... One of the greatest advantages of using learners‟ first language in vocabulary teaching is that it provides an easier way to explain the meaning of second language vocabulary The use of the learners‟ ... in the target language and to have an acceptable pronunciation The Reading approach attracted more importance than grammatical skill The vocabulary used in the reading passages is controlled at ... 1994) Candlin (1988) stated that “The study of vocabulary is at the heart of language teaching in terms of organization of syllabuses, the evaluation of learner performances, and the provision of
Ngày tải lên: 30/03/2015, 14:00
... studied and most data currently available come mainly from the USA [17] The aim of this exploratory study is to fill the gaps highlighted above by investigating a range of school characteristics that ... management, achievement of students, and behaviour and safety of students at the school Our sample included no schools with a rating of “Inadequate.” b Value added (VA) score: a second school quality rating ... from all Year classes (age 11–12 years) in 40 participating secondary schools within the state education system across south-east England Full details of the sampling methodology are available
Ngày tải lên: 20/02/2020, 22:15
Báo cáo khoa học: Characterization of the role of a trimeric protein phosphatase complex in recovery from cisplatin-induced versus noncrosslinking DNA damage potx
... that cH2AX is removed from the site of DNA damage before it is dephosphorylated If this is the case, removal from the action of the ataxia telangiectasia mutated (ATM)⁄ ataxia telangiectasia and ... and RAD53 related (ATR) kinases at the site of DNA damage may decrease the kinase⁄ phosphatase ratio and allow the phosphatase to dephosphorylate cH2AX In mammalian cells, PP2A isoforms, the orthologues ... activation of the DNA damage response pathways causes arrest of the cell cycle to allow time for cells to repair the DNA before the cell cycle resumes If the DNA cannot be repaired or the damage bypassed,
Ngày tải lên: 30/03/2014, 04:20
Báo cáo y học: "The role of a pseudocapsula in thymic epithelial tumors: outcome and correlation with established prognostic parameters. Results of a 20-year single centre retrospective analysis" pptx
... Masaoka III Masaoka IV a Data are presented as mean ± SD unless otherwise indicated. b Myasthenia gravis Table 2: Clinical features of different thymoma classified according Masaoka Stage a Masaoka ... Okumura M, Ohta M, Tateyama H, Nakagawa K, Matsumura A, Maeda H, Tada H, Eimoto T, Matsuda H, Masaoka A: The World Health Organization histologic classification system reflects the oncologic behavior ... prognosis Although the presence of a capsula is of strong significance in the univariate analysis, it failed in the multivariate analysis due to its correlation with clinical Masaoka stage Masaoka stage
Ngày tải lên: 10/08/2014, 10:20
Báo cáo y học: "The establishment of a primary spine care practitioner and its benefits to health care reform in the United States" docx
... care provider for the diagnosis and non-surgical management of SRDs; a “primary care physician for the spine” Primary Care for the Spine “Primary care” is defined by the American Academy of Family ... comprehensive care and management of a designated patient population under a risk-sharing agreement However, there is a projected gap between the availability of traditional PCPs and societal needs in the ... communication of findings may also help avoid the iatrogenic disability that can arise as a result of the medicalization of imaging findings that are of questionable clinical significance, such as “disc
Ngày tải lên: 13/08/2014, 15:21
Molecular analysis of the role of a yeast potassium transport component TRK1 in agrobacterium mediated transformation
... Trk1-Seq-F1 ACAAAGACAGCACCAACAGA Trk1-Seq-R1 GAAGTAGTGAACCGCGATAA Trk1-Seq-F2 TGGATCGTGCAATTATCTTG Trk1-Seq-R2 AAGGCGATTAAGTTGGGTAA Trang 392.2 DNA manipulation 2.2.1 Transformation of plasmid DNA into ... Biosystem and s Tu’s on’s y ms Trang 38Table 2.5: List of primers.GFP1 GATAAGGCAGATTGAGTGGA GFP2 AAAGATGACGGTAACTACAA TO105-2F CTAGGGATCCGCCACCATGCATTTTAGAAGAACGAT TO105-2R CTAGGGATCCCGTTAGAGCGTTGTGCTGCTCC ... with animal voltage-gate K+ channel, they form K+ selective channels and are strongly regulated by voltage They are active at the plasma membrane as inward, weakly-inward and outward channels The
Ngày tải lên: 16/10/2015, 11:57
The role of mother tongue in teaching English to the first year students at Thai Nguyen University of Education
... on the practice and use of the target language as much as possible, which will help the learners get familiar with the language they learn as well as motivate them in the study It is important ... the impact of the mother tongue on the learning and teaching of a second language with some hope that both the learners and teachers can find an easier and more effective teaching and learning method ... first language as a means to help them study the target language easily To those who have a low-level of English, the use of the mother tongue is of great importance To the teachers, the mother
Ngày tải lên: 23/09/2020, 22:45
I the study on the role of using vietnamese in teaching english vocabulary to th
... One of the greatest advantages of using learners‟ first language in vocabulary teaching is that it provides an easier way to explain the meaning of second language vocabulary The use of the learners‟ ... in the target language and to have an acceptable pronunciation The Reading approach attracted more importance than grammatical skill The vocabulary used in the reading passages is controlled at ... 1994) Candlin (1988) stated that “The study of vocabulary is at the heart of language teaching in terms of organization of syllabuses, the evaluation of learner performances, and the provision of
Ngày tải lên: 16/03/2021, 08:44
I the study on the role of using vietnamese in teaching english vocabulary to th
... second language acquisition It examines recent research on the teaching and learning of second language vocabulary, the role of the first language (L1) and translation in vocabulary instruction, and ... the command of a particular person or a group 3 A list of words and often phrases, usually arranged alphabetically and defined or translated; a lexicon or glossary Vocabulary is fundamentally defined ... 1.1.2 The Roles of Vocabulary in Second Language Acquisison It is known that, in learning a foreign language in general, and English in particular, the knowledge and mastery of vocabulary play an
Ngày tải lên: 18/07/2021, 14:36
Exploring the Role of a Superintendent on Science Curriculum Delivery
... staff affirmed the accuracy of the personal attribute and mostof the environmental scales Table 1: Rural Early-Years School SCIQ Application Data Scale Actual Mean Score Actual Standard Deviation ... in anorthern Canadian school on science delivery evaluation at an educational forum foreducators at an urban centre in Canada (Lewthwaite, 2005a) The principal at RuralEarly-Middle Years School ... delivery of the sciencecurriculum at the early- and middle-years level Fullan (1992) asserts that school changeand improvement in any area bear the mark of the principal as central for leading andsupporting
Ngày tải lên: 18/10/2022, 20:44
The Value of a Neighborhood School- The Story of Paxson Elementar
... school officials The study area is only a part of the area that feeds students into Paxson Elementary School, however, it is an older part of the school’s contributing area and has traditionally ... grade standards, and the population was spilling into the modular classrooms set up on the playground A few years later, a brand new school building stood at the site of the old Paxson School The ... Trang 1ScholarWorks at University of Montana Graduate Student Theses, Dissertations, & 2010 The Value of a Neighborhood School: The Story of Paxson Elementary, Missoula, Montana Tina
Ngày tải lên: 22/10/2022, 22:07
An Investigation of the Role of a Teacher Evaluation System and I
... growth (Painter, 2001) Standards-based Evaluation - A vision of teaching standards that are broad domains of research-based teaching practices, comprehensive standards, and detailed criteria through ... large urban district, and the extent to which this appraisal system and the roles of building administrators, as evaluators, impact teaching practice and teacher professional growth As whole-school ... Departments in each school, as well as the department chairpersons of the respective departments Language Arts and Mathematics were selected because they are the two areas of assessment on the New Jersey
Ngày tải lên: 01/11/2022, 23:12
(LUẬN VĂN THẠC SĨ) The role of mother tongue in teaching English to the first year students at Thai Nguyen University of Education
... data collection, with participants unaware of the observation details to enhance result reliability, allowing for an accurate assessment of mother tongue usage in the classroom.Data analysisThe ... methods emphasize practical use of the target language, which can enhance familiarity and motivation among learners However, at the beginner level, students may lack the necessary vocabulary and structures ... first language or target language in the classroom According to Lynn Cameron, the amount of the first language to be used in class depends on the learners' ability rather than the teachers' proficiency
Ngày tải lên: 17/12/2023, 02:23
Luận văn i the study on the role of using vietnamese in teaching english vocabulary to th
... main goal was to train students to communicate in the target language and to have an acceptable pronunciation The Reading approach attracted more importance than grammatical skill The vocabulary ... language teaching approach is the Direct Method The Direct Method stressed the abilily to use rather than analye a language as the Trang 16goal of language instuction or in other words, the main ... lang uage acquisition (Knight, 1994) Candlin (1988) stated that “The study of vocabulary is at the heart of language teaching in terms of organization of syllabuses, the evaluation of learner
Ngày tải lên: 19/05/2025, 21:03
Luận văn a comparative study of the effect of a task based teaching and traditional method to grammar instruction at vietnamese upper secondary schools
... this thesis are granuaar teaching, grammar instruction, granmar-wanslation mathod, and task-hased approach AWhough there may be some connctational meaning between grammar feaching and grammar ... this thesis are granuaar teaching, grammar instruction, granmar-wanslation mathod, and task-hased approach AWhough there may be some connctational meaning between grammar feaching and grammar ... Vietnam, the teaching of grammar is an area of controversy and debate In the grammar teaching classroom, some teachers pay excessive attention to the importance of teaching rules and grammatical structures,
Ngày tải lên: 16/08/2025, 19:18
Luận văn i the study on the role of using vietnamese in teaching english vocabulary to th
... Empirical Studies of Translation Method in Vocabulary Teaching and Trang 19PART A: INTRODUCTION 1 Rationale of the Study Vocabulary forms the biggest part of the meaning of any language, and it ... Vocabulary Teaching 1.2.4 Empirical Studies of Translation Method in Vocabulary Teaching and Trang 15PART A: INTRODUCTION 1 Rationale of the Study Vocabulary forms the biggest part of the meaning ... vocabulary leaming Therefore, an effective approach to vocabulary is always one of the great concerns of every language teacher A recent study by Ramachandran and Rahim (2004) investigaled the oflectiveness
Ngày tải lên: 16/08/2025, 21:11
The implementation of task based language teaching in EFL primary school classrooms a case study in vietnam
... approach to teaching that resulted from a focus on communication as the organizing principle for teaching rather than a focus on mastery of the grammatical system of the language” (Richards, ... in much of Merrill Swain’s research Swain (1985) argued for the role of language production as a primary catalyst in process of in language acquisition; a role that has also been incorporated into ... The value of tasks has thus been established in the field of second language teaching and learning It is now essential to examine in what ways teachers can design and carry out task-based teaching
Ngày tải lên: 28/02/2021, 20:37
MICROECONOMICSPrinciples and AnalysisFrank A. CowellSTICERD and Department of Economics London School of Economics December 2004.ii.ContentsContents List of Tables List of Figures Preface 1 Introduction 1.1 The rôle of microeconomic principles . potx
... in the analysis of game-theoretic models (chapter 10) –how one player responds to the actions of another on the assumption of a speci…c form of the rules of the game. We use the comparative statics ... equation: q = F(K; L) (“quantity of output = a function of capital and labour”), which is a convenient way of picking up some of the features that are essential to analysing the behaviour of the ... because the method of proof is not particularly illuminating or is rather technical. Throughout each chapter there are footnotes that focus on detailed points of the argument. These take the...
Ngày tải lên: 08/03/2014, 10:20
Tài liệu THE ROLE OF UNIVERSITIES IN REGIONAL INNOVATION SYSTEMS - A NORDIC PERSPECTIVE pdf
... Ålborg and Roskilde, together with the expansion of the number of students at the Aarhus School of Busi- ness in the 70s and the 80s, the rate of growth decreased and the number of students was maintained ... of the transistor indicated a spiral model of interac- 50 Since 1970, the State has funded both capital investments and the running of the University of Aarhus in the same way as for the other ... Number of students and teaching staff at University of Aarhus 1980-2002 Source: The University of Aarhus In the same period, there were a number of changes in the admission of stu- dents. Because of...
Ngày tải lên: 16/01/2014, 16:33
Tài liệu Organization-internal Transfer of Knowledge and the Role of Motivation: A Qualitative Case Study pptx
... transfer and the role of motivation in the way that we have. The role of motivation is probably as important in a chain of hotels or super- markets, a software vendor or a consulting com- pany, ... nature of the programme was addressed by many respondents, and it was a par- ticular area where views differed. The programme was designed as a competition, with of cial results and annual award ... programme was managed also differed between plants. The idea of the central programme management was that, at the least, plants should make yearly plans for each machine, outlining performance targets,...
Ngày tải lên: 24/01/2014, 00:20