speed of light in vacuum c

Báo cáo y học: "Serum cystatin C levels to predict serum concentration of digoxin in Japanese patients

Báo cáo y học: "Serum cystatin C levels to predict serum concentration of digoxin in Japanese patients

... Digoxin, Serum concentration, Heart failure, Renal clearance 1. Introduction Cystatin C (Cys -C) is a non-glycosylated cationic protein of 13.3 kDa, belonging to the cystatin superfamily of cysteine ... Okumura K. Factors influencing the prediction of steady state concentrations of digoxin. Biol Pharm Bull. 2001; 24(4):403–408. 22. Cockcroft DW, Gault MH. Prediction of creatinine clearance from ... level of Cys -C to diagnose a certain class of heart diseases, including heart failure, has recently been suggested based on the fact that the serum level of Cys -C, not of Cr, was higher in such...

Ngày tải lên: 31/10/2012, 17:08

5 525 0
MAKING A CHART OF THE ENERGY CONSUMPTION IN H.C.M. CITY

MAKING A CHART OF THE ENERGY CONSUMPTION IN H.C.M. CITY

... Q5 ACTION PLAN MAKING A CHART OF THE ENERGY CONSUMPTION IN H .C. M. CITY ACTIVITIES All Ss .in each group should do their real assignement to be able to collect the own amounts of the city ... duty Completing the group’s duty 7 7 Having the creative combination’s Having the creative combination’s ideas ideas +1 +1 Having plenty of properly Having plenty of properly illustrated pictures illustrated ... their charts in front of the class and share the best charts in front of the class and share the best way to the web site of the resources file of City way to the web site of the resources file...

Ngày tải lên: 22/07/2013, 01:27

8 406 0
Tài liệu Engineering Mechanics - StaticsChapter 1Problem 1-1 Represent each of the following combinations of units in the correct SI form using an appropriate prefix: (a) m/ms (b) μkm (c) ks/mg (d) km⋅ μN Units Used: μN = 10−6N kmμkm = 109−6Gs = 10 s pptx

Tài liệu Engineering Mechanics - StaticsChapter 1Problem 1-1 Represent each of the following combinations of units in the correct SI form using an appropriate prefix: (a) m/ms (b) μkm (c) ks/mg (d) km⋅ μN Units Used: μN = 10−6N kmμkm = 109−6Gs = 10 s pptx

... permission in writing from the publisher. Engineering Mechanics - Statics Chapter 2 Problem 2-15 Resolve the force F 1 into components acting along the u and v axes and determine the magnitudes of ... material may be reproduced, in any form or by any means, without permission in writing from the publisher. Engineering Mechanics - Statics Chapter 2 Since cos 180deg φ − () cos− φ () = , F R F 1 2 F 2 2 + ... by any means, without permission in writing from the publisher. Engineering Mechanics - Statics Chapter 2 Problem 2-24 Resolve the force F into components acting along (a) the x and y axes,...

Ngày tải lên: 17/02/2014, 14:20

1,1K 1,1K 2
Tài liệu Báo cáo khoa học: Dimers of light-harvesting complex 2 from Rhodobacter sphaeroides characterized in reconstituted 2D crystals with atomic force microscopy docx

Tài liệu Báo cáo khoa học: Dimers of light-harvesting complex 2 from Rhodobacter sphaeroides characterized in reconstituted 2D crystals with atomic force microscopy docx

... absence of a 3D crystallo- graphic structure, we assigned an intrinsic curvature to the LH2 of Rhodob. sphaeroides that could originate from a slight conical shape or speci c binding of a curved ... observed tilt of LH2’s within the square lattice was not due to an intrinsic property of LH2’s of Rhodop. acidophila, but was caused by speci c interactions induced by packing. In contrast, tilted ... square-packing lattices represent a less packed configuration, indicating that dense packing may induce the speci c interactions leading to zig-zagging LH2’s. The intermediate density of the dimer...

Ngày tải lên: 18/02/2014, 18:20

10 526 0
Tài liệu Báo cáo khoa học: Novel aggregate formation of a frame-shift mutant protein of tissue-nonspecific alkaline phosphatase is ascribed to three cysteine residues in the C-terminal extension pdf

Tài liệu Báo cáo khoa học: Novel aggregate formation of a frame-shift mutant protein of tissue-nonspecific alkaline phosphatase is ascribed to three cysteine residues in the C-terminal extension pdf

... Predicted amino acid sequence of TNSALP (1559delT). A single T deletion in the cDNA at nucleotide 1559 of tissue nonspe- ci c alkaline phosphatase (TNSALP) changes the amino acid sequence at leucine ... [ 35 S]methionine ⁄ cys- teine at 30 C for 90 min in the absence or presence of canine pancreatic microsomal membrane as described previ- ously [14]. Metabolic labelling and immunoprecipitation For ... SCF Fbs2 ubiquitin ligase com- plex, which specifically targets N-linked high-mannose- type oligosaccharide chains of glycoproteins [31]. The involvement of EDEM and ⁄ or SCF Fbs2 in the degrada- tion of TNSALP...

Ngày tải lên: 19/02/2014, 17:20

14 446 0
Tài liệu Báo cáo khoa học: Extended half-life upon binding of destabilized intrabodies allows specific detection of antigen in mammalian cells pdf

Tài liệu Báo cáo khoa học: Extended half-life upon binding of destabilized intrabodies allows specific detection of antigen in mammalian cells pdf

... 5¢-CTAGTCGTCCGAACTCCGATAATCGC CGTCAGGGCGGTCGCGAACGTTTAG-3¢ and 5¢-CA TGCCAAACGT TCGCGA CCGC CCTGAC GGCGAT TA TCGGAGTTCGGACA-3¢ into the unique SpeI restriction site. p13R4-DP was obtained by replacing the B10 tag of the p13R4 construct ... 5¢-ACTCATA CTAGTCTTAGCCATGGCTTCCCGCCG GCG-3¢ and 5¢-CCATCCGAATTCTCACTACACATTGAT CCTAGCA GAAGC-3¢ were used for the PCR amplification of the C- terminal region of d1-EGFP corresponding to the mouse ornithine decarboxylase ... sequence (amino acids 422–461 [18]). The B10 tag was subsequently added to the resulting plasmid by cloning the following annealed oligo- nucleotides 5¢-CTAGTCGTCCGAACTCCGATAATCGC CGTCAGGGCGGTCGCGAACGTTTAG-3¢...

Ngày tải lên: 19/02/2014, 18:20

14 484 0
Báo cáo khoa học: Glutamic acid residues in the C-terminal extension of small heat shock protein 25 are critical for structural and functional integrity pptx

Báo cáo khoa học: Glutamic acid residues in the C-terminal extension of small heat shock protein 25 are critical for structural and functional integrity pptx

... Protein precipitation was monitored by light scattering at 360 nm. Assays were performed in duplicate. The precipitation of 45 lm insulin from bovine pancreas in the presence of increasing concentrations ... on pro- teins that contain exposed clusters of hydrophobic ami- noacyl residues, resulting in an increase in fluorescence [39]. ANS binding fluorescence of wild-type and mutant Hsp25 reached a maximum ... activity [21]. Conversely, an increase in the charge of the extension of aA-crystallin results in no significant changes in chaperone activity relative to wild-type aA-crystallin [26,27], highlighting...

Ngày tải lên: 07/03/2014, 04:20

14 418 0
Báo cáo khoa học: The effect of replacing the axial methionine ligand with a lysine residue in cytochrome c-550 from Paracoccus versutus assessed by X-ray crystallography and unfolding ppt

Báo cáo khoa học: The effect of replacing the axial methionine ligand with a lysine residue in cytochrome c-550 from Paracoccus versutus assessed by X-ray crystallography and unfolding ppt

... slow folding in cytochrome. C Acc Chem Res 31, 737–744. 30 Shastry MCR, Sauder JM & Roder H (1998) Kinetic and structural analysis of submillisecond folding events in cytochrome. C Acc Chem Res ... structural changes being minimal the trapping of two main-chain confor- mations and increased B-factors at 295 K suggests that the presence of the coordinating Lys in some way can in uence the ... heme, sufficient movement of the loop containing the Met ligand connecting helices four and five must occur [19–22]. At present two X-ray struc- tures of cyts c 2 exist in which the coordinating Met- iron...

Ngày tải lên: 07/03/2014, 17:20

15 513 0
Báo cáo Y học: Identification of residues in the PXR ligand binding domain critical for species specific and constitutive activation docx

Báo cáo Y học: Identification of residues in the PXR ligand binding domain critical for species specific and constitutive activation docx

... I282Q (forward), 5¢-CAACGCCCAGCATACCCAGCAGT-3¢ for Q404H (forward), 5¢-CAACGCCCAGGCAACCCAG CAGT-3¢ for Q404A (forward), 5¢-TGAACCTCAGCT GGCACATCTA-3¢ for I282Q (reverse), 5¢-ACTGCTG GGTATGCTGGGCGT-3¢ for ... Q285I, 5¢-TCAATGCTCAGCAGACCCAGCGGC-3¢ for H407Q, 5¢-TCAATGCTCAGGCCACCCAGCG GC-3¢ for H407A. The selection restriction site mutation was created by primer 5¢-GTAGCTGACTGGAGCATG CAT-3¢ mutating a unique ... performed in C3 A cells (ATCC, CRL-10741, lot i 1414101) in 6-well plates. C3 A cells were seeded at a concentration of 5 · 10 5 cells in each well and incubated for 24 h at 37 °Cin2mLgrowth medium containing...

Ngày tải lên: 08/03/2014, 16:20

9 553 0
Báo cáo khoa học: Structural features in the C-terminal region of the Sinorhizobium meliloti RmInt1 group II intron-encoded protein contribute to its maturase and intron ppt

Báo cáo khoa học: Structural features in the C-terminal region of the Sinorhizobium meliloti RmInt1 group II intron-encoded protein contribute to its maturase and intron ppt

... (ssDNA70) was obtained by labeling 100 pmol of HPLC-purified primer WT (5¢-AATTGATCCCGCCCG CCTCGTTTTCATCGATGAGACCTGGACGAAGACGA ACATGGCGCCGCTGCGGGGC-3¢) using 50 lCi of [c- 32 P]ATP (3000 CiÆ mmol )1 ; ... extracts, consistent with the truncation affecting part of domain X. Inter- estingly, mutants with shorter C- terminal truncations (DC14 and DC21) displayed no detectable splicing activity in vivo. ... high-affinity binding site in subdomain DIVa of the intron, whereas other regions of the RT and domain X interact with con- served catalytic core regions [12]. Domain X is located in the position corresponding...

Ngày tải lên: 15/03/2014, 09:20

11 399 0
Quantification of vitamin e and ç oryzanol components in RiceGermandBran

Quantification of vitamin e and ç oryzanol components in RiceGermandBran

... spectrum of 7a could not be obtained in LC − MS/MS analysis because of its very low concentration in the dichloromethane fraction. Quantification of Vitamin E and γ -Oryzanol Components in Rice ... Biological effects of oxysterols: Current status. Food Chem. Toxicol. 1996, 34, 193-211. milling process. According to the information of Riceland Foods, Inc., rice germ is about 20% of full-fat ... monitored by comparing the UV and MS peak areas of IS to the LC-MS/MS analyses. Calibration curves of each standard were created from seven concentrations using Microsoft Excel software. The concentrations...

Ngày tải lên: 15/03/2014, 15:33

6 649 1
Báo cáo khoa học: New roles of flavoproteins in molecular cell biology: Blue-light active flavoproteins studied by electron paramagnetic resonance pptx

Báo cáo khoa học: New roles of flavoproteins in molecular cell biology: Blue-light active flavoproteins studied by electron paramagnetic resonance pptx

... physiologically relevant redox state or of the second so-called light- harvesting chromo- phore which is used to enhance the quantum yield of the photoreaction by increasing the extinction coefficient in ... determination in para- magnetic proteins and biomolecules [37,38]. In brief, using ENDOR spectroscopy, hyperfine couplings of a particular nucleus can be determined directly from pairs of resonance ... essential amino acids for 64PP repair is crucial for a thorough understanding of the light- independent catalytic steps preceding blue -light initiated enzymatic DNA repair, and the speci c structural...

Ngày tải lên: 16/03/2014, 02:20

14 385 0
Báo cáo khoa học: Effects on protease inhibition by modifying of helicase residues in hepatitis C virus nonstructural protein 3 pot

Báo cáo khoa học: Effects on protease inhibition by modifying of helicase residues in hepatitis C virus nonstructural protein 3 pot

... introduced side chain in uenced the charac- teristics of the enzyme. These results indicate that residues in the helicase domain of nonstructural protein 3 can in uence the protease, supporting our ... previously used gene construct for full-length HCV NS3 [9] were introduced by PCR using Q526A forward primer (5¢-TCCCGTGTGT GCAGACCATCTTGAAT-3¢), H528A forward primer (5¢-TCCCGTGTGTCAAGACGCTCTTGAAT-3¢) ... the functional importance of the helicase domain for the activity and inhibition of the protease, and have focused on the identification of speci c helicase resi- dues which may be involved. In the crystal...

Ngày tải lên: 16/03/2014, 06:20

8 311 0
Báo cáo khoa học: Arginine-induced conformational change in the c-ring ⁄a-subunit interface of ATP synthase ppt

Báo cáo khoa học: Arginine-induced conformational change in the c-ring ⁄a-subunit interface of ATP synthase ppt

... aN21 4C ⁄ cA6 2C +++ aN23 0C ⁄ cT6 7C +++ aN21 4C ⁄ cI6 3C ND aN23 0C ⁄ cG6 8C ± aN21 4C ⁄ cP6 4C ND aN23 0C ⁄ cI6 9C +++ aN21 4C ⁄ cM6 5C +++ aN23 0C ⁄ cY7 0C +++ aN21 4C ⁄ cI6 6C + aA23 3C ⁄ cI6 9C + aA21 7C ⁄ cM6 5C ... ± aA23 3C ⁄ cY7 0C +++ aA21 7C ⁄ cI6 6C ± aI23 7C ⁄ cV7 3C +++ aI22 1C ⁄ cG6 9C +++ aG23 9C ⁄ cL7 6C + aI22 3C ⁄ cL7 2C +++ aG23 9C ⁄ cI7 7C ± aI22 3C ⁄ cY7 3C ND aL24 0C ⁄ cL7 6C ++ aL22 4C ⁄ cL7 2C + aL24 0C ⁄ cI7 7C ... structural and functional knowledge of the c- ring. Characterization of the a ⁄ c interface by cysteine cross-linking experiments Cell membranes, containing combined cysteine substi- tutions in...

Ngày tải lên: 16/03/2014, 06:20

14 593 0

Bạn có muốn tìm thêm với từ khóa:

w