạt động phân hóa tế bào biểu bì rễ sớm, trong khi gen glabra2 (gl2) tác động muộn hơn Các mô

biểu bì rễ phát triển có 2 kiểu tế bào, tế bào Atrichoblast (A) hình thành nên các tế bào rễ không có lông và tế bào Trichoblast (T) hình thành nên tế bào lông ở rễ Sự phân chia theo chiều dọc của biểu bì là cần cho duy trì cấu trúc tỏa tròn của rễ Hình sau thể hiện sự so sánh giữa phân hóa và phân chia

tế bào của tế bào T khác với tế bào A ở biểu bì rễ

Axix Y1: Tỷ số các tế bào T/ các tế bào A;

Axis Y2: Tỷ số xác xuât của phân chia theo chiều dọc o T/A (pLT/pLA)

Axis Y1: Ty so cac Te bao T/ cac Te bao A

Axis Y2 : Ty so xac xuat cua phan chia theo chieu doc o T/ A (pLT/pLA)

Time (arbitrarily unit)

ttg

ttg gl2 mutant

Wild-type

Hãy chỉ câu đúng, câu sai

A TTG controls epidermal cell fate specification

Gen TTG điều khiển sự phát triển chuyên hóa tiếp theo của tế bào biểu bì.

B gl2 mutant retains the atrichoblast fate and the A cell remains as undifferentiated

epidermal cells

Thể đột biến gl2 giữ lại (retains) sự phát triển tiếp theo của Atrichoblast và

các tế bào A giữ cho (remains) các tế bào biểu bì không phân hóa

C The longitudinal division in root epidermis is more likely to occur in A cell than T cell

Phân chia theo chiều dọc ở biểu bì rễ dường như xuất hiện ở tế bào A hơn ở tế bào T

D Ratio of longitudinal cell division in T versus A is much reduced in the ttg mutant,

suggesting that it is under the control of TTG

Tỷ số giữa phân chia tế bào theo chiều dọc ở T/A là giảm nhiều ở thể đột biến, cho thấy rằng nó bị điều khiển bởi TTG

14 The following table shows the adaptation of Plant A and Plant B in response to different conditions

Indicate if each of the following statements is true or false

Bảng sau minh họa thích nghi của thực vật A và thực vật B phản ứng với các điều kiện khác nhau

Hãy chỉ ra câu đúng, câu sai

A Plant B is C3

Thực vật B là C3

B Plant A is more competitive in limited water availability and high temperature

environment

Thực vật A có khả năng cạnh tranh trong điều kiện môi trường

ít nước và nhiệt độ cao

C If atmospheric CO2 concentration doubles, Plant A is likely to be more competitive Nếu nồng độ CO2 tăng gấp đôi, dường như Thực vật A cạnh tranh mạnh hơn

D If atmospheric CO2 concentration doubles, photorespiration in Plant A is likely to be reduced

Nếu nồng độ CO2 tăng gấp đôi, dường như hô hấp sáng ở thực vật A giảm

15 This figure shows the role of phytochrome in a far red state (P fr ) in sun and shade plants Based on phytochrome-mediated photomorphogenesis, indicate if each of the following statements is true or false

Hình sau minh họa vai trò của phytochrome ở giai đoạn đỏ xa (Pfr) của thực vật ngoài sáng và trong bóng râm Dựa vào quang phát sinh hình thái phụ thuộc vào phytochrome, hãy chỉ ra câu đúng, câu sai

Axis Y1 : Log (stem elongation rate)

Axix Y1: Log (tỷ lệ chiều dài thân)

A Treatment with red light does not affect stem elongation rate in shade plants

Thí nghiệm chiếu tia đỏ vào cây trong bóng râm sẽ KHÔNG ảnh hưởng tới mức độ kéo dài của thân

B Treatment with far-red light decreases stem elongation rate in sun plants

Thí nghiệm chiếu tia đỏ xa (far-red light) vào cây ngoài sáng làm giảm mức

độ kéo dài của thân

C If sun plants are treated in the conditions of sun and shade, elongation rate of plant placed in the sun is higher than one in the shade

Thí nghiệm đặt cây ưa sáng trong điều kiện chiếu sáng và trong bóng tối, mức độ kéo dài của cây trong điều kiện chiếu sáng cao hơn trong bóng tối

D Natural forest clearings would give equal opportunity for sun and shade plants to recolonize

Chặt hết cây của rừng tự nhiên sẽ tạo điều kiện cho cây ưa sáng và cây ưa bóng định cư như nhau

16 An experiment was conducted to study the effect of darkness, red light (RL) and combination of red and blue

light (RL+BL) on stomatal aperture Mutant phot1 and phot2 do not express phototropin, while mutant npq

does not accumulate zeaxanthin Stomatal apertures less than 1.25 µm are considered closed, while apertures greater than 2.0 µm are considered opened more widely

Indicate if each of the following statements is true or false

Tiến hành thí nghiệm ảnh hưởng của mức độ tối, ánh sáng đỏ (RL) và kết hợp của ánh sáng đỏ và xanh (RL + BL) đến độ mở khí khổng Thế đột

biến phot1 và phot2 không biểu hiện protein phototropin, trong khi thể đột

biến npq tích tụ protein zeaxanthin.

Ghi chú trong hình: Trục tung= Độ mở khí khổng; Trục hoành = kiểu hoang dại; Toi = Tối)

Hãy chỉ câu đúng, câu sai

A Stomatal apertures are closed if treated in darkness and slightly opened in red light illumination

Khí khổng đóng nếu để cây trong bóng tối và khí khổng hé mở khi cây được chiếu ánh sáng đỏ

B Blue light significantly increases stomatal aperture size in all tested plants

Ánh sáng xanh làm tăng mạnh độ mở khí khổng ở tất cả các loại cây thí nghiệm.

C It is likely that the blue light receptor is active in mutant npq

Có vẻ như thụ thể ánh sáng xanh hoạt động ở thể đột biến npq.

D The fact that single phot mutants respond to blue light and double mutants do not, suggests that phot1 and phot2 act redundantly as blue light receptors to mediate

17 Nyctinasty is a sleep movement of leaves The diagram shows a model of the interaction of phytochrome, biological clock, and IP 3 on nyctinasty Arrow A stands for activation and Arrows B & C stand for active transport

Indicate if each of the following statements is true or false

Tính khép lá vào ban đên là tính ứng động ban đêm của lá Hình sau mô tả mô

hình tương tác của phytochrome, đồng hồ sinh học và IP3 đến tính khép lá Mũi

tên A chỉ sự kích hoạt, và mũi tên B và C chỉ chuyển vận hoạt động

(chú thích trong hình: Anh sang = Ánh sáng; Mang = Màng; Bao tuong = Bào

tương)

Hãy chỉ câu đúng, câu sai

A Light, mediated by phytochrome and modulated by endogenous clock, increases the level of IP3 and DAG (diacylglycerol)

Ánh sáng, bị ảnh hưởng bởi phytochrome và được điều chỉnh bởi đồng hồ nội sinh, làm tăng mức độ của IP3 và DAG (diacylglycerol)

B IP3 increases release of free calcium and thus stimulate proton extrusion

IP3 làm tăng mức giải thoát canxi tự do và do vậy kích thích giải phóng proton

C The changes in electrochemical gradient energizes the uptake of K+, subsequently reduces cell swelling, and thus causes nyctinastic movement

Những thay đổi thế điện hóa thúc đẩy hấp thụ K+, từ đó làm giảm mức độ trương của tế bào, và do vậy dẫn đến sự vận động khép lá

D An active transport (arrow C) extrudes Ca2+ as an aid to restoring Ca2+ homeostasis Vận chuyển tích cực (theo mũi tên C) làm giải thoát Ca2+ là

do có hoàn trả lại Ca2+ nội cân bằng

18 The effect of gibberellic acid (GA3) and abscisic acid (ABA) on isolated barley aleurons was measured using

-amylase activity and transcriptional responses Aleurons were treated with 1 μmol/L GA 3 and 50 μmol/L ABA for 15 hours The activity of α-amylase was measured using maltose as a standard (Figure A) The accumulation of mRNA encoding high pI amylase (Contig3952) and low pI amylase (Contig7087) is shown in Figure B

Indicate if each of the following statements is true or false

Ảnh hưởng của axit gibberellic (GA3) và axit abscisic (ABA) tới aloron cây lúa mạch phân lập được đo bằng phương pháp đo hoạt tính enzym

-amylase và đánh giá "đáp ứng phiên mã" qua thẩm tách bắc Aloron được xử lý với 1 μmol/L GA3 và 50 μmol/L ABA trong 15 giờ Hoạt tính

chuẩn (Hình A) Sự tích lũy mARN mã hóa pl amylase cao (Contig3952)

và pI amylase thấp (Contig7087) được biểu diễn ở Hình B

Axis Y1 : Hoạt tính (µmol maltose µg-1 protein h-1); Control: Đối chứng Hãy chỉ ra câu đúng, câu sai

A The activity of α-amylase is reduced more than 80% on GA3+ABA-treatment compare

to GA3 treatment only

Hoạt tính của α-amylase giảm nhiều hơn 80% trong phương thức xử lý kết hợp GA3+ABA so với phương thức chỉ xử lý GA3

B GA3 suppresses both high and low pI amylase gene expression

GA3 áp chế biểu hiện của cả hai gen mã pl amylase cao và pl amylase thấp

C ABA suppresses the effect of GA3

ABA áp chế ảnh hưởng của GA3

D The GA3 + ABA treatment synergistically induced expression of genes encoding a high

pI amylase

Phương thức cùng xử lý GA3 + ABA thúc đẩy biểu hiện của các gen mã pI amylase cao

ANIMAL ANATOMY AND PHYSIOLOGY

PHẢI PHẪU VÀ SINH LÍ ĐỘNG VẬT

19 A blood alcohol test measures the concentration of alcohol (ethanol) in body fluids Alcohol is quickly absorbed from the alimentary tract and distributes evenly within the extracellular and intracellular fluid of the human body In a 70 kg person, 6.8 g ethanol is eliminated per hour, 90% is metabolized by the liver and the rest is excreted through lungs and kidneys In most countries, the legal limit of blood alcohol level (BAL) for driving a motor vehicle is 0.08 gram alcohol in 100 mL of blood Average water content

in adult lean 70 kg man is about 65%

Indicate if each of the following statements is true or false

Một test kiểm tra rượu trong máu dùng để đo nồng độ rượu (ethanol) trong dịch

cơ thể Rượu được hấp thụ nhanh qua ống tiêu hóa và được đưa đến dịch ngoại bào và nội bào của cơ thể người Ở người nặng 70kg, 6.8 g ethanol được thải ra trong một giờ, 90% được gan chuyển hóa và phần còn lại được bài tiết ra ngoài qua phổi và thận Ở nhiều nước, giới hạn cho phép nồng độ cồn trong máu đối với người lái các phương tiện có động cơ là 0,08 gam rượu trong 100 mL máu Hàm lượng nước trung bình ở người trưởng thành nặng 70kg là khoảng 65%

Hãy chỉ ra mỗi khẳng định nào dưới đây là đúng hoặc sai

A A 70kg lean man drinks 0.5 L beer with an alcohol content of 5% (weight/volume) One hour later his BAL is greater than 0.08 gram alcohol per 100 mL blood

Một người đàn ông 70kg uống 0,5 lít bia có hàm lượng cồn 5% (khối lượng/thể tích) Một giờ sau, nồng độ rượu trong máu của anh ta lớn hơn 0.08 gam/100 mL máu

B His identical twin drinks 0.2 L of vodka with an alcohol content of 40% instead of beer, and an hour later, his BAL exceeding 0.08 gram alcohol per 100 mL blood

Người anh em sinh đôi cùng trứng với anh ta uống 0.2 lít rượu vodka có hàm lượng rượu 40% và sau một giờ nồng độ rượu trong máu của anh ta vượt quá 0.08 gam/100mL máu

C The time it takes for the 70 kg person to eliminate a BAL at 0.08 gram alcohol in 100

mL blood is more than 5 hours

Thời gian cần thiết để một người nặng 70kg loại bỏ 0,08 gam rượu trong 100 mL là hơn 5 giờ

D A 70 kg breast-feeding woman drinks 0.15 L of wine with an alcohol content of 12%(weight/volume) She then feeds her 5.0 kg baby 100 mL breast milk 55% of the weight of a baby with normal body weight is water The BAL of the baby will exceed 0.08 gram ethanol per 100 mL blood

Một người phụ nữ đang cho con bú cân nặng 70 kg uống 0,15L rượu có hàm lượng rượu là 12% (Khối lượng/ thể tích) Khi đó

cô ta cho đứa con nặng 5.0 kg bú 100 mL sữa 55% khối lượng

cơ thể của đứa trẻ là nước Hàm lượng rượu trong máu của đứa trẻ sẽ vượt quá 0.08 gam rượu/100 mL máu

20 Barbuourula kalimantanensis, an indigenous flat frog was found in Kalimantan, Indonesia in 2008 (A)

The morphology of the frog ( B , C ) is shown below

Comparison of (A) Typical frog mouth and pharynx (Rana catesbeiana), showing glottis (circled), tongue, and esophageal opening, and (B) Barbourula kalimantanensis showing tongue, lack of glottis (circled), and an enlarged esophageal opening leading directly to the stomach

Figure 20.2 Comparison of (A) Typical frog mouth and pharynx (Rana catesbeiana), showing glottis (circled), tongue, and esophageal opening, and (B) B kalimantanensis showing tongue, no glottis

(circled), and an enlarged esophageal opening leading directly to the stomach

Indicate if each of the following statements is true or false

Barbuourula kalimantanensis, một loài ếch địa phương được tìm thấy ở

Kalimantan, Indonesia năm 2008 (A) Hình thái của loài ếch (B,C) được thể hiện dưới đây

So sánh miệng và hầu của loài ếch điển hình (A) (Rana catesbeiana), cho thấy thanh quản (được khoanh tròn), lưỡi và lỗ mở thực quản và loài (B) Barbourula

kalimantanensis cho thấy lưỡi, không có thanh quản (được khoanh tròn), một lỗ

mở thực quản lớn dẫn đến dạ dày

X = lưỡi

Hãy cho biết câu đúng, câu sai

A The frog is more likely to have stereoscopic vission as compared to ponds frog (Rana sp) Dường như loài ếch này có thể nhìn hình nổi tốt hơn so với ếch đồng (Rana sp)

B Skin of this exceptionally flat frog is the only respiratory organ in and gas exchange

occurs in the blood vessels located on the skin surface

Da của loài ếch cá biệt này là cơ quan hô hấp duy nhất trao đổi khí, quá trình trao đổi khí xảy ra giữa các mạch máu có trên bề mặt da

C Barbourula kalimantanensis is expected to have a low metabolic rateTrue

Ếch Barbourula kalimantanensis được trông đợi có tốc độ

chuyển thấp

D Barbourula kalimantanensis most probably lives in fast flowing cold water, often close

to waterfalls

Ếch Barbourula kalimantanensis, hầu hết có thể sống ở nơi có

dòng nước lạnh chảy nhanh, thường gần với thác nước

21 The diagram shows pulse rate, stroke volume and cardiac output in a healthy IBO student

Indicate if each of the following statements is true or false

A The stroke volume and the pulse rate are equal at a cardiac output of 25 dm3/min

B The most reliable estimate of the general fitness is obtained by measuring a work pulse within the interval of 120 – 150 min-1

C At high work intensity, an increase in cardiac stroke volume accounts for the increase in cardiac output

D At high work intensity, inadequate filling of the heart during diastole limits the cardiac output

22 The process of urine formation takes place in the nephron

Indicate if each of the following statements is true or false

Quá trình hình thành nước tiểu được thực hiện ở nephron

Hãy chỉ ra mỗi câu khẳng dịnh dưới đây là đúng hoặc sai

A Transport from 5 to 6 in the figure, is dependent on blood pressure

Vận chuyển từ 5 đến 6 ở trên hình là phụ thuộc vào huyết áp

B The most important process in the structure labelled 7 in the figure is ATP-dependent Quá trình quan trọng nhất trong cấu trúc 7 trên hình là phụ thuộc ATP

C The concentration of HCO3- is higher in structure 2 than in 4

Nồng độ của HCO3- là cao hơn ở cấu trúc 2 so với 4

D The water reabsorption in the structure labeled 8 is driven by a concentration gradient Tái hấp thu nước trong cấu trúc 8 được thực hiện nhờ sự chênh lệch nồng độ

23 Growth hormone (GH) is important for humans that raises the concentration of glucose and free fatty acid and promotes postnatal growth through direct and indirect effects on many tissues

Hoocmon sinh trưởng (GH) là quan trong đối với người, làm tăng nồng độ glucose và axit béo tự do và thúc đẩy sinh trưởng sau sinh qua tác động trực tiếp và gián tiếp lên nhiều mô

Hãy chỉ ra câu đúng, câu sai

A Hyperglycaemia can stimulate the release of GH secretion

Bệnh đường huyết cao có thể kích thích giải phóng GH

B Exercising will increase GH production which in turn increases lipolysis

Bệnh đường huyết cao có thể kích thích giải phóng GH

C The effects of GH are attenuated by circulating androgen (eg testosterone) at puberty Các hiệu quả của GH bị giảm đi bởi androgen (ví dụ: testosterone) tuần hoàn trong máu vào tuổi dậy thì

D Administration of GH will stimulate bone mass and muscle growth enhancement

Đưa GH vào cơ thể sẽ kích thích tăng khối lượng khối xương và thúc đẩy tăng trưởng cơ

24 IBO 2014 participants are from different continents around the world Some students experience ‘jet lag’ due to crossing many time zones to reach Bali These individuals feel fatigue as the body’s ‘clock’ need to be adjusted to the new environment Circadian rhythms are regulated by the pineal gland which produces melatonin during the dark Indicate if each of the following statements is true or false

Những thí sinh tham dự IBO 2014 đến từ nhiều châu lục Một số thí sinh trải qua hiện tượng mệt mỏi sau chuyến bay (‘jet lag’) do phải

đi qua nhiều múi giờ để đến Bali Những thí sinh này cảm thấy mệt mỏi khi đồng hồ sinh học (body’s ‘clock’) cần được điều chỉnh ở môi trường sống mới Nhịp ngày đêm được điều chỉnh bởi tuyến tùng, tuyến này sản sinh hoocmôn melatonin trong tối

Hãy chỉ ra câu đúng, câu sai

A Generally, for the same distance, flight from west to east (for example, from Europe to Bali) causes worse jet lag than flying in the opposite direction

Nhìn chung, đối với cùng một khoảng cách, bay từ Tây sang Đông (ví dụ, từ Châu Âu đến Bali) gây ra hiện tượng ‘jet lag’ tồi tệ hơn so với bay theo hướng ngược lại (từ Đông sang Tây)

D Melatonin pills, as possible treatment to avoid jet lag and readjustment with the local light-dark cycle should be taken about half an hour before the sleep

Thuốc viên Melatonin có thể điều trị để tránh hiện tượng ‘jet lag’ và tái điều chỉnh chu kì sáng tối theo địa phương, phải được uống khoảng nửa tiếng trước khi ngủ

25 Tetrodotoxin(TTX), a very powerful toxin,produced by the local puffer fish

(Ferodoxonmultistriatus), selectively blocksvoltage gated Na+ channels in the neuron

eventually dies from respiratory paralysis

Indicate if each of the following statements is true or false

Tetrodotoxin (TTX), một chất cực độc, do cá puffer

(Ferodoxonmultistriatus) sinh ra, là chất phong tỏa kênh Na+ ở nơ ron Kết

quả là TTX gây liệt cơ và mất sự điều hòa của dây đối giao cảm đối với tim Nạn nhân thậm chí có thể chết do liệt thở

Hãy chỉ ra mỗi khẳng định nào dưới đây là đúng hoặc sai

A The pufferfish never gets poisoned by TTX A possible explanation is that it has a mutated sodium ion channel to the resistant variant

Cá puffer không bao giờ bị độc bởi Tetrodotoxin Một giải thích

có thể là do có kênh ion Na+ bị đột biến giúp cá kháng độc

A TTX binds to Na+ ion gated channel in smooth muscle cells in the lungs and keep

membrane potential of the smooth muscle cells in the resting state condition

Tetrodotoxin gắn với kênh Na+ trên tế bào cơ trơn ở phổi và duy trì điện thế màng của các tế bào cơ này ở trạng thái nghỉ ngơi

B TTX is absorbed in gastrointestinal tract and therefore travel first to the lungs via hepatic vein and interfere with its function

Tetrodotoxin được hấp thụ ở ống tiêu hóa và bởi vậy trước tiên nó đi qua tĩnh mạch gan đến phổi và thể hiện tác động của nó

C If injected, TTX poison will result in very elevated heart rate

Nếu được tiêm, độc tố tetrodotoxin sẽ làm tăng rất nhanh nhịp tim