speaker recognition is a multi

Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf

Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf

... simultaneously engaged in mRNA decay in an ARE-mediated manner [45], suggesting that the pathway of mammalian ARE-mediated mRNA decay can be flexible Recently, an excellent database compiling ARE ... elucidated a mammalian 5¢- to 3¢ ARE decay pathway that is localized to P-bodies via an ARE interaction with tristetraprolin and BRF1 [41–44] However, both 5¢- to 3¢ and 3¢- to 5¢ pathways can be ... RPA, RNase protection analysis. Trang 2activator [5,6], it exists primarily as a nonglycosylatedintracellular protein Over the past decade, evidence has accumulated to suggest a role for PAI-2

Ngày tải lên: 16/02/2014, 09:20

14 636 0
Báo cáo hóa học: " A Posterior Union Model with Applications to Robust Speech and Speaker Recognition" pot

Báo cáo hóa học: " A Posterior Union Model with Applications to Robust Speech and Speaker Recognition" pot

... each speaker Trang 10Table 3: Speaker identification accuracy (%) using clean and noisy utterances with melody 1 noise, for matched (Mat), mismatched (Mis), and combined (Cmb) handset tests Table ... was also obtained for the new model in stationary band-selective noise The noise was addi-tive, and simulated by passing Gaussian white noise through a band-pass filter The central frequency and ... “con-tact” and “connect,” extracted from an Internet tool These noises each had a dominant band-selective nature, and the noises “contact” and “connect” were particularly nonstation-ary These noises

Ngày tải lên: 22/06/2014, 23:20

12 325 0
Báo cáo y học: "Eosinopenia is a reliable marker of sepsis on admission to medical intensive care units"

Báo cáo y học: "Eosinopenia is a reliable marker of sepsis on admission to medical intensive care units"

... 27 Aïssaoui Y, Zeggwagh AA, Zekraoui A, Abidi K, Abouqal R: Vali-dation of a behavioral pain scale in critically ill, sedated, and mechanically ventilated patients Anesth Analg 2005, 101:1470-1476. ... Trang 1Open AccessVol 12 No 2 Research Eosinopenia is a reliable marker of sepsis on admission to medical intensive care units Khalid Abidi1, Ibtissam Khoudri1, Jihane Belayachi1, Naoufel Madani1, ... the analyzer Cobas Integra (Roche Diagnostics, Mannheim, Germany) The limits of detection were 0.071 mg/dl Statistical analyses Data are presented as the mean ± standard deviation for vari-ables

Ngày tải lên: 25/10/2012, 10:35

10 599 0
Optimization of design and operating parameters on the year round performance of a multi-stage evacuated solar desalination system using transient mathematical analysis

Optimization of design and operating parameters on the year round performance of a multi-stage evacuated solar desalination system using transient mathematical analysis

... performance of a multi-stage evacuated solar desalination system using transient mathematical analysis P Vishwanath Kumar1, Ajay Kumar Kaviti1, Om Prakash1, K.S Reddy2 1 Department of Mechanical Engineering, ... steady-state and transient performance of a multi-stage stacked tray solar still A numerical modeling of a multi-stage solar still with an expansion nozzle and heat recovery for steady state ... performance and thermal characteristics of the system 2 Description of the multi-stage evacuated solar desalination system The Multi-stage evacuated solar desalination system is a combination of evaporative-condenser

Ngày tải lên: 05/09/2013, 16:11

26 572 0
Tài liệu How to build a Multi-Level Money Machine docx

Tài liệu How to build a Multi-Level Money Machine docx

... retails may not always break away, yet, breakaway qualifications must be achievable with a fair amount of effort by a serious business-builder A 3 x 5 Matrix means that everyone can have ... a pyramid infinite variations of legal and illegal marketing programs For that reason, multiOnly a few sophisticated states have... fifteen thousand dollars a month) that someone must maintain ... uneducated in this area and are... must be carefully determined based upon the number of products the company has and what a realistic average volume should be A small distributor who mainly

Ngày tải lên: 24/01/2014, 07:20

196 429 0
Tài liệu SALTER-HARRIS FRACTURE Alex Duckworth, MS4 What is a Salter-Harris fracture? Fracture through ppt

Tài liệu SALTER-HARRIS FRACTURE Alex Duckworth, MS4 What is a Salter-Harris fracture? Fracture through ppt

... Trang 1SALTER-HARRIS FRACTURE Alex Duckworth, MS4 Trang 2What is a Salter-Harris fracture?ƒ Fracture through growth plate in a pediatric Trang 3Anatomy of Long Bonesƒ Epiphysis distal to ... history of axial load ƒ Crush injury of growth plate, no damage to epiphysis or metaphysis ƒ Poor prognosis, almost inevitable growth disturbance ƒ Diagnosis difficult, often made after premature ... plate seen Trang 20Salter-Harris Type VeMedicine – Salter-Harris Fractures : Article by William Moore, MD http://www.hawaii.edu/medicine/pedi atrics/pemxray/v1c18.html Trang 21Salter-Harris

Ngày tải lên: 25/01/2014, 06:24

22 620 1
Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx

Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx

... SJ, Ward ER, Ryals JA & Dangl JL (1994) Arabidopsis mutants simulating disease resistance response Cell 77, 565–577 26 Takahashi A, Agrawal GK, Yamazaki M, Onosato K, Miyao A, Kawasaki T, ... gene as an internal standard PCRs were performed using the following primers: ACT2 (At3g18780): 5-ACATTGT AATGGA-3, OXI1 (At3g25250): 5-GACGAGATTATC AGATTTTACGC-3 and 5-AACTGGTGAAGCGGAAG AGAC-3, ... were cleared in ethanol and visualized with a stereomicro-scope (Leica MZ16FA) RNA isolation and real-time quantitative RT-PCR analysis RNA was isolated from seedlings according to manufac-turer’s

Ngày tải lên: 14/02/2014, 19:20

11 701 0
Tài liệu Báo cáo khoa học: Diol dehydratase-reactivating factor is a reactivase – evidence for multiple turnovers and subunit swapping with diol dehydratase pdf

Tài liệu Báo cáo khoa học: Diol dehydratase-reactivating factor is a reactivase – evidence for multiple turnovers and subunit swapping with diol dehydratase pdf

... reactivating factor while it exists as an active holoenzyme The glycerol dehydratase-reactivating factor reactivates the inacti-vated hologlycerol dehydratase in a similar manner Both dehydratase-reactivating ... forming a cavity  11 A˚ in height The size of this cavity is comparable with that of adenine-lacking cobalamins, and thus allows the damaged cofactor to pass through it Intact cofactor, an ade-nine-containing ... Biotechnology, Graduate School of Natural Science and Technology, Okayama University, Japan Keywords adenosylcobalamin; coenzyme B12; diol dehydratase; diol dehydratase-reactivating factor; reactivase Correspondence

Ngày tải lên: 15/02/2014, 01:20

13 622 0
Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf

Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf

... A600 A600 A600 Time (h) Fig 5 His41 is essential for Paracoc-cus pantotrophus NirF, but Asp129 is dis-pensable Growth plots and time courses of nitrite appearance and disappearance for P pantotrophus ... In addition, it has been dem-onstrated that a Paracoccus derivative strain, in which nirN is replaced with a kanamycin resistance cassette, still makes holo-cd1, which suggests that this last ... mutant that lacks NirF; this too is not trivial as the DnirF strain does not accumulate readily detectable amounts of an intermediate of d1synthesis Experimental procedures DNA manipulations DNA

Ngày tải lên: 15/02/2014, 01:20

12 617 0
Tài liệu Mental Health in a Multi-ethnic Society A Multi-disciplinary Handbook docx

Tài liệu Mental Health in a Multi-ethnic Society A Multi-disciplinary Handbook docx

... therapist with an interest in the psychologicaldevelopment of the Black child Amanda Webb-Johnson As a primary school teacher, Amanda had an interest in multicultural and anti-racist education and ... isrequired, but an evaluation of what mental health actually means as multi-a prmulti-acticmulti-al proposition Chapter 1 examines Western thinking about mental health andillness in a historical context, ... emphasises a need to deal with racisms ratherthan a single ahistorical racism also implicitly attacks thefashionable over-identification of race and ethnicity with tradition,allowing instead the

Ngày tải lên: 15/02/2014, 02:20

250 458 0
Tài liệu ECTS Users’ Guide: Europe Direct is a service to help you find answers to your questions about the European Union doc

Tài liệu ECTS Users’ Guide: Europe Direct is a service to help you find answers to your questions about the European Union doc

... outcomes-based qualifications frameworks, makes programmes and qualifications more transparent and facilitates the recognition of qualifications ECTS can be applied to all types of programmes, whatever ... that learners can have a record/ proof or confirmation of what they have achieved at each stage of their educational pathway Credit transfer in ECTS 4.4 From the key features: “Credits awarded ... within a particular programme within that institution or organisation The process of awarding credit to non-formal or informal learning has these three stages: Initial advice and guidance (what does

Ngày tải lên: 16/02/2014, 03:20

64 425 0
Tài liệu Báo cáo khoa học: Helicobacter pylori acidic stress response factor HP1286 is a YceI homolog with new binding specificity pdf

Tài liệu Báo cáo khoa học: Helicobacter pylori acidic stress response factor HP1286 is a YceI homolog with new binding specificity pdf

... to a Table 1 Statistics on data collection and refinement A wavelength of 0.8726 A ˚ was used Rotations of 1 were performed The Ramachan-dran plot was calculated using RAMPAGE X-ray data Cell ... twice; that is, if Ala25 of chain A is close to Asn77 of chain B, then Asn77 of chain A is close to Ala25 of chain B. AlaO–ArgND2 AsnOD1–HisNE2 Trp30 Arg42, Trp30, Arg76 Phe36 Phe142, Pro136, Asn135 ... protein cavity Residues that present at least one atom at a distance shorter than 4.0 A ˚ from the ligand are listed Distances were calculated using CONTACT [19]. Trang 6quite common in nature It is,

Ngày tải lên: 16/02/2014, 14:20

10 770 0
Tài liệu What is a PLC Starters pdf

Tài liệu What is a PLC Starters pdf

... physically exist They are simulated relays and are what enables a PLC to eliminate external relays There are also some special relays that are dedicated to performing only one task Some are always ... and the actual program we arealmost ready to start writing a program But first lets see how a relay actually works After all, the main purpose of a plc is to replace "real-world" relays ... initially Theladder diagram now looks like this: Notice also that we now gave each symbol (or instruction) an address This address sets aside a certain storage area in the PLCs data files so that

Ngày tải lên: 18/02/2014, 23:20

68 516 0
Tài liệu Báo cáo khoa học: Human Cdc45 is a proliferation-associated antigen pdf

Tài liệu Báo cáo khoa học: Human Cdc45 is a proliferation-associated antigen pdf

... for histologi-cal sections The antibody was tested on formalin-fixed paraffin-embedded normal human skin sections as well as on invasive-lobular mamma carcinoma and small cell bronchial carcinoma ... monocyte⁄ macrophage phenotype was also veri-fied by a Nitro Blue tetrazolium reduction assay Monocytes⁄ macrophages are able to generate reactive oxygen species and this burst activity can be visualized ... haematopoietic malignant K562 cells displayed morphological changes characteristic of mega-karyocytic differentiation Numerous cells were larger and adhered on plastic surfaces compared with parental suspension

Ngày tải lên: 19/02/2014, 00:20

16 506 0
Tài liệu Báo cáo khoa học: Cell surface nucleolin on developing muscle is a potential ligand for the axonal receptor protein tyrosine phosphatase-r ppt

Tài liệu Báo cáo khoa học: Cell surface nucleolin on developing muscle is a potential ligand for the axonal receptor protein tyrosine phosphatase-r ppt

... anti-placental alkaline phosphatase-agarose (anti-PLAP; Sigma) was packed into an FPLC column (Amersham Biosciences, Chalfont St Giles, UK) Purifica-tion of FN3d–AP was carried out using an AKTA ... predict that an anti-body raised to a sequence outside this domain might have little effect on the RAP assay signal This was tested with an antibody to nucleolin raised against amino acids 271–520 ... phosphatase catalytic domains; black dots, protease cleavage sites (B) SDS ⁄ PAGE separation of FN3d–AP purified from conditioned media using anti-placental alkaline phosphatase (PLAP) agarose (C)

Ngày tải lên: 19/02/2014, 05:20

14 673 0
Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx

Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx

... ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT ATAAGAATGCGGCCGCTCAGCTGTCACTCAGCCGCAGCAG ATAAGAATGCGGCCGCTCAGTCTGAGGTGATAACATTCCC ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGT ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGT ... ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGT ATAAGAATGCGGCCGCTCAGGGCTGCGTGGTCACAGAGGC ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGT ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGT ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGT ... GCGGGATCCCGTTTCCCAGCCTGTTGGGCCT AAACTGCAGAAGCTTGATTTTGAATTCTGT AAACTGCAGAAGCTTGATTTTGAATTCTGT GCGGGATCCCGGATGCTGGCAGCGTGGGTTGG ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT

Ngày tải lên: 19/02/2014, 05:20

14 517 0
Tài liệu Báo cáo khoa học: Cytochrome P450 Cyp4x1 is a major P450 protein in mouse brain doc

Tài liệu Báo cáo khoa học: Cytochrome P450 Cyp4x1 is a major P450 protein in mouse brain doc

... 4x1-12-pR, 5¢-AAACATAAATTTCGCCATTTCTCCTAG TAT-3¢ The full-length mouse cDNA was obtained with primers 4x1-f-pF, 5¢-ATGGAGGCCTCCTGGCTGGAG ACTCGTTGG-3¢ and 4x1-f-pR, 5¢-AAACATAAATTT CGCCATTTCTCCTAGTAT-3¢ ... function Experimental procedures Animals and tissue Human cardiovascular system and 12-lane multitissue nor-thern blots, human aorta cDNA library and RACE ready aorta cDNA were obtained from Clontech ... mid-way along the chain Northern blot analysis showed high level expression of the CYP4x1 RNA in brain and in aorta, and this was confirmed by analysis of the EST database; this showed significant

Ngày tải lên: 19/02/2014, 07:20

12 468 0
Tài liệu Báo cáo khóa học: A multi-protein complex containing cold shock domain (Y-box) and polypyrimidine tract binding proteins forms on the vascular endothelial growth factor mRNA Potential role in mRNA stabilization pptx

Tài liệu Báo cáo khóa học: A multi-protein complex containing cold shock domain (Y-box) and polypyrimidine tract binding proteins forms on the vascular endothelial growth factor mRNA Potential role in mRNA stabilization pptx

... mRNA stabilization; vascular endothelial growth factor VEGF is an essential regulator of angiogenesis that acts on vascular endothelial cells to induce proliferation and promote cell migration ... Molecular Biosciences, The University of Adelaide;3Department of Medicine, The University of Adelaide, North Terrace, Adelaide, South Australia, Australia Vascular endothelial growth factor (VEGF) is ... [34–37] mRNA stabilization Recent data suggests that PTB proteins may also play a role in this latter type of mRNA stabilization [62] Factors such as HuR and hnRNPL proteins, have been implicated in

Ngày tải lên: 19/02/2014, 12:20

13 604 0
Tài liệu Báo cáo khoa học: The RNA recognition motif, a plastic RNA-binding platform to regulate post-transcriptional gene expression ppt

Tài liệu Báo cáo khoa học: The RNA recognition motif, a plastic RNA-binding platform to regulate post-transcriptional gene expression ppt

... Oberstrass, S D Auweter and F H.-T Allain, unpublished results) are arranged in such a way that only distantly located RNA sequences of the same RNA can bind simultaneously to both RRMs These totally ... 2 and the linker region are observed In the case of PABP, the interdomain inter-actions are mediated through many salt bridges and van der Waals contacts between a2 and b4 of RRM 1 and b2and a1of ... theoretically able to bind RNA, as with the U2AF35–U2AF65[51], and the U2AF65–SF1 complexes [46] In this latter case, it was postulated that the partic-ular behavior of these RRM domains is due mainly

Ngày tải lên: 19/02/2014, 17:20

14 428 0
Tài liệu What is a high school worth?: A model of Australian private secondary school fees docx

Tài liệu What is a high school worth?: A model of Australian private secondary school fees docx

... (bas) It is a group of schools in Ballarat, that provides the basis for interschool sporting competition Ballarat and Clarendon College; Ballarat and Queens Anglican Grammar School; Ballarat ... program An alternative to either of these is the International Baccalaureate (IB) and a small number of schools, mainly private, offer the IB diploma Table reports some standard VCE statistics across ... English Attendance ICSEA Number of Teachers Number of Support Staff Read7 Write7 Spell7 Grammar7 Math7 School Associations: ASPV AGSV GV ACC ACOED BAS CAS Sandhurst EID GIS SIS Region: Cental East

Ngày tải lên: 20/02/2014, 19:20

24 511 0

Bạn có muốn tìm thêm với từ khóa:

w