the core of a multiuser system

List the components of a radio system

List the components of a radio system

... – Advantages • Can carry up to three times the amount of data as TDMA • Transmissions are much harder to eavesdrop on • A would-be eavesdropper must also know the exact chip in which the transmission ... Communications Understanding Radio Frequency Communications Objectives • List the components of a radio system • Describe how different factors affect the design of a radio system • Explain the radio ... receiving the signal • Attenuation – A loss of signal strength • Multipath distortion – As a radio signal is transmitted, the electromagnetic waves spread out 24 Signal Strength (continued) 25 Radio...

Ngày tải lên: 13/09/2012, 10:52

30 924 0
Báo cáo khoa học: Insights into the design of a hybrid system between Anabaena ferredoxin-NADP+ reductase and bovine adrenodoxin pot

Báo cáo khoa học: Insights into the design of a hybrid system between Anabaena ferredoxin-NADP+ reductase and bovine adrenodoxin pot

... plot of the initial rateconstants (V0), which represents the initial rate of the reaction, vs the Adx concentration shows an almost linear correlation (Fig 3A), suggesting that the formation of the ... 1 Departamento de Bioquı´mica y Biologı´a Molecular y Celular, Facultad de Ciencias, Universidad de Zaragoza, Spain; 2 Biochemie, Universit€ a at des Saarlandes, Saarbr€ u ucken, Germany The opportunity ... shows a typical absorbance band at 450 nm [33] Time-sequential spectra recorded after addition of CYP11A1 to an anaerobic CO-saturated sample containing the reaction mixture FNRrd/Adxoxgave rise...

Ngày tải lên: 31/03/2014, 07:20

10 403 0
The development of a classification system for moniitoring physical activity using a miniaturized 3 axis accelerometer

The development of a classification system for moniitoring physical activity using a miniaturized 3 axis accelerometer

... artificial neural networks (ANN) [17, 33], etc Heuristic analysis methods are through the analysis on the raw sensor data or the features from data, such as the average and the deviation of the acceleration ... calibration The acceleration in each axis can be calibrated in the earth’s gravitational field The device is put face up/down and get the up/down acceleration (a max and a min) The ideal calibration ... relative to the user, the advantage of a 3-axis system was taken by summing the squared of all projected accelerations into a common signal denoted net acceleration The vector magnitude of an accelerometer...

Ngày tải lên: 29/01/2021, 14:14

81 11 0
Tài liệu Báo cáo khoa học: Evidence that the assembly of the yeast cytochrome bc1 complex involves the formation of a large core structure in the inner mitochondrial membrane pdf

Tài liệu Báo cáo khoa học: Evidence that the assembly of the yeast cytochrome bc1 complex involves the formation of a large core structure in the inner mitochondrial membrane pdf

... mitochon-drial respiratory chain, the assistance of specific chaperone proteins is also required The available data indicate that the accessory factor Bcs1p is involved in the binding of ISP to an immature ... speculate that the larger bc1 core structure acquires a higher stability against proteolytic degrada-tion after incorporadegrada-tion of the two core proteins The minimal, yet stable, composition of ... the midst of this quickly evolving con-text of macromolecular organization of the mitochon-drial proteome, comparatively little is known about the assembly pathway leading to the maturation of...

Ngày tải lên: 18/02/2014, 08:20

15 641 0
Tài liệu Báo cáo khoa học: The chitinolytic system of Lactococcus lactis ssp. lactis comprises a nonprocessive chitinase and a chitin-binding protein that promotes the degradation of a- and b-chitin doc

Tài liệu Báo cáo khoa học: The chitinolytic system of Lactococcus lactis ssp. lactis comprises a nonprocessive chitinase and a chitin-binding protein that promotes the degradation of a- and b-chitin doc

... Vaaje-Kolstad et al containing 100 lm of (GlcNAc)1–4 was analysed at the start, in the middle and at the end of each series of samples The resulting average values of the standards (displaying standard ... instructions, containing ends compatible with the expression vector (forward primer, 5¢-GGTATTGAGGGTCGCCATGGTTATGTTC AATCACCA-3¢; reverse primer, 5¢-AGAGGAGAGTTAG AGCCTTACAAGAAGGGTCCAAAGA-3¢) The PCR product ... hydrolases) was recorded at regular time intervals The degradation of a-chitin by LlChi18A started with a rapid phase, regardless of the presence of LlCBP33A In the presence of LlCBP33A, the fast...

Ngày tải lên: 18/02/2014, 08:20

14 684 0
báo cáo hóa học: " Cognitive interviewing methodology in the development of a pediatric item bank: a patient reported outcomes measurement information system (PROMIS) study" docx

báo cáo hóa học: " Cognitive interviewing methodology in the development of a pediatric item bank: a patient reported outcomes measurement information system (PROMIS) study" docx

... University of North Carolina at Chapel Hill, Chapel Hill, North Carolina, USA Email: Debra E Irwin* - dirwin@email.unc.edu; James W Varni - JVarni@archmail.tamu.edu; Karin Yeatts - Karin_Yeatts@unc.edu; ... Measurement Informa-tion System (PROMIS) project, a NaInforma-tional Institute of Health Roadmap for Medical Research initiative, was developed to advance the science and application of patient-reported ... for an interview date At the time of the interview, a trained research assistant obtained parental informed consent and the children signed an assent document All child participants received a...

Ngày tải lên: 18/06/2014, 19:20

10 486 1
Báo cáo hóa học: " Testing the potential of a virtual reality neurorehabilitation system during performance of observation, imagery and imitation of motor actions recorded by wireless functional nearinfrared spectroscopy (fNIRS)" potx

Báo cáo hóa học: " Testing the potential of a virtual reality neurorehabilitation system during performance of observation, imagery and imitation of motor actions recorded by wireless functional nearinfrared spectroscopy (fNIRS)" potx

... hands on the table with the palms facing down-wards, and faced the monitor at a distance of approxi-mately 70 cm The image on the monitor showed a virtual arm in the same orientation and relative ... the action-observation system and 2) to draw conclusions for the system’s further application in neurorehabilitative treatment We hypothesized that the observation, imagery and imitation of a ... protocol with systemic rhythms such as heart-beat, respiration and heart rate fluctuations Bilateral group The subject group ‘bilateral’ had the same VR task as the group ‘unilateral’, but was recorded...

Ngày tải lên: 19/06/2014, 08:20

13 578 0
báo cáo hóa học: " Application of a hybrid wavelet feature selection method in the design of a self-paced brain interface system" pptx

báo cáo hóa học: " Application of a hybrid wavelet feature selection method in the design of a self-paced brain interface system" pptx

... as the feature classifier A moving average and a debounce algorithm are employed to improve the performance of the system by reducing the number of false activations The parameter values of the ... sigsig-nals can be used to label the brain signals and to evaluate the per-formance of a BI The data analysis of individuals with motor disabilities was thus left to future studies The data of four ... elimination of chan-nels) Systematic elimination of channels can lead to a faster setup of the system as well as decreased computa-tional time This could be part of future research works aimed at...

Ngày tải lên: 19/06/2014, 10:20

13 530 0
Báo cáo hóa học: " Research Article Dynamics of a Rational System of Difference Equations in the Plane" pot

Báo cáo hóa học: " Research Article Dynamics of a Rational System of Difference Equations in the Plane" pot

... for the different values of the parameters, the global and local properties of the system In particular, we discuss the boundedness and the asymptotic behavior of the solutions, the existence of ... techniques of linear algebra one can also compute them in terms of the eigenvalues ofA an approach using the solutions to an associated linear difference equation may be seen in 9 Remark 2.2 As mentioned ... matrixA has an eigenvalueλ such that −λ is also an eigenvalue Since A is a 3 × 3 square matrix, this Trang 5obviously implies that the trace ofA is also an eigenvalue Hence, β1 is an eigenvalue,...

Ngày tải lên: 21/06/2014, 05:20

17 366 0
Báo cáo hóa học: " A Robust Parametric Technique for Multipath Channel Estimation in the Uplink of a DS-CDMA System" pot

Báo cáo hóa học: " A Robust Parametric Technique for Multipath Channel Estimation in the Uplink of a DS-CDMA System" pot

... )isconstructedinaway similar to S(τ) based on the already estimated path delays. The value of the search step size δ affects the estima- tion accuracy of the maximization procedure. In any case, the estimates ... the main diagonal elements of R η . Hence, the MAI covariance matrix R η can be approximated as a block diagonal matrix and the block that appears in its main diagonal is given by (A.4).Notethatsuchanapprox- ... inversion of the block diagonal matrix R η can be avoided by using the approximation (A.7)providedin the appendix. Although this approximation has a significant computational advantage, it may limit the...

Ngày tải lên: 22/06/2014, 22:20

12 439 0
Báo cáo y học: "Reducing mortality in severe sepsis with the implementation of a core 6-hour bundle: results from the Portuguese community-acquired sepsis study (SACiUCI study)" pps

Báo cáo y học: "Reducing mortality in severe sepsis with the implementation of a core 6-hour bundle: results from the Portuguese community-acquired sepsis study (SACiUCI study)" pps

... contributions All authors have made substantial contribution on the conception, design and acquisition of data and/or analysis and interpretation of data, as well as in the drafting, revising and final approval ... Cuidados Intensivos, Hospital de São Sebastião, Santa Maria da Feira); Paula Castelões (Unidade de Cuidados Intensivos, Centro Hospitalar de Vila Nova de Gaia); Teresa Cardoso (Unidade de Cuidados ... eliminating any bias related to seasonal variation Time 0 was clearly defined as the hospital arrival time, eliminating the influence of individual physician's assess-ment [22,23,28], making data more...

Ngày tải lên: 13/08/2014, 20:22

11 353 0
THE DIRECT REPROGRAMMING OF SOMATIC CELLS: ESTABLISHMENT OF A NOVEL SYSTEM FOR PHOTORECEPTOR DERIVATION

THE DIRECT REPROGRAMMING OF SOMATIC CELLS: ESTABLISHMENT OF A NOVEL SYSTEM FOR PHOTORECEPTOR DERIVATION

... regeneration in the mammalian central nervoussystem has been a significant limitation for the fields of mammalian developmentalbiology and regenerative medicine A further limitation is a reduced ability ... that they can give rise toall the cell types of an adult organism, including all of the specific cell types of thecentral nervous system They are also capable of self-renewal, which allows them ... phenotypesDiseases of and injuries to the central and peripheral nervous system devastate thesensory experience and motor control of a significant portion of the population eachyear Because of the prevalence...

Ngày tải lên: 24/08/2014, 12:37

72 376 0
luận văn Toxicity assessment of small molecules using the zebrafish as a model system

luận văn Toxicity assessment of small molecules using the zebrafish as a model system

... ACATGCTGGAGGCCAGCTC TACCCTCCTTGCGCTCAATC hsp70 Stress indicator CCGAAGAGAAGCGACTTGAC GCGATTCCTTTTGGAGAAGAC foxd3 Autonomic nervous mbpa Myelin sheath CCGTCGTGGAGACGTCAA CGAGGAGAGGACACAAAGCT ... testing that is attracting scientific and legal attention Its advantages including rapid development, high availability, and easy observation have made the model amenable to high-throughput assays ... On the other hand, there are concerns over hazardous effects of some PPCP substances upon human health such as the commonly-used antimicrobial triclosan [18], or the phthalate family of plasticisers...

Ngày tải lên: 15/05/2015, 00:37

58 265 0
Study of technical feasibility and the payback period of the invested capital for the installation of a grid connected photovoltaic system at the library of the technological federal university of paraná

Study of technical feasibility and the payback period of the invested capital for the installation of a grid connected photovoltaic system at the library of the technological federal university of paraná

... Federal University of Santa Catarina Situated at the Solar Energy Laboratory – LABSOLAR, at the UFSC (Federal University of Santa Catarina), there is the first Grid-connected Photovoltaic System of ... [17] has found a difference of 5,5% between annual average daily irradiation obtained at the weather station INMET and database SWERA To conclude, this paper considered 5,5% of the annual average ... invested capital for the installation of a grid-connected photovoltaic system at the library of the Technological Federal University of Paraná Henrique Marin Campos, Ana Katherine Rodríguez Manrique,...

Ngày tải lên: 09/09/2015, 10:32

12 431 0
The introduction of a system that would improve a manager’s ability to successfully supervise their employees, operating companies has been identified as a solution

The introduction of a system that would improve a manager’s ability to successfully supervise their employees, operating companies has been identified as a solution

... stakeholders.5 Statistical analysis of employee and goods data 6 Evaluate the performance of the new system Has it improved the way we manageour people There is a vast amount of staff employed within the ... differentapproaches that can be taken to create the system these are: A windows application would run as a programme directly on the user‟s machine.The application can easily be connected to a database ... Visual studioallowing the system to update and modify the data from within the database A loginsystem can also be created by using data in the database where the login details will be stored in the...

Ngày tải lên: 17/01/2016, 19:35

32 453 0
Development of a recommender system for the selection of software architecture methods

Development of a recommender system for the selection of software architecture methods

... & separate phase • Scant attention to the shaping of IT artefacts by the organizational context • Fails that the artefacts emerges from interaction with the organization Need for a research ... focuses practical use of artefact as well as a scientific approach Added value • DS is captured in the “build and then evaluate” cycle • Focus on building artefacts and relegate evaluation to a subsequent ... Employees Year 2012 • usage of several thousands of applications and a huge IT-landscape • high demand on software architecture knowledge & management Leads to … Trang 5Background and motivationSiemens...

Ngày tải lên: 10/12/2016, 15:36

22 276 0
DSpace at VNU: Quantum theory of the absorption of a weak eletromagnetic wave by the free carriers in two dimensional electron system

DSpace at VNU: Quantum theory of the absorption of a weak eletromagnetic wave by the free carriers in two dimensional electron system

... expressions are numerically evaluated plotted and discussed for a specific 2 dimensional system (AlAs/GaAs/AlAs quantum well and n-GaAs/p-GaAs superlattice) 1 I n t r o d u c t i o n Recently, there has ... study the absorption coefficient of a weak E M W by free carriers confined in a 2 dimensional system (quantum wells and doped superlattices) in the case of the absence of a magnetic field and the ... th a t the Laplaces’s transformation of the time correla­ tion function (2) can be represented in the form of an infinite continued fraction One of advantages of this representation is th a t the...

Ngày tải lên: 11/12/2017, 22:40

15 155 0
Tài liệu Infrastructure Protection and Security Service Integration Design for the Next Generation WAN Edge v2.0 pptx

Tài liệu Infrastructure Protection and Security Service Integration Design for the Next Generation WAN Edge v2.0 pptx

... ! ! AAA Authentication commands: (request authentication via ! tacacs+ for both login and for enable level: aaa authentication login default group tacacs+ local enable aaa authentication enable ... cisco aaa-server TACACS+ protocol tacacs+ ! ! AAA Authentication commands: (request authentication via ! tacacs+ for both login and for enable level: aaa authentication enable console tacacs-group ... tacacs-group LOCAL aaa authentication ssh console tacacs-group LOCAL aaa authentication telnet console tacacs-group LOCAL ! if you are on an ASA Security Appliance you will need this additional command !...

Ngày tải lên: 24/01/2014, 10:20

184 751 0
Tìm hiểu Windows 2003 Auditing and Logging

Tìm hiểu Windows 2003 Auditing and Logging

... tra ghi Bạn nên xác định cách sau: a A successful local logon b A successful unlocking of the computer c A successful network logon d A failed local logon attempt e A failed network logon attempt ... Vào HKEY_LOCAL_MACHINE\SAM\SAM Nhấp chuột phải vào kh a SAM\SAM, chọn Permissions 5 Click vào nút Advanced, chọn Auditing tab Click Add button Trong Object Name text box, gõ Ordinary click OK ... WinLogon\MSGina – winlogon.exe and msgina.dll, giao diện chứng thực người dùng  SCMgr – Quản lý điều khiển dịch vụ  LAN Manager Workstation Service  Advapi – API gọi đến LogonUser  MS.RADIU – gói...

Ngày tải lên: 14/09/2012, 09:55

13 810 4
Tài liệu Firewalls and Logging doc

Tài liệu Firewalls and Logging doc

... regulations (such as Sarbanes-Oxley and the Health Insurance Portability and Accountability Act) The number of events and the amount of data that Security Manager can handle far exceed the capabilities ... provide a means of demonstrating that the logs have been unaltered and the data contained in the logs is accurate and adheres to the rules of chain of custody (for more information about the chain of ... database One of the advantages of this kind of logging system is the ability to then be able to build and issue custom queries against the data in the database, providing tremendous functionality...

Ngày tải lên: 21/01/2014, 02:20

10 329 0
w