is a risk factor for atherosclerosis and liver fibrosis

Is alcohol consumption a risk factor for prostate cancer? A systematic review and meta–analysis

Is alcohol consumption a risk factor for prostate cancer? A systematic review and meta–analysis

... key study characteristics and potential biases, in particular according to whether former and/ or occasional drinkers were misclassified as abstainers Unique among published meta-analyses [21–23, ... Jinhui Zhao1*, Tim Stockwell1,2, Audra Roemer1,2 and Tanya Chikritzhs3 Abstract Background: Research on a possible causal association between alcohol consumption and risk of prostate cancer is inconclusive ... Zhao et al BMC Cancer (2016) 16:845 DOI 10.1186/s12885-016-2891-z RESEARCH ARTICLE Open Access Is alcohol consumption a risk factor for prostate cancer? A systematic review and meta–analysis

Ngày tải lên: 20/09/2020, 18:34

13 19 0
báo cáo hóa học:" SimReg1 is a master switch for biosynthesis and export of simocyclinone D8 and its precursors" docx

báo cáo hóa học:" SimReg1 is a master switch for biosynthesis and export of simocyclinone D8 and its precursors" docx

... CCATGTAGGCGGTGACGA simA7F TAAAGCTTCAAAACGGGGTGAAC DNA-shift assay P A7 simA7R ATAAGCTTGTCGATACCGATCTTC PEx2F ACTTCCCAGAAGTA DNA-shift assay P Ex2 PEx2R AGAGGGCAGTAGAC PR3F TTTCTAGATGCACCCGATCCTC ... TAGAATTCCGCGGTTCGGCAGA simX5D3F TAGAATTCTGTACAAGGCCTGGT DNA-shift assay P D3 simX5D3R TAGAATTCGCGACAGGAGCCATA simEXX4F TAGAATTCGACGCCTTCCAGTC DNA-shift assay P X4 simEXX4R TAGAATTCTCAGAACATCGTCC SR2ExXF AAATCTAGATCAAGCCAGTGCTG ... SSR1R TTTGAATTCATTAATGGTGATGGT purification SR1D4F TAGAATTCGTGAGCAGATCATGT DNA-shift assay P D4 SR1D4R TAGAATTCCATTGTGAACCATC SD2R1F TAGAATTCATCGCCACGACCATG DNA-shift assay P R1 SD2R1R TAGAATTCCGCGGTTCGGCAGA

Ngày tải lên: 21/06/2014, 17:20

12 456 0
Báo cáo y học: "Matrin 3 is a co-factor for HIV-1 Rev in regulating post-transcriptional viral gene expressio" pptx

Báo cáo y học: "Matrin 3 is a co-factor for HIV-1 Rev in regulating post-transcriptional viral gene expressio" pptx

... 10 reading and commenting on the manuscript, and Barbara Felber for sharing several critical reagents. We are grateful to Anna Kula and Alessandro Marcello for sharing data in their paper prior ... (Clontech). Antibodies Mouse monoclonal anti-HA (Sigma Chemical); mouse monocl onal Matrin 3, (Abcam) and rabbit anti-GFP and anti-HA (Cell Sciences) are commercially available. Western Blotting, and ... mers for unspliced transcripts were Primer A 5′- GTCTCTCTGGTTAGACCAG-3′, Primer C 5′-CTAGT- CAAAATTTTTGGCGTACTC-3′ and primer A and sj4. 7A 5′- TTGGGAGGTGGGTTGCTTTGATAGAG-3 for spliced 2 Kb transcript.

Ngày tải lên: 13/08/2014, 01:21

10 318 0
Lanosterol is a survival factor for dopaminergic neurons

Lanosterol is a survival factor for dopaminergic neurons

... Phosphate buffer saline Phosphatidylcholine Parkinson’s Disease PTEN-induced putative kinase Polyunsaturated fatty acids Standard error of mean Substantia Nigras par compacta Substantia nigras par ... MPTP, and methamphetamine Ann N Y Acad Sci, 1053, 183-191 Wada, H., Yasuda, T., Miura, I., Watabe, K., Sawa, C., Kamijuku, H., Kojo, S., Taniguchi, M., Nishino, I., Wakana, S., Yoshida, H and Seino, ... membrane depolarization (Narendra et al., 2008), and regulates the clearance of damaged mitochondria by mitophagy in mammalian cell lines (Geisler et al., 201 0a) In addition, the translocation

Ngày tải lên: 10/09/2015, 15:52

102 399 0
Adult attachment style as a risk factor for maternal postnatal depression: A systematic review

Adult attachment style as a risk factor for maternal postnatal depression: A systematic review

... review Nasir Warfa1,3*, Melissa Harper1, Giampaolo Nicolais2 and Kamaldeep Bhui1 Abstract Background: Postnatal depression (PND) is an important health problem of global relevance for maternal health ... al 2008) and maternal neuroticism (Simpson et al 2003 and Van Bussel et al 2005) Risk factors associated with both PND symptoms and attachment style in the same study analysis were maternal anxiety ... inclusion and criteria, and were selected for the final review See Additional file for adapted PRISMA flowchart Data analysis The design of this review is a systematic review with narrative synthesis,

Ngày tải lên: 10/01/2020, 14:19

11 15 0
reconsidering depression as a risk factor for substance use disorder insights from rodent models

reconsidering depression as a risk factor for substance use disorder insights from rodent models

... Do an.Tai lieu Luan van Luan an Do an.Tai lieu Luan van Luan an Do an cocaine and methamphetamine, in animal models of depression, rather than systematically compiling and comparing literature ... Do an.Tai lieu Luan van Luan an Do an.Tai lieu Luan van Luan an Do an Table Psychostimulant self-administration and CPP-related-behaviors in adult rodents exposed to post-weaning social isolation ... Do an.Tai lieu Luan van Luan an Do an.Tai lieu Luan van Luan an Do an Table Psychostimulant self-administration and CPP-related-behaviors in adult rodents exposed to early life stress Strain

Ngày tải lên: 26/07/2023, 07:40

56 0 0
Obesity is a significant risk factor for breast cancer in Arab women

Obesity is a significant risk factor for breast cancer in Arab women

... Taher Al-Tweigeri2, Dahish Ajarim2, Ali Al-Zahrani14, Suad M Bin Amer3 and Abdelilah Aboussekhra3 Abstract Background: Breast cancer (BC) is the most common malignancy and the leading cause of cancer-related ... these factors for each population and geographical location, and to understand the reasons of the observed differences At present, there is no data available on the breast cancer risk factors for ... dietary habits, prior disease history, physical activity, tobacco and alcohol use, and family history of cancer Information on Page of 10 menstrual and reproductive history included age at menarche,

Ngày tải lên: 30/09/2020, 14:41

10 17 0
Wdr66 is a novel marker for risk stratification and involved in epithelial-mesenchymal transition of esophageal squamous cell carcinoma

Wdr66 is a novel marker for risk stratification and involved in epithelial-mesenchymal transition of esophageal squamous cell carcinoma

... Statistical analysis Statistical analysis was done using GraphPad Prism version for Windows (GraphPad Software) and SPSS version 13 for Windows (SPSS, Chicago, IL, USA) as follows: GraphPad Prism, ... protocols and a G2565AA Microarray Scanner (Agilent, Santa Clara, CA) Raw expression values were determined using Feature Extraction 9.0 software (Agilent, Santa Clara, CA) Western blotting analysis ... microarray analysis Microarray analysis was performed on 18 healthy normal esophageal epithelium (NE) and 10 esophageal squamous cell carcinoma (ESCC) samples Gene expression is presented as normalized

Ngày tải lên: 05/11/2020, 07:27

10 24 0
Benign prostatic hyperplasia is a significant risk factor for bladder cancer in diabetic patients: A population-based cohort study using the National Health Insurance in Taiwan

Benign prostatic hyperplasia is a significant risk factor for bladder cancer in diabetic patients: A population-based cohort study using the National Health Insurance in Taiwan

... with a diagnosis of diabetes may have a significantly 3-fold and 2.3-fold higher risk of BPH, respectively [14] Actually, type diabetes and BPH share several common risk factors including aging, ... institute approved, as per local regulations, for handling the NHI reimbursement databases for academic research The databases contain detailed records on every visit for each patient, including outpatient ... population-based cohort study using the National Health Insurance in Taiwan Chin-Hsiao Tseng1,2,3 Abstract Background: Diabetic patients have a higher risk of bladder cancer and benign prostatic

Ngày tải lên: 05/11/2020, 08:16

10 26 0
Báo cáo khoa học: Syndecan-4 is a signaling molecule for stromal cell-derived factor-1 (SDF-1)/ CXCL12 pptx

Báo cáo khoa học: Syndecan-4 is a signaling molecule for stromal cell-derived factor-1 (SDF-1)/ CXCL12 pptx

... Glycan and glycosaminoglycan binding properties of stromal cell-derived factor (SDF) -1alpha Glycobiology 10, 21– 29 34 Valenzuela-Fernandez A, Palanche T, Amara A, Magerus A, Altmeyer R, Delaunay ... ligand for LESTR ⁄ fusin and prevents infection by T-cell-line-adapted HIV-1 Nature 382, 833–835 1950 N Charnaux et al Pablos JL, Amara A, Bouloc A, Santiago B, Caruz A, Galindo M, Delaunay T, ... molecular mass distribution on SDS ⁄ PAGE Using the respective specific Abs, glycanated PGs migrate as follows: SD-4 as a 100–250 kDa broad smear, SD-1 as a single 98 kDa band, CD44 as a 110 kDa band,

Ngày tải lên: 16/03/2014, 18:20

15 423 0
Báo cáo khoa học: Combining theoretical analysis and experimental data generation reveals IRF9 as a crucial factor for accelerating interferon a-induced early antiviral signalling pdf

Báo cáo khoa học: Combining theoretical analysis and experimental data generation reveals IRF9 as a crucial factor for accelerating interferon a-induced early antiviral signalling pdf

... estimate distributions obtained for each gene on each array when performing RMA analysis Normalization ensures that the median standard error across all arrays is for each gene Problematic chips are ... theoretical analysis and experimental data generation reveals IRF9 as a crucial factor for accelerating interferon a- induced early antiviral signalling Tim Maiwald1,*, Annette Schneider2,*, Hauke ... signaling through a novel mechanism involving nuclear accumulation of interferon regulatory factor J Virol 83, 2178–2187 Nakao K, Nakata K, Yamashita M, Tamada Y, Hamasaki K, Ishikawa H, Kato

Ngày tải lên: 23/03/2014, 03:20

14 434 0
HEPATOCYTE GROWTH FACTOR IS a MAJOR CYTOKINE FOR NSC HOMING TO GLIOMA

HEPATOCYTE GROWTH FACTOR IS a MAJOR CYTOKINE FOR NSC HOMING TO GLIOMA

... alpha4-integrin and SDF-1alpha-dependent mechanisms. Cancer Biol Ther, 2004. 3(9): p. 838-44. Erlandsson, A. , J. Larsson, and K. Forsberg-Nilsson, Stem cell factor is a chemoattractant and a survival factor ... was found that Il-6 and. .. barrier provides an additional advantage in treating CNS related cancer [33] Researchers have been using NSCs as a cellular agent to carry transgenic products and ... neural stem cells. J Anat, 2010. 217(3): p. 203-13. Malatesta, P., I. Appolloni, and F. Calzolari, Radial glia and neural stem cells. Cell Tissue Res, 2008. 331(1): p. 165-78. Farkas, L.M. and

Ngày tải lên: 09/09/2015, 08:17

128 215 0
def (digestive organ expansion factor) is a crucial gene for the development of endoderm derived organs in zebrafish (danio rerio

def (digestive organ expansion factor) is a crucial gene for the development of endoderm derived organs in zebrafish (danio rerio

... medaka fish, and its transposition in the zebrafish germ lineage. Proc Natl Acad Sci U S A 97, 1140311408. Kawakami, K., Takeda, H., Kawakami, N., Kobayashi, M., Matsuda, N., and Mishina, M. (2004). ... and Handa, H. (2002). YEAF1/RYBP and YAF-2 are functionally distinct members of a cofactor family for the YY1 and E4TF1/hGABP transcription factors. J Biol Chem 277, 22484-22490. 180 Schlisio, ... the major pathway of beta-cell formation in the pancreas. Development 127, 5533-5540. Sawa, C., Yoshikawa, T., Matsuda-Suzuki, F., Delehouzee, S., Goto, M., Watanabe, H., Sawada, J., Kataoka, K.,

Ngày tải lên: 11/09/2015, 16:06

199 302 0
Parental military deployment as risk factor for children’s mental health: a meta-analytical review

Parental military deployment as risk factor for children’s mental health: a meta-analytical review

... sizes in random-effect models and were calculated separately for the relation between parental deployment and civilian/normative data and for the relation between parental deployment and non-deployment ... health data were captured As the data for the same individual cannot be included in a meta-analysis more than once, in studies where there was more than one informant available for the same sample, ... meta-analysis aimed to systematically assess the association between military deploy‑ ment of (at least one) parent and impact on children’s mental health For this meta-analytic review, publications

Ngày tải lên: 10/01/2020, 12:59

10 37 0
Perineural invasion as a prognostic factor for intrahepatic cholangiocarcinoma after curative resection and a potential indication for postoperative chemotherapy: A retrospective cohort

Perineural invasion as a prognostic factor for intrahepatic cholangiocarcinoma after curative resection and a potential indication for postoperative chemotherapy: A retrospective cohort

... Not applicable Availability of data and materials All data generated or analyzed during this study are included in this published article Ethics approval and consent to participate The study was ... aminotransferase, AST Aspartate aminotransferase, PLT Blood platelet, CEA Carcinoembryonic antigen Zhang et al BMC Cancer (2020) 20:270 Page of 11 Table Univariate and multivariate analysis for ... expressed as frequency (percentage) and analyzed using Chi-square or Fisher exact test as appropriate Kaplan-Meier (K-M) curves was used for survival analyses, and log-rank test was applied to analyze

Ngày tải lên: 17/06/2020, 11:39

11 27 0
Nutritional status according to the mini nutritional assessment (MNA)® as potential prognostic factor for health and treatment outcomes in patients with cancer – a systematic review

Nutritional status according to the mini nutritional assessment (MNA)® as potential prognostic factor for health and treatment outcomes in patients with cancer – a systematic review

... Extermann 2012 Frasca 2018 Ghosn 2017 Giannotti 2019 Giannousi 2012 Gioulbasanis NL Aaldriks 2016 Araujo 2017 NL Aaldriks 2015 Canada NL Aaldriks 2013b France NL Aaldriks 201 3a Aparicio 2018 NL Aaldriks ... Torbahn et al BMC Cancer (2020) 20:594 Availability of data and materials Data sharing is not applicable to this article as no datasets were generated or analysed during the current study Page ... Lee Y, Katsura M, Tada M, et al Evaluating progression-free survival as a surrogate outcome for health-related quality of life in oncology: a systematic review and quantitative analysis JAMA Intern

Ngày tải lên: 03/07/2020, 02:54

18 50 0
Combination of Helicobacter pylori infection and the interleukin 8 –251 T > A polymorphism, but not the mannosebinding lectin 2 codon 54 G > A polymorphism, might be a risk factor of

Combination of Helicobacter pylori infection and the interleukin 8 –251 T > A polymorphism, but not the mannosebinding lectin 2 codon 54 G > A polymorphism, might be a risk factor of

... and controls (n = 3810) from Asian (Korea, Japan, and China), and Caucasian (Poland, Finland, and Portugal) populations [13–23], and analyzed GC risk according to IL-8 -251 T > A genotype Statistical ... Statistical analysis Data are expressed as mean values ± standard deviations or as frequencies and percentages Chi-squared and Kruskal–Wallis tests were performed to compare clinical parameters ... infection and the risk of gastroduodenal diseases using the SAS statistical software package version 9.4 (SAS Institute Inc.) All clinical parameters with a p value A polymorphism and the risk of gastroduodenal

Ngày tải lên: 06/08/2020, 07:21

11 27 0
Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf

Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf

... Fujita H, Yamanaka M, Imamura K, Tanaka Y, Nara A, Yoshimori T, Yokota S & Himeno M (2003) A dominant negative form of the AAA ATPase SKD1 ⁄ VPS4 impairs membrane trafficking out of endosomal ... D, Uchimura S, Nara A, Yoshimori T, Hayashizaki Y, Kawai J, Ishidoh K et al. (2004) Mammalian class E Vps proteins, SBP1 and mVps2 ⁄ CHMP 2A, interact with and regulate the function of an AAA-ATPase SKD1 ... the meiotic clade of AAA ATPases Parimala R. Vajjhala 1,2 , Chau H. Nguyen 1,2 , Michael J. Landsberg 1 , Carol Kistler 1,2 , Ai-Lin Gan 1,2 , Glenn F. King 1 , Ben Hankamer 1 and Alan L. Munn 1,2,3,4 1...

Ngày tải lên: 07/03/2014, 05:20

23 493 0
Tài liệu Báo cáo khoa học: Diol dehydratase-reactivating factor is a reactivase – evidence for multiple turnovers and subunit swapping with diol dehydratase pdf

Tài liệu Báo cáo khoa học: Diol dehydratase-reactivating factor is a reactivase – evidence for multiple turnovers and subunit swapping with diol dehydratase pdf

... glycerol dehydratase-reactivating factor reactivates the inacti- vated hologlycerol dehydratase in a similar manner. Both dehydratase-reactivating factors exist as a 2 b 2 heterotetramers [a, DdrA or GdrA ... Mechanism of action of adenosylcobalamin: glycerol and other substrate analogues as substrates and inactivators for propanediol dehydratase – kinetics, stereospecificity, and mechanism. Biochemistry ... biochemical evidence for this has been obtained so far. A similar reactivating factor for ethanolamine ammonia lyase has been reported [26]. It has also been reported that a protein named E 2 activates...

Ngày tải lên: 15/02/2014, 01:20

13 622 0
Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C ppt

Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C ppt

... x Information about health disparities related to hepatitis B and hepatitis C. To increase knowledge and awareness about hepatitis B and hepatitis C in at -risk populations and the general population, ... hepatitis B screening and related services to this high -risk population. There is a pervasive lack of knowledge about hepatitis B among Asians and Pacific Islanders, and this is probably also ... anti-HCV Hepatitis C antibody API Asian and Pacific Islander AST Aspartate transaminase AVHPC Adult viral hepatitis prevention coordinators CDC Centers for Disease Control and Prevention...

Ngày tải lên: 06/03/2014, 01:20

191 458 0

Bạn có muốn tìm thêm với từ khóa:

w