... including a contingency/reserve margin to meet balancing and regulating needs Each Balancing Area can maintain reliability even with the loss of more than the single largest generating unit in the ... disturbance Today, the government and industry must recommit themselves to supporting one another to enhance the protection, resiliency, and response capabilities for the North American bulk power ... infrastructure sectors—including the defense industrial base and U.S government Another reason is the difficulty in detecting malware that is designed to be concealed When scanned, they have the...
Ngày tải lên: 30/03/2014, 09:20
... hướng d n trẻ t n hiệu đ n giao th ng th n lại không th c hi n, điều làm cho trẻ không tu n th theo đ n giao th ng cha mẹ dạy Do vậy, bậc cha mẹ mu n trẻ nghe lời c n phải tu n th th c nghiêm ... trước nh n sau xem có xe hay người qua không Hướng d n trẻ sinh động, th c tế Để trẻ dễ tiếp thu học, ba mẹ mua mô hình có li n quan đ n giao th ng để hướng d n trẻ. Ngoài việc hướng d n trẻ th ng ... giao th ng, nguy hiểm cho tính mạng Qua đường c n th n, chậm rãi, tu n th đ n t n hiệu giao th ng N u trẻ nhỏ, qua đường c n có người l n đưa qua Với trẻ độ tuổi vào cấp tự học nhà g n trường,...
Ngày tải lên: 04/12/2015, 10:07
Kinh tÕ n«ng th«n trong thêi kú qu¸ ®é ®i lªn chñ nghÜa x• héi ë ViÖt Nam
... bi n, tìm th tr ờng tiêu th n ng s n Vì n c thang ti n đờng phát tri n kinh tế hàng hoá n ng th n x hội hoá kinh tế n ng th n 3.3 Ng n ch n sung đột lợi ích n i n ng th n, n ng th n th nh th ... n ng th n góp ph n định th ng lợi CNXH n ng th n nói riêng đất n c n i chung Phát tri n kinh tế n ng th n g n li n với phát tri n v n hoá, trị, x hội ki n trúc th ng tầng theo định hớng x hội ... dụng Kinh tế tập th trở l n đa dạng Kinh tế tập th đ ờng tất yếu để n ng d n c d n nông th n l n s n xuất l n x hội chủ nghĩa với kinh tế nhà n c n ng th n hợp th nh tảng kinh tế n ng th n...
Ngày tải lên: 20/03/2013, 08:33
Luận văn: Tổ chức công tác kế toán tập hợp chi phí sản xuất và tính giá thành sản phẩm tại Công ty TNHH xây dựng Quang Huy
... Th. S Nguyn Th Hc vin ti chớnh Lun tt nghip LI N I U X y dng c bn l ngnh sn xut to c s v tin phỏt trin cho nn kinh t quc d n Hng nm, ngnh x y dng c bn thu hỳt gn 30% tng s u t ca c nc Vi ngun ... vo bng tớnh giỏ thnh cho tng n t hng tng ng Trng hp n t hng gm nhiu hng mc cụng trỡnh sau tớnh giỏ thnh cho n t hng hon thnh, k to n tớnh giỏ thnh cho tng hng mc cụng trỡnh theo cụng thc sau: ... lu n chuyn theo ỳng ch quy nh H thng s k to n tng hp c s dng theo hỡnh thc k to n Nht ký chung vi k to n th cụng v Cụng ty cng s dng mỏy vi tớnh tớnh to n, lp v in bng biu k to n gúp phn lm...
Ngày tải lên: 06/01/2016, 18:07
iec 60076-4 power transformers - guide to the lightning impulse and switching impulse testing
... International Standards transparently to the maximum extent possible in their national and regional standards Any divergence between the IEC Standard and the corresponding national or regional standard ... dependent on the inherent impedances of the test object A brief explanation of the principles of waveshape control is given in annex A The arrangement of the test plant, test object and the interconnecting ... or, in addition, of the non-tested terminals of windings under test Impedance earthing, rather than direct earthing, of the non-tested winding terminals results in a significant increase in the...
Ngày tải lên: 25/12/2013, 10:35
Tài liệu More power to the bottom line pptx
... Enhanced data and telephony elements tend to rely on DC power There is no hard-and-fast rule–operators often go with the method that they are most comfortable with or the one that delivers the ... network element in the rack This method wastes precious BDFB positions Each run from the BDFB creates another expense for operators Running one cable from the BDFB to a power distribution panel ... and increased revenue Heading to DC DC power begins the same way AC does, as an alternating current from a generator It is then converted to DC at the headend through the use of rectifiers Eventually...
Ngày tải lên: 17/01/2014, 11:20
Những yếu tố ảnh hưởng đến chất lượng dân số dân tộc pà thẻn, huyện quang bình, tỉnh hà giang
... V n hóa tinh th ̀ n Đồng bào d n tộc Pà Th n có truy n th ng v n hóa , v n nghê ̣ mang nhiề u nét ba n sắ c riêng Trong phong trào toa n d n đoa n kết x y dựng đời sống v n hóa , đồ ng ... nghi n cứu - Địa ba n nghi n cứu: x T n Bắc, huy n Quang Bình, tỉnh Hà Giang - Th i gian nghi n cứu: từ th ng 11 n m 2011 đ n th ng n m 2012 Câu hỏi nghi n cƣu: ́ - Th c trạng chất lượng ... vâ n dụng lý thuyết x hội học để giải th ch yếu tố ảnh hưởng đ n chất lượng d n số d n tộc Pà Th n, huy n Quang Bình, tỉnh Hà Giang H n nữa , vâ n dụng ki n th c x hội học để nghi n cứu “Nhữ...
Ngày tải lên: 24/01/2014, 23:22
Tài liệu Báo cáo khoa học: Stefin A displaces the occluding loop of cathepsin B only by as much as required to bind to the active site cleft doc
... (Fig 2) These additional features hinder binding along the whole interdomain interface, although they both are displaced upon binding of the ligand The N- terminal trunk and the first binding loop ... in the S72–D79 region that forms the second binding loop Cathepsin B structure exhibits a two-domain, papain-like fold [11] The N- terminal domain includes the central helix that contains, on ... relevance of the occluding loop for the exopeptidase activity [11], they not explain the mechanisms of endopeptidase activity, nor the inhibition of the enzyme by their endogenous protein inhibitors...
Ngày tải lên: 18/02/2014, 04:20
Tài liệu Báo cáo khoa học: Top-down MS, a powerful complement to the high capabilities of proteolysis proteomics pdf
... for the specific PTM In the biosynthesis of NAD, the enzyme 3-hydroxyanthranilate-3,4-dioxygenase (HAD) catalyzes the oxidative ring opening of 3-hydroxyanthranilate, which, with cyclization, forms ... accepted for the routine identification of proteins in complex mixtures Usually, the identification of the gene that encodes the protein is more important than full structural characterization of the protein ... the protein Its quantitative analysis by the bottom-up method under normal and abnormal conditions can then provide a direct indication of the upregulation or downregulation of the gene If, however,...
Ngày tải lên: 18/02/2014, 16:20
Tài liệu Báo cáo khoa học: NMR structure of AII in solution compared with the X-ray structure of AII bound to the mAb Fab131 pptx
... investigated, on the grounds that this parameter is involved in their binding to the receptor As a corollary of this argument, it has often been assumed that the conformation of the hormone in ... AII in the solution state (representing the free ligand conformation) were compared with the conformation of the hormone complexed to the high-affinity mAb Fab131 (representing the receptor-bound ... than 0.25 A were selected after the final refinement in explicit water The conformation of the hormone does not change significantly in the final stages of refinement and is mainly determined by the...
Ngày tải lên: 20/02/2014, 23:20
Báo cáo khoa học: The N-terminal region of the bacterial DNA polymerase PolC features a pair of domains, both distantly related to domain V of the DNA polymerase III s subunit ppt
... role in binding the incoming template in both PolC and DnaE The ability to bind single-stranded DNA has indeed been demonstrated for the E coli DnaE OB domain [12,16] The very N- terminal region of ... compared to the corresponding DnaE-s interaction in E coli [30] The s-binding determinants in E coli DnaE have been mapped to the very C-terminus after the OB domain A single point mutation in this ... Venclovas binding [27] suggests similar functions for these domains Taking into account the biological context, an obvious hypothesis is that either one or both domains mediate the interaction...
Ngày tải lên: 05/03/2014, 23:20
Báo cáo khoa học: ` Inhibition of human ether a go-go potassium channels by 2+ Ca ⁄calmodulin binding to the cytosolic N- and C-termini potx
... channels in the absence of the N- terminal domain Mutations in the N- and C-terminal CaM binding sites also affected the gating parameters of the channels, but to a much smaller extent than the ... of the lack of structural information on the cytosolic channel domains in complex with CaM Initiated by the finding that hEAG1 channels lacking the entire N- terminal cytosolic domain are insensitive ... deletion of the N- terminus Remarkably, mutations in the N- terminus (hEAG_F15 1N L15 4N) markedly slowed down channel activation further supporting the Calmodulin binding to hEAG1 channels notion that...
Ngày tải lên: 07/03/2014, 12:20
X-rated - the power of mythic symbolism in popular culture
... regularly are nothing more than pop religions.36 Americans now seem to change their faith to suit their fancy They shop for it, rather than remain in the one they were born into Religion is, Twitchell ... opposition we feel unconsciously between the human and the divine, between vice and virtue Let me quote none other than the Marquis de Sade on the presence of these two internal voices within the ... back to the middle part of the nineteenth century, when the Industrial Revolution gave common people the financial means to seek pleasure in the arts and to engage creatively in them From the...
Ngày tải lên: 14/03/2014, 21:47
Convert's guide to the Mac and OS X
... using the Migration Assistant If you are not asked this (or your Mac was set up in store, and the machine boots straight into the desktop) then you can find the option again in the Utilities menu ... screenshot below You can change this behaviour using the two-finger click menu The context menu at the top of the screen will change depending on the application you are using, but it functions ... into the dock You can also reorder icons by dragging and clicking The dock can be placed on the left, bottom and right side of the screen – this can be set from the Apple menu at the top of the...
Ngày tải lên: 19/03/2014, 13:36
Báo cáo khoa học: Change in structure of the N-terminal region of transthyretin produces change in affinity of transthyretin to T4 and T3 pdf
... determine the influence of the N- terminal region of TTR on the binding to thyroid hormones, the construction of chimeric recombinant TTRs containing variations in structure of the N- terminal region is ... ACGGAATTCTTATTCTTGTGGATCACTG Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense the cDNA Primers to generate the compatible restriction ends for ligation into the pPIC3.5 (using the TTR native ... only synthesized in the liver during development in the egg and in hatchlings and only in the choroid plexus of the adult Thus, it is difficult to obtain the native crocTTR in sufficient amounts...
Ngày tải lên: 23/03/2014, 10:21
Báo cáo khoa học: Factor VIIIa regulates substrate delivery to the intrinsic factor X-activating complex docx
... and the fX binding in the presence of fIXa) In contrast, in the presence of factors with a higher affinity, the binding curves changed their form and did not follow the one-site binding equation ... correlation between the rate of fXa formation and the fX binding to fVIIIa that suggested a regulatory role of the fVIIIa–fX complex in the activation of fX This conclusion was confirmed by the finding that ... required to obtain the fX density on the membrane, at which half of membrane-bound fX is involved in the reaction; therefore, intrinsic KM is expected to increase with the decrease in PtdSer content...
Ngày tải lên: 23/03/2014, 11:20
WHAT IS BETA GLUCAN? A Concise Guide to the Benefits and Uses of the Most Powerful Natural Im- mune Enhancer Known to Science ppt
... been a toxic, over-touted failure from the beginning The strongest immunity enhancer on earth has been known about for over thirty years now Nothing rivals beta glucan for immune enhancement No ... granted WO98 40,082 in 1998 for their therapeutic glucan cream They claimed, “These substances strengthen the immune system of the skin, counteract wrinkling and can be used to prevent scaling ... to radioactive dye and the course of action was following after oral administration to mice The macrophages took up the glucans, and then transported them to the spleen, lymph glands, and bone...
Ngày tải lên: 31/03/2014, 22:20
solutions for an introduction to the finite element method (3rd edition), by j. n. reddy
... identify the operator A of the problem to be A = −d2 /dx2 so that it does not include the unknown, λ (not consistent with the definition of the method) Then 0= Z = = A(φi )R dx = n X ½Z j=1 " Ã n ... of the lines representing the sides of the triangle for the approximation function Answer: c1 = − Solution: For the coordinate system shown in the figure, the equations of the boundary segments ... at the two nodes The linear combination (6) of functions that interpolate both the function and its derivative(s) are known as the Hermite interpolation functions, and φj (x) are known as the...
Ngày tải lên: 08/04/2014, 10:38
wrox press mac os x and ios internals, to the apple's core (2013)
... v1.4.1 to 5.1, and since then has followed the OS X numbers consistently by being four numbers ahead of the minor version, and aligning its own minor with the sub-version XNU was version 201 10.2 ... possible to circumvent the OS X installer protections and install the system on non-Apple hardware The hackers (in the good sense of the word) emulate the EFI environment (which is the default on Mac ... references are to the XNU kernel source xxxii flast.indd xxxii 9/29/2012 5:55:36 PM INTRODUCTION XNU and Darwin components are fairly well documented, but this book tries to go the extra step, and...
Ngày tải lên: 24/04/2014, 09:56