the structure of a multiple choice question

... be installed – The amount of data and the speed at which it must be transmitted – The cost of the media and installation 17 Local Area Network (LAN) Local Area Network (LAN) An individual network ... Frame Header IP Header Data App TCP Header Header Frame Trailer Data Message: Data Multiple protocols 26 Multiple protocols (encapsulated) HTTP Header Protocols Frame Header IP Header Data App TCP ... 46 The Communication Process Protocol Data Unit (PDU) - The form that a piece of data takes at any layer PDUs are named according to the protocols of the TCP/IP suite Data - Application layer...

Ngày tải lên: 01/04/2014, 12:20

... the class of linear models, the abundance value of a gene is treated as a weighted sum of the abundance values of other genes A high-dimensional transcript profile is a vector of abundance values ... is regulated often by a small number of other genes [3,4] so a reasonable representation of a network is a sparse graph A sparse graph is a graph  parametrized by a sparse matrix W, a matrix with ... networks Analysis of the statistical and topological properties of learned LP-SLGNs may have practical value; for example, genes with high random walk betweenness, a measure of the centrality of a node...

Ngày tải lên: 12/08/2014, 17:20

... of the four dimensions of value Notes The results of the factor analysis on the data collected in the first stage are available on request from the authors Appendix A partial-disaggregation approach ... The importance of this combination can be seen in a comment by MacKay (1999, p 182), who noted that a product’s or a service’s appeal is an “amalgam of rational and emotional factors” and that ... reliabilities appear on the diagonal Reliability of linear composite of scale (19 items) ϭ 0.96 The reliabilities of the factors and the total scale are shown in Table The reliabilities range from...

Ngày tải lên: 24/09/2016, 18:06

... achievement of short-term performance targets or long-range performance targets E All of the above Which of the following is not among the principal managerial tasks associated with managing the strategy ... strategic and financial performance targets is a conceptually strong approach for judging a company's overall performance because A financial performance measures are lagging indicators that ... we are and what we do." E what future actions the enterprise will likely undertake to outmaneuver rivals and achieve a sustainable competitive advantage The task of stitching together a strategy...

Ngày tải lên: 16/03/2017, 10:09

... for the syntactic structure of language, it prefers placing the function of language as central (what language does and how language does it) rather than placing the elements of language and their ... Re-examine some of the most important issues related to the experiential aspect of functional grammar • Analyze the meaning and structure of a narrative based on the systemic functional analysis ... grammar are different from formal models of grammar by their focus on the communicative aspect of language 2.4 Metafunctions Halliday developed a theory of the fundamental functions of language...

Ngày tải lên: 07/09/2013, 13:48

... declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative ... declarative declarative declarative declarative declarative declarative declarative declarative declarative imperative declarative declarative Modality ability/neg ability/pos ability/neg ability/neg ... Subject The spaceship The planet They There The spaceship The two astronauts The woman It She We It Both of them They All plants and Animals They They Everything The man Nothing Something He I The...

Ngày tải lên: 12/02/2014, 20:20

... was improved by con˚ sidering only pairs of Ca atoms < 2.5 A apart Because of the different length of a helix A, the Ca atoms N-terminal to or inside helix A are separated by large distances The ... composed of two domains: an a ⁄ b domain and an a domain (Fig 1A) The known activesite motif is found in a cavity between the two domains The a ⁄ b domain consists of a central six-stranded b sheet of ... conserved active-site motifs, RHGXRXP and HD, and hydrolyze metal-free phytate with pH optima in the acidic range They consist of two domains, a large a ⁄ b domain and a small a domain with the catalytic...

Ngày tải lên: 16/02/2014, 09:20

... Standard procedures were used for the preparation and ligation of DNA fragments, for the transformation of Escherichia coli and for the isolation of plasmid DNA from bacterial cells [51] Other ... wild-type and DQCR10 strains (Fig 2C) Such an analysis demonstrated that all the bc1 subunits were present in comparable amounts in both yeast strains Therefore, the reason for the disappearance of the ... respiratory-deficient because of the absence of the catalytic subunit ISP (Table 1) Figure 3A shows that a band of ΔQCR9 ΔISP ΔBCS1 approximately 500 kDa was also found in this mutant strain when the...

Ngày tải lên: 18/02/2014, 08:20

... al from the ratio of the forward scattering intensity of the sample and that of the molecular mass standard BSA The ab initio deconvolution of the SAXS profiles to restore a low-resolution shape ... surface structure of the enzyme was investigated by small-angle X-ray scattering (SAXS) Further structural information was obtained by the spectroscopic characterization of PLDa2 in the native ... et al Structure of plant phospholipase D A B C Fig Influence of the calcium concentration on PLDa2 activity (A) Relative activity as function of calcium chloride (black) and calcium acetate (gray)...

Ngày tải lên: 19/02/2014, 02:20

... The N-terminal pro domain is autocatalytically cleaved off when the enzyme has obtained its active conformation, and the two C-terminal domains are cleaved off by heat treatment at 50 °C An Ala-Pro-Thr ... from a Serratia sp R Helland et al Structure in the binding region The electrostatic surface calculated by icm (Fig [28]) shows that the bacterial peptidases have a more anionic character than the ... SPRK also has an aspartic acid residue at position at 200, and with the same conformation as in the two other structures, but Asp200 forms a salt bridge to Lys253 (Ala253 and Asn250 in PRK and...

Ngày tải lên: 19/02/2014, 07:20

... that Figure is not a screenshot of the actual system interface The NM is the only part from the actual system interface Figure shows the NM after turn Tutor1 We manually annotated each system question/ explanation ... addition, the SIH is not always available and users have to activate it manually Other visual improvements for dialogue-based computer tutors have been explored in the past (e.g talking heads (Graesser ... betweensubjects factors was applied The within-subjects factor was the NM presence (NMPres) and the between-subjects factor was the condition (Cond)1 The significance of the effect of each factor and their...

Ngày tải lên: 20/02/2014, 12:20

... 2007 The Authors Journal compilation ª 2007 FEBS 3129 Structure of S agalactiae STP A M K Rantanen et al B Fig (A) Structure of the SaSTP (monomer C) The protein was drawn using a secondary structure ... electron-density maps SaSTP has an abba sandwich structure, consisting of two antiparallel b sheets packed against each other The b sheets (b1 and b2) are surrounded by a helices (Fig 1A, B) Similar to other ... Fcalc|)/( |Fobs|), where Fobs and Fcalc are observed and calculated structure factor amplitudes, respectively Rfree is an R-factor for an unrefined subset of the data (5% of the data) a the metal...

Ngày tải lên: 07/03/2014, 09:20

... GAGCCATCATCATTAATAGCATCCAAAA TGACTTGC-3¢); GLU T46 2A forward (5¢- GAACAACTT AACAGATATGCCGGTTATTCCACCGGTGCC-3¢), GLU T46 2A reverse (5¢- GGCACCGGTGGAATAACCGGCA TATCTGTTAAGTTGTTC-3¢); GLU H44 7A, D45 0A ... (5¢-ATTCAAACTATAAAGTTGACGCAA CTGACTTGGAAACCTTC-3¢), GLU R1 5A reverse (5¢GAAGGTTTCCAAGTCAGTTGCGTCAACTTTATAGTT TGAAT-3¢); GLU H44 7A forward (5¢- GCAAGTCATTT TGGATGCTATTAATGATGATGGCTC-3¢), GLU H44 7A reverse (5¢- GAGCCATCATCATTAATAGCATCCAAAA ... et al Glucoamylase raw starch binding site reverse (5¢-GTTCATTCAAGGAGCCATCAGCATTAAT AGCATCCAAAATGACTTGC-3¢) All mutations were verified by DNA sequencing Glucoamylase Glu Enzyme preparation and...

Ngày tải lên: 07/03/2014, 12:20

... In the report, Exhibit plots the impact of average account balance and number of plan participants on the ‘all-in’ fee for a variety of combinations of average account balance and number of plan ... as a percentage of assets) The primary drivers6 of a plan’s overall level of fees were: • Plan size as measured by number of participants; • Average participant account balance in the plan; and ... • Average participant account balance in the plan Plans with more participants and plans with higher average participant account balances tended to have lower ‘all-in’ fees (as a percentage of...

Ngày tải lên: 07/03/2014, 13:20

... kinases, a MAP kinase (MAPK), a MAPK kinase (MAPKK) and a MAPKK kinase (MAPKKK), are common signalling modules in eukaryotic cells [20,21] The budding yeast (S cerevisiae) has several MAPK cascades ... pathway for hyperosmolarity adaptation in budding yeast (Saccharomyces cerevisiae) and based on the related mRNA expression time-series data from Stanford Microarray Databases Results Inferring the ... intervention of other nodes or parameters Sontag et al [15] have proposed another complementary method based on time-series measurements, which can be useful when stationary data are not available and the...

Ngày tải lên: 07/03/2014, 21:20

... chains of Hb A0 was 10 times faster than that of the beta chains and that the oxidation of the beta chains was not influenced by pH The biphasic reaction was shown to consist of a rapid initial ... oxidation rate A comparison with the auto-oxidation rate (data from Fig 3) revealed that in the presence of EDTA, the increase in the rate of oxidation of Hb A0 produced by the LPSs of rough and ... increased the initial fast phase of the reaction, but decreased the rate of the slow phase of oxidation in the presence of EDTA A comparison of rough and smooth LPSs of E coli and S minnesota in the...

Ngày tải lên: 08/03/2014, 10:20

... demonstrate the presence of positive charge Figure 4I shows the bottom face (same as in Fig 4C) of a van der Waals model of the best structure of RIIa D/D The central part of this face appears to ... understand the structural properties of the charged face, we have performed pKa calculations on the ensemble of 24 structures of RIIa D/D Figure presents a plot of the calculated apparent mean pKa ... N-terminal amide and His2 Aspartic acids Asp27 and Asp30 show lower mean pKa values than their model pKa values This may be a general property of Asp residues, as it has been observed in another...

Ngày tải lên: 08/03/2014, 22:20

... mousetraps in the Merode Altarpiece.2 Thanks to Panofsky, we are aware that the very transparence of a window, in the context of an Annunciation, can serve as a vehicle for the most resistant of theological ... of Vasarian academicism: triumphant ri` nascita recast in a certain notion of the history of art as rationalist humanism; the famous imitazione recast in a hierarchical table of the relations between ... of the dybbuk This very simple legend would be to the arcana of the great Jewish mystical culture—in particular the cabala of Isaac Luria, transmitted as far as the shtetls in Poland—what the...

Ngày tải lên: 18/03/2014, 09:15

... and T brucei apocytochrome c (J W A Allen, unpub2826 A Normalised absorbance of the alanine of the AXXCH motif (Ala25) (in green) and the unsaturated vinyl group of the heme ˚ (cyan) are separated ... free-living phagotrophic flagellates (e.g Bodo saltans), photosynthetic algae (e.g Euglena gracilis), and parasitic trypanosomatids [e.g the causal agents of the tropical diseases African sleeping ... ceased within a few seconds (Fig 1) A very similar result was obtained if mm KCN was added instead of antimycin A; cyanide inhibits the cytochrome aa3 oxidase of the classic respiratory chain,...

Ngày tải lên: 23/03/2014, 04:21

... Although a precise analysis of the mode of action of Xgh7 4A has not been performed, Xgh7 4A appears to be an endoglucanase because it has an open cleft Comparison of the XEG and OXG-RCBH active sites ... calculated from a plot of initial reaction rates versus substrate concentration using Prism (GraphPad Software, San Diego, CA, USA) One unit was defined as the amount of enzyme that released lmol of ... (both Amersham Biosciences) Analysis of kinetic parameters The kinetic parameters were determined at various concentrations of the substrate, tamarind seed xyloglucan (Dainippon Sumitomo Pharma,...

Ngày tải lên: 23/03/2014, 05:22