will going to exercises 2 eso pdf

future- will ỏ going to

future- will ỏ going to

... Will or Going to? 1. “There’s a problem at the door”. “I (GO) and open it” 2. “Why are you carrying that spade?” “I (PLANT) some flowers” 3. ... a mule. He (NOT RESIGN) 11. “Can you take me to the station, Jim?” “Of course I (TAKE) you Jane. It will be a pleasure” 12. “Shall I take you to the station, Jane?” “Thanks Pete. Jim (TAKE) ... (GET) some from the bank 20 .“I can’t understand this letter” “I (CALL) my son. He (TRANSLATE) it” 21 . You’ve bought a lot of paint. you (REDECORATE) your kitchen? 22 .“Why are you getting out...

Ngày tải lên: 18/08/2013, 04:10

2 1,8K 140
Will hay going to?

Will hay going to?

... - Ann will probably arrive at about 8 o’clock (Ann có thể sẽ đến lúc 8 giờ) - I think Tom will like the present you bought for him (Tôi nghĩ Tom sẽ thích món quà mà anh...

Ngày tải lên: 20/09/2013, 02:10

2 522 7
FOCUS ON - phrasal verbs and will or  be going to

FOCUS ON - phrasal verbs and will or be going to

... and will or be going to Both will and be going to are used to talk about the future in English, but they are not the same. Predictions: will or be going to Use will or be going to for ... Nancy is going to try to call her sister in Nepal tonight. What is Nancy going to try to do tonight? 11. Hank isn't reliable. You can't be certain he will do what he says he will do. ... something that you do not have to do, you are willing to do it: / will put up the shelves for you. Plans: be going to Use only be going to for plans. When you decide to do something in the future,...

Ngày tải lên: 01/11/2013, 12:20

26 1K 2
Will, be going to, past tenses

Will, be going to, past tenses

... khứ. Before + 1990… Before, after, by the time, when… 2. Will and “be going to * be going to diễn tả một dự định, một kế hoạch hoặc một sự tiên đoán * Will + V bare-infinitive diễn tả một ý nghĩ, ... Put the verbs into the correct form - past perfect or past simple. 1. The storm (destroy) …………………. the sandcastle that we (build) ………………………… 2. He (not be) ……………………………. to Cape Town before 1997. ... REVIEW OF PAST TENSES, WILL/ BE GOING TO 1. The past tenses. TENSES FORM EXAMPLES USE SIGNAL WORDS 1. The simple past (+) S...

Ngày tải lên: 08/11/2013, 12:11

2 710 12
Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf

Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf

... tumor necrosis factor-mediated cytolysis by overexpression of plasminogen activator inhibitor type -2. J Biol Chem 26 6, 20 960 20 964. 12 Lian X & Yang T (20 04) Plasminogen activator inhibi- tor 2: expression ... Forward (nt 15 52 1585 PAI -2) SJS260 AACTCACCAT AGGAATGCATAATAAATAACAAAG Reverse (nt 1585–15 52 PAI -2) SJS261 CTTTGTTA AAGCTTATGCATTCCTATGGTGAGTT Forward (nt 15 52 1585 PAI -2) SJS2 62 AACTCACCAT AGGAATGCATAAGCTTTAACAAAG ... the plasminogen activating system. J Biol Chem 26 7, 122 20– 122 26. 19 Pytel BA, Peppel K & Baglioni C (1990) Plasminogen activator inhibitor type -2 is a major protein induced in human fibroblasts...

Ngày tải lên: 16/02/2014, 09:20

14 636 0
ON THE ALGEBRAIC DIFFERENCE EQUATIONS un+2 un = ψ(un+1 ) IN R+ , RELATED TO A FAMILY ∗ OF pdf

ON THE ALGEBRAIC DIFFERENCE EQUATIONS un+2 un = ψ(un+1 ) IN R+ , RELATED TO A FAMILY ∗ OF pdf

... particular (u 3 ,u 2 ) =(u −1 ,u 2 ). If we put X = u 2 1 and Y =u 2 0 , this equality is equivalent to  1 −c 2  (1 +cX) 2 −Y 2 (c + X) 2  = 0,  1 −c 2  (1 +cY) 2 −X 2 (c + Y ) 2  = 0. (7.10) If ... following factor  dλ 2 −cλ+ b  xy(x + y)+λc  x 3 + y 3  +(c + dλ)(x + y) 2 +(d + λ)(x + y) +  2 2 −2dλ−2c −K  xy+1 (6.10) (the coefficient of x 2 y 2 is λ 4 −2dλ 3 +(2c −K)λ 2 −2bλ + 1 which ... Bastien and M. Rogalski 24 9 some K>K m ,thene 2 = 2/ (λ − f 2 ) < 0ifb + d>0(Lemma 6.1). In the three cases, e 2 = 2/ (λ − f 2 +2p) < 0, so we have 2 e 2 = λ − f 2 +2p<0 (if b+ d>0),...

Ngày tải lên: 23/06/2014, 00:20

35 281 0
Tràn dịch màng phổi thanh tơ (Kỳ 2) pdf

Tràn dịch màng phổi thanh tơ (Kỳ 2) pdf

... phổi do nhiễm khuẩn: Hút tháo dịch kết hợp điều trị kháng sinh to n thân. Tràn dịch màng phổi thanh (Kỳ 2) 3 .2. Tràn dịch do ung thư: - Lâm sàng: thường gặp ở lứa tuổi ³ 50. ... dịch. Sốt hoặc không sốt. To n thân suy sụp: hạch thượng đòn, ngón tay dùi trống, hội chứng cận u, hội trứng trung thất. Tiến triển nặng dần. - Cận lâm sàng: Phản ứng Mantoux ( - ) tính , tốc ... phổi có thể hấp thu. 4. Điều trị: 4.1. Tràn dịch màng phổi do lao. -Dùng phác đồ: 2RHZS(E) / 6HE; hoặc 2RHZS( E ) / 4RH. - Hút tháo dịch sớm, mỗi lần hút không quá 600ml, làm nhanh hết dịch...

Ngày tải lên: 02/07/2014, 08:20

5 522 0
it was not until...; will and be going to

it was not until...; will and be going to

... Phuong is going to Australia. The idea of going on this trip excites her. a. Phuong is (excite) …………… about going on this trip. b. She thinks it is going to be an (excite) ………………. trip. 12/ The ... before he went to HCM city. 18/ She didn’t begin to learn English until 1980 19/ We didn’t study English until we began primary school. 20 / I didn’t learn English until 20 02 II/ Complete ... He didn’t stop working until he felt too tired. 14/ The police didn’t make any accusations until they had some proof. 15/ The little girl didn’t open the gifts until the last visitor left. ...

Ngày tải lên: 07/07/2014, 01:00

2 1,5K 49
BE GOING TO & WILL

BE GOING TO & WILL

Ngày tải lên: 13/07/2014, 18:00

2 1,1K 32

Bạn có muốn tìm thêm với từ khóa:

w