platform is a new development

The small GTPASE   ARF like protein 1 (ARL1) is a new regulator of golgi structure and function

The small GTPASE ARF like protein 1 (ARL1) is a new regulator of golgi structure and function

... Takai et al., 20 01; Nie et al., 2003) Previous work done on ARF1 ... human Arl5 human Arl8 human Arl8 human Arl4 human Arl4 human Arl7 human Arl7 human Arl4L human Arl4L human Arl6 human Arl2 ... small G protein Ras Rho ARF ClassI :ARF1 , ARF2 , ARF3 ClassII: ARF4 , ARF5 Rab ARF Arl Arl1, Arl2, Arl3, Arl4, Arl5, Arl6, Arl7, ARFRP1, ARD1 ClassIII: ARF6 Fig 1 Classification ... ARF4 human ARF4 human ARF5 human ARF5 human ARF6 human ARF6 rat Arl1 rat Arl1 human Arl5... Golgin-97 and Golgin-245 from the Golgi apparatus xiv Abbreviations: ACAP ARF GAP with coiled-coil,

Ngày tải lên: 17/09/2015, 17:20

184 303 0
Small nucleolar RNA U91 is a new internal control for accurate microRNAs quantification in pancreatic cancer

Small nucleolar RNA U91 is a new internal control for accurate microRNAs quantification in pancreatic cancer

... GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGAT ACGACTCAACA miR-96 GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGAT ACGACAGCAAAAATGTG miR-148a GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGAT ACGACAGTCGGAG miR-155 GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGAT ... GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGAT ACGACACCCCTATCACG miR-196a GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGAT ACGACCCCAACAACATG miR-217 GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGAT ACGACTCCAATCAGTTC primer Artificial ... GCGGCGGCGCAAGGATGACACG U91 snoRNA GCGGCGGTGGCCGATGATGACG miR-16 GCGGCGGTAGCAGCACGTAAAT mir-21 GCGGCGGTAGCTTATCAGACTG miR-96 GCGGCGGTTTGGCACTAGCAC miR-148a GCGGCGGAAAGTTCTGAGACACTCC miR-155 GCGGCGGTTAATGCTAATCGTG

Ngày tải lên: 23/09/2020, 00:04

10 20 0
UCITS Hedge Platform Survey 2012: Building routes to a new investment market place pdf

UCITS Hedge Platform Survey 2012: Building routes to a new investment market place pdf

... seal of approval now extends to investors in the Middle East, Asia and Latin America. This is attracting the attention of alternative fund managers, notably in America and some emerging markets. “In ... base may prove to be very attractive. A soon-to-launch UCITS platform from Prodigy Capital Partners is aiming to address this market. Prodigy is awaiting regulatory approval for an umbrella ... phases. As a specialist in structuring there is a significant legal/set-up team, a risk team and an operations team to handle pre-trade and post-trade controls. The team’s scale will be a big

Ngày tải lên: 23/03/2014, 12:21

17 565 0
Báo cáo Y học: A new siglec family member, siglec-10, is expressed in cells of the immune system and has signaling properties similar to CD33 docx

Báo cáo Y học: A new siglec family member, siglec-10, is expressed in cells of the immune system and has signaling properties similar to CD33 docx

... followed by a wash with 0.1  NaCl/Cit containing 0.1% SDS at 50 8C An image was acquired using a PhosphorImager 445 SI (Molecular Dynamics, Sunnyvale, CA, USA) Chromosomal localization The human chromosomal ... preparations (PBMC), a secondary phosphatidylethanolamine-conjugated antibody was used to distinguish subpopulations The percentage of total cells with increased fluorescence is indicated Data ... B-cells that were generated within Bristol – Myers Squibb by standard transformation methods B-cell lymphoblastomas Ramos, Raji, Daudi and HSB-2, a T-cell lymphoblastoma Jurkat, a erythroblastic

Ngày tải lên: 24/03/2014, 04:21

14 541 0
Báo cáo khoa học: A new highly toxic protein isolated from the death cap Amanita phalloides is an L-amino acid oxidase pdf

Báo cáo khoa học: A new highly toxic protein isolated from the death cap Amanita phalloides is an L-amino acid oxidase pdf

... they were added at Statistical analysis All experiments were repeated at least three times with minimum three parallels The standard deviation was calculated, and the statistical significance of ... (2009) Purification and character-ization of a new L-amino acid oxidase from Daboia 22 Zhang L & Wu WT (2008) Isolation and characteriza-tion of ACTX-6: a cytotoxic l-amino acid oxidase from 554–563 ... hemolytic Table 1 Toxophallin is L -amino acid oxidase Different amino acids were studied as toxophallin substrates using an amine oxidase enzymatic activity assay, as described in the Materials and

Ngày tải lên: 29/03/2014, 08:20

10 480 0
Báo cáo khoa học: A new pathway encompassing calpain 3 and its newly identified substrate cardiac ankyrin repeat protein is involved in the regulation of the nuclear factor-jB pathway in skeletal muscle pdf

Báo cáo khoa học: A new pathway encompassing calpain 3 and its newly identified substrate cardiac ankyrin repeat protein is involved in the regulation of the nuclear factor-jB pathway in skeletal muscle pdf

... CACCATGATGGTACTGAGAG GAATGTAGCTATGCGAGAGTTC 30 to 319 CACCATGGCCGAGTTCAGAAATGGAGAAG GAATGTAGCTATGCGAGAGTTC 71 to 319 CACCATGCTGAAGACACTTCCGGCCAACAG GAATGTAGCTATGCGAGAGTTC 102 to 319 CACCATGCTGAAAGCTGCGCTGGAGAAC ... CGCCATGGCAATGATGGTACTGAAAGTAGAGG CGGCCCGGGAACTGATTAAGAGTCTGTCG pGAD-DNter2 CARP from 71 to 319 GAGCCATGGAACAACGGAAAAGCGAGAAAC CGGCCCGGGAACTGATTAAGAGTCTGTCG pYFP-CARP-CFP-HIS Full-length CARP 1–319 CACCATGATGGTACTGAGAG ... 319 CACCATGCTGAAAGCTGCGCTGGAGAAC GAATGTAGCTATGCGAGAGTTC 124 to 319 CACCATGACCAAAGTTCCAGTTGTGAAGG GAATGTAGCTATGCGAGAGTTC 1 to 70 CACCATGATGGTACTGAGAG GAATGTAGCTATGCGAGAGTTC

Ngày tải lên: 29/03/2014, 21:20

16 462 0
Báo cáo khoa học: A new sulfurtransferase from the hyperthermophilic bacterium Aquifex aeolicus Being single is not so simple when temperature gets high potx

Báo cáo khoa học: A new sulfurtransferase from the hyperthermophilic bacterium Aquifex aeolicus Being single is not so simple when temperature gets high potx

... codons for panD and aq477, they appear to be organized as an operon panD encodes an aspartate decarboxylase which cata-lyses the decarboxilation of aspartate to produce b-alanine, a precursor ... three major evolutionary phyla We characterized a new single-domain rhodanese with a thiosulfate : cyanide transferase activity, Aq-477 Aq-477 can also use tetrathionate and polysulfide Thermoactivity ... widespread enzymes that catalyse the transfer of a sulfane sulfur Thiosulfate is generally used as a substrate for rhodaneses in vitro assays, and cyanide is used as a sulfur acceptor to regenerate

Ngày tải lên: 30/03/2014, 03:20

16 445 0
Báo cáo khoa học nông nghiệp " Classical Swine Fever (CSF): Development of a new classical swine fever vaccine - Milestone 7" pot

Báo cáo khoa học nông nghiệp " Classical Swine Fever (CSF): Development of a new classical swine fever vaccine - Milestone 7" pot

... Diagnostic Virologist, Supervisor Mammalian Virology, AAHL Organisation: AAHL, PMB 24, Geelong, VIC 3220, Australia Email: chris.morrissy@csiro.au In Australia: Administrative Contact Organisation: ... for vaccine production in experimental animals at NAVETCO was used as the parental virus for subsequent adaptation and growth in cell culture As related earlier, preliminary research at AAHL had ... virus-specific labelling as shown in Attachment 1 Of particular significance, the successful adaptation following serial passage in PK-15 at NAVETCO was accompanied by a marked and progressive increase in

Ngày tải lên: 21/06/2014, 05:20

10 427 0
Báo cáo khoa học: "Development and Evaluation of a New Apparatus for Continuous Perfusion of Isolated Perfused Pig Heart" ppt

Báo cáo khoa học: "Development and Evaluation of a New Apparatus for Continuous Perfusion of Isolated Perfused Pig Heart" ppt

... Scientific, Avantec Inc., A: An’s Cannula B: Casali’s cannula Fig 1 The new coronary cannula maded for this study (A: An’s Cannula) and the coronary cannula used in the work of Casali et al (B: Casali’s ... coronary arteries were separated, and a ligature material placed around as near as their ostia The coronary cannula are inserted and fixed into the coronary arteries In both groups, the latex balloon ... stimulateur cardiaque (Medtronic, Michigan, U.S.A.) set at 110beats/minute in 20mA In the control isolated hearts, the attachment of aorta and pulmonary artery is separated Two coronary arteries

Ngày tải lên: 07/08/2014, 15:20

14 432 0
Báo cáo y học: "Looking through the ''''window of opportunity'''': is there a new paradigm of podiatry care on the horizon in early rheumatoid arthritis" pot

Báo cáo y học: "Looking through the ''''window of opportunity'''': is there a new paradigm of podiatry care on the horizon in early rheumatoid arthritis" pot

... application of specialist skills to manage localised, residual disease activity and associated functional impairments. Here we describe a new paradigm of podiatry care in early RA. This is driven by ... indicates that it is difficult to justify delay in treating inflammatory disease once it is recognised. Foot involvement in early RA Small joint arthritis is a hallmark feature of early RA and ... of refer- ral routes with an initial diagnosis of mechanically- related metatarsalgia. The algorithm is easy to under- stand and apply and should be widely disseminated among podiatrists. Therefore,

Ngày tải lên: 10/08/2014, 21:24

10 388 0
Renewable energy is a challenge, but also an opportunity for new industries, employment, and new ways to reduce dependency on fuel imports, provide electricity to poor remote areas, reduce air pollution

Renewable energy is a challenge, but also an opportunity for new industries, employment, and new ways to reduce dependency on fuel imports, provide electricity to poor remote areas, reduce air pollution

... Thailand) and Sajjakunukit, B (DEDE, Thailand), 2006   147 Renewable Energy Developments and Potential in the Greater Mekong Subregion About the Asian Development Bank ADB’s vision is an Asia and ... province-by-province basis for Cambodia, the Lao PDR, Myanmar, Thailand and Viet Nam, in each case showing the theoretical energy potential for their main agricultural residues The data is available upon ... Papong et al (2004), B Sajjakulnukit et al (2005), and O Akgün et al (2011), as well as from data for Thailand and Lao PDR Where country-specific data were not available, such as for Cambodia,

Ngày tải lên: 08/09/2015, 23:32

168 636 0
Development a new equation of polarization curve for a proton exchange membrane fuel cell at different channel geometry

Development a new equation of polarization curve for a proton exchange membrane fuel cell at different channel geometry

... cell at different channel geometry I Khazaee Department of Mechanical Engineering, Torbat-e-jam branch, Islamic Azad University, Torbat-e-jam, Iran Abstract The polarization curve of a proton ... rectangular, elliptical and triangular have constructed The active area of each cell is 25cm2 that its weight is 1300gr The material of the gas diffusion layer is Carbon clothes, the membrane is nafion112 ... is in A/cm2, temperatures are in ºC and Z=1 for elliptical channel and Z=2 for triangular channel and Z=3 for rectangular channel that this parameter is only in concentration loss that it can be

Ngày tải lên: 09/09/2015, 10:32

10 300 0
Development of a new elastic path controller for the collaborative wheelchair assistant

Development of a new elastic path controller for the collaborative wheelchair assistant

... approaching perfor-mance, and that the feedback force is an effective tool to assist in the obstacle avoidanceespecially when vision feedback is not available for the users Trang 11List of Tables3.1 ... thegoal is not attainable at this level, the deliberative planner is stimulated again to renewthe path scheduling based on the current world models Trang 32repre-ATLANTIS (A Three-Layer Architecture ... Shortest distance between the circular obstacle and the CWA 110 Trang 16ACK Acknowledgment ARE Algebraic Riccati Equation CM Constrained Mode CVT Continuously Variable Transmission CWA Collaborative

Ngày tải lên: 11/09/2015, 09:59

160 313 0
def (digestive organ expansion factor) is a crucial gene for the development of endoderm derived organs in zebrafish (danio rerio

def (digestive organ expansion factor) is a crucial gene for the development of endoderm derived organs in zebrafish (danio rerio

... developmental studies in vertebrate Zebrafish has many advantages over other vertebrate organisms Firstly, rapid external development makes translucent embryos available for visual analysis of tissue ... serves as a tissue for haematopoiesis during gestation, the vascular development in liver is essential Angioblasts, precursors of endothelial cells, start to appear near the hepatoblasts at the stage ... Overview of pancreas development 10 1.1.4.3 Regulation of pancreas development by signals and factors 11 1.2 Zebrafish as a good model organism 12 1.2.1 General advantages of zebrafish 13 1.2.2

Ngày tải lên: 11/09/2015, 16:06

199 302 0
Hyperscsi  design and development of a new protocol for storage networking

Hyperscsi design and development of a new protocol for storage networking

... a burden for higher layer to provide connection and data reliability mechanism A UDP datagram has a header and a payload The application data is carried as payload and the header... ... Foo Siang Fook, Prashant Agrawal, Chava Vijaya Saradhi, and Qiu Qiang. Without these people’s effort, this thesis would not have been possible. I would also like to thank the Data Storage Institute, ... grown at an amazing speed The amount of data stored is at least doubling every year [1, 2] It is estimated that 5 exabytes of new information was generated in 2002 alone [4] Traditionally,

Ngày tải lên: 16/09/2015, 15:54

169 517 0
The research is a sure-fire solution to apply on realistic condition due to its feasibility and low cost for a development of sustainable agriculture in Vietnam as the top aims of Sony Green competition

The research is a sure-fire solution to apply on realistic condition due to its feasibility and low cost for a development of sustainable agriculture in Vietnam as the top aims of Sony Green competition

... Blyxa aubertii Eichhornia crassipes Aquatic plant Wolfia arrhiga live drift Pistia stratiotes Salvinia spp Typha spp Aquatic plant Scirpus spp live float Phragmites communis ... equation by time and growing capability Ludwigia in waste water - Stage III: Analyse data and conclude the waste treatment capability of Ludwigia 4.2.2 Material – Means of study + Ludwigia ... Reticule Alga Anaerated pond Composting Ventilation Aerated pond Feces Reserve pond Aquatic plant Trang 16Figure: Aerated pond for waste treatment by aquatic plant – Water hyacinth in slaughterhouse

Ngày tải lên: 15/01/2016, 16:17

16 520 0
Reserve Recruiting and the College Market - Is a New Educational Benefit Needed doc

Reserve Recruiting and the College Market - Is a New Educational Benefit Needed doc

... principal component is a linear combination of the original standardized ( µ = 0, σ = 1) variables (in this case, the four ASVAB components listed above) that maximizes the variance of that combination ... at james_hosek@rand.org; by phone at 310-393-0411, extension 7183; or by mail at the RAND Corporation, 1776 Main Street, Santa Monica, California 90407-2138. More information about RAND is available at www.rand.org. - ... instead took a more qualitative and descriptive approach to this preliminary evaluation. We began by reexamining how changes in the demand for college among youth in general, and reservists in particular,...

Ngày tải lên: 23/03/2014, 02:20

97 271 0
Tài liệu Báo cáo khoa học: Helicobacter pylori acidic stress response factor HP1286 is a YceI homolog with new binding specificity pdf

Tài liệu Báo cáo khoa học: Helicobacter pylori acidic stress response factor HP1286 is a YceI homolog with new binding specificity pdf

... diffracts to a Table 1. Statistics on data collection and refinement. A wavelength of 0.8726 A ˚ was used. Rotations of 1° were performed. The Ramachan- dran plot was calculated using RAMPAGE. X-ray ... same time, erucamide is a contaminant of plastic materials, and is used, in particular, as a slip agent in polyethylene films [25]. As neither erucamide nor any other long-chain fatty acid or amide ... the protein cavity. Residues that present at least one atom at a distance shorter than 4.0 A ˚ from the ligand are listed. Distances were calculated using CONTACT [19]. Protein residue Ligand atom Val29...

Ngày tải lên: 16/02/2014, 14:20

10 770 0
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

... primers: LTA-1F, 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA- 1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ ... organ-specific blood vascular and lymphatic endothelial cells of the mouse Takashi Yamaguchi, Taeko Ichise, Osamu Iwata, Akiko Hori, Tomomi Adachi, Masaru Nakamura, Nobuaki Yoshida and Hirotake ... Minneapolis, MN, USA), anti-Prox-1 (Acris Antibodies, Hiddenhausen, Germany), and anti-SV40 T Ag (Santa Cruz Biotechnol- ogy, Santa Cruz, CA, USA). The corresponding secondary antibodies labeled...

Ngày tải lên: 18/02/2014, 17:20

11 875 0
Tài liệu A New Paradigm for Economic Development docx

Tài liệu A New Paradigm for Economic Development docx

... really see the company as a client,” said Kaiser. Cabela’s went public in 2004, and it’s still in Sidney. Biomanufacturing and North Carolina One Tuesday in January, Winnell Newman was having a ... behalf of rural parts of the state. Its Urban Research and Outreach/Engagement Center weaves together research and public engagement, and is based on an in - terdisciplinary approach dedicated ... that was a landmark on the Oregon Trail, Western Nebraska Community College (WNCC) has tra - ditionally had a strong emphasis on the conventional academic courses and associate’s degrees that...

Ngày tải lên: 20/02/2014, 19:20

74 411 0

Bạn có muốn tìm thêm với từ khóa:

w