... Trang 1Koreen PaganoDirector, Product Management , lynda.com at LinkedIn Author of Immersive Learning Trang 2Return on Investment $ Training $$$ Trang 3BIG data Trang 4Return on InvestmentWhat ... want in return? More money Less cost Trang 5What’s a PNL? Trang 6 Revenue Profitability Trang 7Metrics that DON’T matter. Trang 8Time in training.Courses completed Passing scores Number of attempts ... attempts Trang 9What do you value?Fast. Cheap. Good. Trang 1480% common business success metrics. 20% snowflake metrics. Trang 15Employees. Customers. Trang 16Cheap. Good. Trang 19For each person
Ngày tải lên: 30/11/2015, 00:57
... ¢- GTGGAGGA G AGCTATGGGCAGCAG - 3 ¢ Asp893fiAla 5 ¢- GTGGAGG C CAGCTATGGGCAGCAG - 3 ¢ Ser894fiAsp 5 ¢- GTGGAGGAC GA CTATGGGCAGCAG - 3 ¢ Ser894fiIle 5 ¢- GTGGAGGACA T CTATGGGCAGCAG - 3 Gly896fiArg 5 ... GTGGAGGACAGCTAT A GGCAGCAG - 3 ¢ Gly896fiIle 5 ¢- GTGGAGGACAGCTAT ATC CAGCAG - 3 ¢ Second primer for all of the above 5 ¢- GTC A TT A ATCCAACGGTCATCCCA - 3 ¢ a Primers used for mutations by PCR and ... proper-ties, although in somewhat different ways In general, however, we can distinguish between catalytically inactive and catalytically active mutants Catalytically inactive mutants All mutants of Asp893
Ngày tải lên: 23/03/2014, 13:20
what is a just peace mar 2006
... same condition on any acquirer British Library Cataloguing in Publication Data Data available Library of Congress Cataloging in Publication Data Data available Typeset by SPI Publisher Services, ... peace between their peoples Said passionately pleaded forjustice and, ultimately, for a single state in the Middle East for Palestiniansand Israelis alike Beilin made a strong plea for a search ... universe, theLeviathan alone deWnes what is just and it is therefore an arbitrary decision No such global Leviathan exists today Therefore, in a world where state and Trang 28non-state actors abound (from
Ngày tải lên: 10/06/2014, 22:35
báo cáo hóa học:" SimReg1 is a master switch for biosynthesis and export of simocyclinone D8 and its precursors" docx
... TAGAATTCCGCGGTTCGGCAGA simX5D3R TAGAATTCGCGACAGGAGCCATA simEXX4R TAGAATTCTCAGAACATCGTCC SR2ExXR TTTGAATTCTTGACCACCACTTC simA7R ATAAGCTTGTCGATACCGATCTTC D4For TATTGGTCGCGCAGTCGTCC DNA-shift assay part of the simD4 ... simD4_for_script AAATCTAGAGGCGACCGACCCCG GCCGAG simD4 promoter cloning P D4 simD4_rev_script AAAGGTACCCGATCCGGCTGGCA TTACTG simReg1_for AAAAAGCTTTACCTGTATCCAGGGC GGGCACTT simReg1_ rev AAAGGATCCGCACAAAGCGGCAGC ... in a reac-tion mixture) were tested as SimReg1 ligands Table 2 Primers used in this study SSR1R TTTGAATTCATTAATGGTGATGGT purification SR1D4R TAGAATTCCATTGTGAACCATC SD2R1R TAGAATTCCGCGGTTCGGCAGA
Ngày tải lên: 21/06/2014, 17:20
English Language Proficiency Tests-Advanced Level''''sarchiveReal Life: What is a SOHO (1) potx
... working as a SOHO For example, people could easily get sidetracked and not get any work done W: Really? I think I can motivate myself and I could spend more time with my family advantage drawback ... devices sustaining Trang 8pertaining procrastinating 9.W: I'm actually quite self- I always get my work done whether a manager is looking over my shoulder or not apathetic disciplined less Trang 910.W: ... detail-oriented M: Not me That kind of system requires a lot of time and energy to run and maintain disorganized programmed organized 6.W: I would also like to save money on gas and not have
Ngày tải lên: 25/07/2014, 12:20
Báo cáo y học: "SHROOM3 is a novel candidate for heterotaxy identified by whole exome sequencing" pptx
... SL and TS evaluated and interpreted SNP microarray and aCGH data All authors read and approved the final manuscript for publication Acknowledgments We thank the heterotaxy patients and families ... quality at each aligned base position which serves as the basis for variant calling Variants are reported based on a configurable formula using the following additional parameters: depth of coverage, ... become an important modality for the identification of novel disease causing heterotaxy genes, candidate genes, and disease associated rare variants important for disease susceptibility Trang 13Conclusions
Ngày tải lên: 09/08/2014, 23:20
Báo cáo y học: " FISH Oracle: a web server for flexible visualization of DNA copy number data in a genomic contex" ppsx
... available web servers Additionally CAPweb and arrayCGHbase can be obtained for local installation by requesting it from the maintainers FISH Oracle is avail-able as a web server and additionally ... source data In particular, two different kinds of data are stored in two separate databases: genome annotation data (as available in the Ensembl database [37]) and seg-mented array CGH data The ... platform for dynamic web appli-cation development (Java) Figure S1 in the additional file 1 shows the data flow in FISH Oracle Availability FISH Oracle is available as a source code package via
Ngày tải lên: 10/08/2014, 09:22
Báo cáo y học: "Matrin 3 is a co-factor for HIV-1 Rev in regulating post-transcriptional viral gene expressio" pptx
... laboratory for Trang 9reading and commenting on the manuscript, and Barbara Felber for sharingseveral critical reagents We are grateful to Anna Kula and Alessandro Marcello for sharing data in ... Yoshida M, Mattaj IW: CRM1 is an export receptor for leucine-rich nuclear export signals Cell 1997, 90:1051-1060 37 Fukuda M, Asano S, Nakamura T, Adachi M, Yoshida M, Yanagida M, Nishida E: CRM1 is ... Trang 1R E S E A R C H Open AccessMatrin 3 is a co-factor for HIV-1 Rev in regulating post-transcriptional viral gene expression Venkat SRK Yedavalli and Kuan-Teh Jeang* Abstract Post-transcriptional
Ngày tải lên: 13/08/2014, 01:21
what is a solid
... Trang 1by Jennifer BoothroydTrang 2a Lerner Publications Company · Minneapolisby Jennifer Boothroyd What Is a Trang 3All things are made of matter.Trang 4Matter is anything that takes up space.Trang ... its size.Trang 14But it is still a solid.Trang 15Heating a solid can change its shape.Trang 16Heat can change a solid intoa liquid. Trang 17Heat can melt wax.Trang 18Look around What solids doyou ... Solids can be hard.Trang 10A toy is a solid Solids can besoft. Trang 11A tree is a solid Solids can be thick.Trang 12A ribbon is a solid Solids canbe thin. Trang 13Cutting a solid changes its
Ngày tải lên: 14/11/2014, 09:04
what is a liquid
... Trang 10Water is a liquid It flows.Trang 11Paint is a liquid It drips.Trang 12Juice is a liquid You can pour it.Trang 13Heating a liquid can change it.Trang 14Heating can change a liquidinto a ... anything that takesup space. Trang 6There are three kinds of matter.Trang 7A liquid is a kind of matter.Trang 8A liquid does not have its own shape.Trang 9A liquid takes the shape ofits container. ... Trang 1by Jennifer BoothroydTrang 2THIS PAGE INTENTIONALLY LEFT BLANKTrang 3a Lerner Publications Company · Minneapolisby Jennifer Boothroyd Trang 4All things are made of matter.Trang 5Matter is
Ngày tải lên: 14/11/2014, 09:05
What is a digital image
... Trang 1 Prof Duong Anh Duc Trang 2 What is an image? o Picture, Photograph o Visual data o Usually two- or three-dimensional What is a digital image? o An image which is “discretized,” ... data (interpretation by a machine/non-human, storage, transmission) 3 Trang 4Image Acquisition Discretization/Digitization Quantization Compression Image enhancement and restoration Image ... Image processing and analysis is mainly concerned with “interpreting” a given image Trang 7Engineering - Circuit board Trang 8Medicine - MR Scan Trang 99 Photography Trang 11 Gamma-ray imaging
Ngày tải lên: 26/01/2015, 10:08
What is a Museum Inside the Museum
... Trang 2 Trang 3 ... Trang 4 Trang 5 ... Trang 1
Ngày tải lên: 22/05/2015, 07:56
what is a question survey
... so that the sample is then representative of the population Eg: A study on a number of people using fast food in a quater A representative sample of a population has similar characteristics ... local park, a Do you use the local park? question at a time and if so what do you think b what do you think of facilities of its facility in the local park? Trang 14Introductory RemarksIt ... school. A population: is the entire group of things or people being studied Random sampling: involves selecting a sample in such a way that all members of the population have an equal chance
Ngày tải lên: 11/06/2015, 13:00
HEPATOCYTE GROWTH FACTOR IS a MAJOR CYTOKINE FOR NSC HOMING TO GLIOMA
... across an endothelial barrier [53] In addition, HMGB1 acts as a pro-inflammatory factor, and is released by damaged cells as a chemoattractant for vascular smooth muscle cells and fibroblasts and ... A major obstacle of utilizing NSCs in clinical applications is the need for fetal brain tissue There is limited availability of fetal tissue and it raises multiple moral and ethical complications ... metastasis Palumbo et al reported that HMGB1 attract mesoangioblast to migrate across an endothelial monolayer and reach damaged muscle HMGB1 therefore appears to induce stem cell transmigration across
Ngày tải lên: 09/09/2015, 08:17
Lanosterol is a survival factor for dopaminergic neurons
... than the affected areas (ventral midbrain and striatum), For example, Julien et al., (2006), measured fatty acids (docohexanoic acid, DHA and arachidonic acid, AA, see Fig 2 for structure) reasoning ... lphosphatidylinositol-inked fatty acyls (B) and plasmalogens (C) are found in high levels in the brain Ethanolamine plasmalogen has an ether linkage A major fatty acyl brain PE is arachidonic acid (AA, 20:4), with ... characterization of the disease, started about half a century ago, is extremely accurate Among experienced clinicians, PD is diagnosed with a 98.5% accuracy (de Lau and Breteler, 2006), compared to about
Ngày tải lên: 10/09/2015, 15:52
def (digestive organ expansion factor) is a crucial gene for the development of endoderm derived organs in zebrafish (danio rerio
... developmental studies in vertebrate Zebrafish has many advantages over other vertebrate organisms Firstly, rapid external development makes translucent embryos available for visual analysis of tissue formation ... meioses.Finally, the small size of adult fish permits large numbers of these animals to be easily bred in a relatively small facility All these features make zebrafish as a suitable model organism for ... disadvantages, morpholino-mediated gene knockdown method is really expanding the capabilities of using zebrafish as the model organism Trang 341.2.3.3 Transgenic fish Transgenic approach is another
Ngày tải lên: 11/09/2015, 16:06
What is a GAP YEAR why do people take a GAP YEAR how to take a GAP YEAR
... Financials of a Gap Year Financials of a Gap Year Tips for Making Your Gap Year a Success Trang 4I What is a gap year?In its most basic form a gap year is a year taken off from traditional schooling ... Misconceptions About the Gap Year Misconceptions About the Gap Year Misconceptions About the Gap Year Misconceptions About the Gap Year Ways to spend your gap year Tips for choosing a gap year Financials ... pathway, prep-year, leap year, defer year, bridge-year, drop year, year out, year off, overseas experience (OE) or foundation year A gap year comes under many guises - backpacking, a career gap,
Ngày tải lên: 21/12/2015, 09:57
What is a Company Visual Identity?
... necessary? - What is the purpose of the form? - Does a form with a similar function already exist, or can this new form be combined with an existing form? - Does the form have a name, and is this name as ... inspiration or for the evaluation and selection of image material. Ambience The Heineken organisation's key values are an essential starting point for image manipulation and photography. ... frontages and company vehicles. Why have a Company Visual Identity? A Company Visual Identity gives an organisation its own look. It make s a company recognisable, to the outside world and also...
Ngày tải lên: 23/10/2012, 13:53
Tài liệu SALTER-HARRIS FRACTURE Alex Duckworth, MS4 What is a Salter-Harris fracture? Fracture through ppt
... non - - displaced displaced What is a Salter What is a Salter - - Harris fracture? Harris fracture? Fracture through growth plate in a pediatric Fracture through growth plate in a pediatric patient patient 35 ... Growth Cartilage growth from epiphysis towards Cartilage growth from epiphysis towards metaphysis metaphysis Neovascularization Neovascularization and primary bone formation and primary bone formation ... epiphysis, Fracture through epiphysis, physis physis , and , and metaphysis metaphysis Also chronic disability because of Also chronic disability because of articular articular surface...
Ngày tải lên: 25/01/2014, 06:24
Tài liệu Báo cáo khoa học: Diol dehydratase-reactivating factor is a reactivase – evidence for multiple turnovers and subunit swapping with diol dehydratase pdf
... glycerol dehydratase-reactivating factor reactivates the inacti- vated hologlycerol dehydratase in a similar manner. Both dehydratase-reactivating factors exist as a 2 b 2 heterotetramers [a, DdrA or GdrA ... biochemical evidence for this has been obtained so far. A similar reactivating factor for ethanolamine ammonia lyase has been reported [26]. It has also been reported that a protein named E 2 activates ... Mechanism of action of adenosylcobalamin: glycerol and other substrate analogues as substrates and inactivators for propanediol dehydratase – kinetics, stereospecificity, and mechanism. Biochemistry...
Ngày tải lên: 15/02/2014, 01:20
Bạn có muốn tìm thêm với từ khóa: