... are like conversations Each conversation is a series of statements, questions, or explanations that pass along information Each paragraph is also a series of Trang 19sentences that pass along ... along information A paragraph is different from a conversation because a paragraph can be edited and changed after you write it down, and a conversation can't be taken back once you have spoken ... inches of rain per Trang 26year In addition, while Arizona is a landlocked state and thus has no seashore, Rhode Island lies on the Atlantic Ocean and does have a significant coastline 10 A
Ngày tải lên: 11/07/2014, 22:20
... , 1980 a and b) A second D simulans strain (Madagascar) and a D melanngaster one (Champetières) were utilized Mada-gascar and Champetières (P et al., 1975) were both free of microorganisms. ... these flies, of a hereditary virus with low pathogenicity. II Material and methods Drosophila strains The strain in which the S character appeared was denominated SimES ; it was already described ... examples of maternal transmission of characters are known for the genus Drosophila In 3 cases the causal factor appeared to be a microorganism : CO 2 sensitivity is due to the Rhabdovirus sigma (B
Ngày tải lên: 09/08/2014, 22:22
Solving the Forward Kinematics of a GoughType Parallel Manipulator with Interval Analysis
... Trang 1INRIA Sophia-Antipolis, FranceKinematics of a Gough-Type Parallel Manipulator with Interval Analysis Abstract We consider in this paper a Gough-type parallel robot and we present an efficient ... (Kiyoharu, Ohara, and Hiromasa 2001; Tagawa et al 1999) and parallel robots FK (Castellet 1998; Didrit, Petitot, and Walter 1998; Jaulin et al 2001), workspace analysis (Chablat, Wenger, and Merlet ... with Interval Analysis 2.1 Interval Analysis Interval analysis is an alternative numerical method that can be used to determine all the solutions to a system of equations and inequalities systems
Ngày tải lên: 07/07/2016, 14:45
Tài liệu The Anatomy of a Large-Scale Hypertextual Web Search Engine ppt
... to PageRank, again see [Page 98] Another intuitive justification is that a page can have a high PageRank if there are many pages that point to it, or if there are some pages that point to it and ... these hyperlinks, a significant sample of the total These maps allow rapid calculation of a web page’s "PageRank", an Trang 4objective measure of its citation importance that corresponds ... than half a million servers, and generates tens of millions of log entries generates a fair amount of email and phone calls Because of the vast number of people coming on line, there are always
Ngày tải lên: 24/01/2014, 20:20
Tài liệu GLOBAL PHYLOGEOGRAPHY OF A CRYPTIC COPEPOD SPECIES COMPLEX AND REPRODUCTIVE ISOLATION BETWEEN GENETICALLY PROXIMATE ‘‘POPULATIONS’’ ppt
... estuary, WA; (23) Grays Harbor Marsh, WA; (24) Nitinat Lake, BC, Canada; (25) Nanaimo River, BC, Canada; (26) Campbell River, BC, Canada; (27) Ishikari River, Japan; (28) Lake Baratoka, Japan; ... used to amplify sequences from 16S rRNA, and primers COIH 2198 (59 TAAACTTCAGGGTGAC-CAAAAAATCA 39) and COIL 1490 (59 GGTCAACAAAT-CATAAAGATATTGG 39; Folmer et al 1994) were used to obtain sequences ... Populations of E affinis in northern Russia may be more widespread (1) St. Lawrence estuary, Canada; (2) St Lawrence marsh, Canada; (3) Saguenay River, PQ, Canada; (4) Lac St Jean, PQ, Canada;
Ngày tải lên: 13/02/2014, 15:20
Tài liệu Pictures of a Socialistic Future ppt
... cast lots again and again until they got a trade; and in this way the vacancies were fi lled up in these branches of labor for which there had been a scarcity of applicants I understand that a ... labor; and he says, for instance, that in Berlin the Younkers have been completely scattered as a party One had to go as a paperhanger to Inowrazlaw because there was a scarcity of paperhangers there, ... Onward is issued with a sheet of local matter for each separate place Provisionally, and until such time as a new Parliament shall have been elected, the conduct of aff airs is in the hands of
Ngày tải lên: 14/02/2014, 08:20
Tài liệu Developing Culturally and Linguistically Competent Health Education Materials: A Guide for the State of New Jersey ppt
... Department of Health and Senior Services Melissa Vezina, MPH, New Jersey Department of Health and Senior Services Maris Chavenson, Pediatric Asthma Coalition of New Jersey Sandra Fusco-Walker, Allergy ... Allergy & Asthma Network Mothers of Asthmatics Teresa Lampmann, Pediatric Asthma Coalition of New Jersey Guide for Developing Culturally and Linguistically Competent Health Education Materials ... define health promotion as "educational and environmental supports" that create conditions of living that support and maintain health Health education is one of several strategies that are
Ngày tải lên: 14/02/2014, 13:20
Tài liệu World Bank, Inter-American Development Bank, and Subregional Development Banks in Latin America: Dynamics of a System of Multilateral Development Banks ppt
... this, we use a great amount of quantitative data from the annual reports and financial databases of MDBs that the FORO Nacional Internacional research program has been tracking periodically The ... Anguilla, Antigua and Barbuda, the Bahamas, Barbados, Belize, British Virgin Islands, Dominica, Grenada, Guyana, Haiti, Jamaica, Montserrat, St Kitts and Nevis, St Lucia, St Vincent and the Grenadines, ... Uruguay, and Venezuela); CABEI in Belize, Costa Rica, the Dominican Republic, El Salvador, Guatemala, Honduras, Nicaragua, Panama; and Argentina and Colombia outside the subregion, and; CDB in Anguilla,
Ngày tải lên: 16/02/2014, 06:20
Tài liệu Báo cáo khoa học: Intrinsic GTPase activity of a bacterial twin-arginine translocation proofreading chaperone induced by domain swapping ppt
... Trang 1translocation proofreading chaperone induced by domain swapping David Guymer1, Julien Maillard2, Mark F Agacan1, Charles A Brearley3and Frank Sargent1 1 College of Life Sciences, ... TorD GTPase activity can be isolated by Cibacron Blue affin-ity chromatography (A) Unusual behaviour of TorD on Cibacron Blue affinity media A sample of 0.5 m M metal affinity chromatogra-phy-purified ... investigated by analytical ultracentrifugation Sedimentation velocity analysis was performed on a sample taken from the initial nickel-affinity chroma-tography and this material was shown to contain
Ngày tải lên: 16/02/2014, 09:20
Tài liệu The Banker and the Bear The Story of a Corner in Lard ppt
... at least make them a long visit Somewhat toDick's surprise she accepted; partly because the idea of having any sort of a home appealed to her, and partlybecause, in spite of her prejudice against ... into a mania One morning John was nearing his twentieth birthday then he was sent on a small matter of business to theAtlantic National Bank He had despatched it and was passing out when Dawson, ... the wide sofa and looking over portfolios of steel engravings from famouspaintings and talking of nothing in particular, or at least not of the steel engravings Trang 7At last one Sunday afternoon
Ngày tải lên: 17/02/2014, 19:20
Tài liệu The Chronicles of a Gay Gordon ppt
... was in Spain Parliamentary elections were to take place the very week after Easter Sunday On that day thefirst bull-fight of the season was to take place at Puerto Santa Maria, a small town about ... Meanwhile my fatherstood at the entrance of the restaurant, sad but resigned, and it was after some considerable time and after theremoval of the offending joint, that the family party was again ... South of Ireland There was a detachment of some twenty-five men at a place called Green Castle, which was an old fort at the entrance of Lough Swilly, not far off the Giant's Causeway Another detachment
Ngày tải lên: 18/02/2014, 06:20
Tài liệu Báo cáo khoa học: Production and characterization of a secreted, C-terminally processed tyrosinase from the filamentous fungus Trichoderma reesei ppt
... AAA AGC AGG CTA TCA TGC TGT TGT CAG GTC CCT CTC G; and reverse, GGG GAC CAC TTT GTA CAA GAA AGC TGG GTC AGT GGT GGT GGT GGT GGT GCA GAG GAG GGA TAT GGG GAA CGG CAA A The PCR reaction was done ... 5¢ and 3¢ ends, respectively The primers used were as follows: forward primer, GTT GGA ATT CCA TCA TCA TCA TCA TCA TCA GGG CAC GAC ACA CAT CCC C; and reverse primer, GAT CGG TAC CTC ATT ACA GAG ... protein had a sig-nificantly lower molecular mass (43.2 kDa) than that calculated from the putative amino acid sequence (61.151 kDa) According to N-terminal and C-terminal structural analyses by fragmentation,
Ngày tải lên: 19/02/2014, 06:20
Tài liệu Báo cáo khoa học: Characterization of a recombinantly expressed proteinase K-like enzyme from a psychrotrophic Serratia sp. ppt
... 5¢-GACACCGTAGGTTGAGCCGCCAATC CATTG-3¢; NP6, 5¢-TTGATCGATTCTGTCTATGCCC CA-3¢ along with the adaptor primers: AP1 (5¢-GTAATAC GACTCACTATAGGGC-3¢) and AP2 (5¢-ACTATAGGG CACGCGTGGT-3¢) Nested PCR was ... containing 1 ng of genomic DNA as template, 0.2 mm dATP, dCTP, dGTP and dTTP, 0.2 lm of upstream primer (OP17: 5¢-GA AAAACCATGGTGAATGAATACCAAGCGACT-3¢) and downstream primer (NP7: 5¢-CAATCTCCATGGCTAG ... endo- and exo- peptidases are widespread in nature and found in viruses, archaea, bacteria and euk-aryotes The biological importance of peptidases are clearly indicated by the fact that 2% of all
Ngày tải lên: 19/02/2014, 07:20
Tài liệu The Total Cost of (Non) Ownership of a NoSQL Database Cloud Service ppt
... With Amazon DynamoDB, there are no direct acquisition costs of database hardware, and no indirect administration costs of managing and scaling your hardware environment That’s because Amazon DynamoDB ... NoSQL database software hosted on Amazon Elastic Compute Cloud (Amazon EC2) with Amazon Elastic Block Storage (Amazon EBS) 3 Amazon DynamoDB (a NoSQL database service) To get a complete picture of ... significant cost of owning and managing a scalable NoSQL database solution is related to operating and maintaining the software, along with the hardware and infrastructure needed to support it As
Ngày tải lên: 19/02/2014, 12:20
Tài liệu Báo cáo khoa học: Stimulation of poly(A) synthesis by Escherichia coli poly(A)polymerase I is correlated with Hfq binding to poly(A) tails ppt
... 5¢-TAATTAACCCTCACTAAAGGGGTGCTCGGCATAAG Reverse ompA105 5¢-GCCATGAATATCTCCAACGAG Reverse ompA117 5¢-CATCCAAAATACGCCATGAATATC Forward 5¢rpsO 5¢-TAATACGACTCACTATAGGGGCCGCTTAACGTCGCG Reverse 5¢rpsO 5¢-GCTTCAGTACTTAGAGAC Forward ... 5¢-GCTTCAGTACTTAGAGAC Forward 3¢rpsO 5¢-TAATACGACTCACTATAGGGAGACGTAGCACGTTACACC Reverse 3¢rpsO 5¢-GAAAAAAGGGGCCACTCAGG Reverse 3¢rpsO-(T)18 5¢-T(18)GAAAAAAGGGGCCACTCAGG Forward rpsO internal 5¢GCGTCGCTAATTCTTGCGAGA18TTTCAGAAAAGGGCTG Reverse ... 5¢GCGTCGCTAATTCTTGCGAGA18TTTCAGAAAAGGGCTG Reverse 3¢rpsO-(C)18 5¢-C(18)GAAAAAAGGGGCCACTCAGG Reverse 3¢rpsO-(G)18 5¢-G(18)GAAAAAAGGGGCCACTCAGG Reverse 3¢rpsO-(N)18 5¢-GAATTGCTGCCGTCAGCTTGA Forward oxyS109* 5¢-TAATTAACCCTCACTAAAGGGAAACGGAGCGGCACCTCTT Reverse
Ngày tải lên: 19/02/2014, 16:20
Tài liệu Pathophysiology and Clinical Aspects of Venous Thromboembolism in Neonates, Renal Disease and Cancer Patients Edited by Mohammed A. Abdelaal ppt
... Patricia Cannata Arriola, Gloria Soledad Cotrina Romeroand Pedro Arauco Nava Chapter 4 Venous Thromboembolism in Cancer Patients 73 Galilah F Zaher and Mohamed A Abdelaal Chapter 5 Thrombosis Associated ... standardization of preanalytical and analytical variables as well as integration of the various approaches in measuring MP Severalnovel approaches are now being considered 'Megamix beads' is novel approach ... Consultant Hematologist, Head of Pathology & Laboratory Medicine; Head of King Abdullah International Medical Research Center Jeddah, Saudi Arabia Trang 11Section 1 Some Aspects of Pathogenesis
Ngày tải lên: 19/02/2014, 23:20
Tài liệu Architecture of a Database System ppt
... errors andfailures is a rapid failover to a redundant online copy Redundancy can be achieved in a number of ways: (a) replication at the data storage level(Storage-Area Networks), (b) data replication ... in all three DBMSmodels is that the buffer pool is a large shared data struc-ture available to all database threads and/or processes When a thread needs a page to be read in from the database, ... These operators make calls to fetch data from the DBMS’ Trans-actional Storage Manager (Figure 1.1, bottom), which man-ages all data access (read) and manipulation (create, update,delete) calls
Ngày tải lên: 20/02/2014, 05:21
Tài liệu A NOTE ON MEASURING THE ECONOMIC IMPACT OF INSTITUTIONS OF HIGHER EDUCATION ppt
... that the skill-base approach is particularly useful in the case of the University of Massachusetts at Boston (UMB), since 89% of undergradu-ates and 82% of graduundergradu-ates remain in Massachusetts ... skill-base approach begin their argument with the observation that a large percentage of a university's gradu-ates remain in that state after graduation These individuals become productive, tax-paying ... Recent studies have employed a new approach that also accounts for increases in the state's skill base as part of the economic impact Although the skill-base ap-proach yields favorable results for
Ngày tải lên: 20/02/2014, 19:20
Tài liệu Eye of a Dog ppt
... Gather your drawing pencils and prepare to add shading to Shadow’s eye. Shading refers to the various shades of gray (values) in a drawing that make drawings look three-dimensional. Values are ... Canadian Mounted Police, and in 1994, she was awarded a Certificate of Membership from “Forensic Artists International”. Her home-based art career included graphic design, and teaching recreational ... recreational drawing and painting classes. As supervisor of her community’s recreational art department, Brenda hired and trained teachers, and designed curriculum for several children’s art programs....
Ngày tải lên: 23/12/2013, 10:16
Tài liệu FINANCIAL ENGINEERING The Evolution of a Profession pptx
... investment management firm. Tanya sits on several boards of directors, including a major mutual fund complex and the National Board of Mathematics and their Applications. She has taught courses at Yale ... Financial Analysts Journal, Harvard Business Review,andtheJournal of Financial Engineering. She holds an MBA in finance from Harvard University and a BA in mathematics and philosophy from Yale ... separation of banking and insurance under the then-in-effect Glass-Steagall Act. THE MASSIVE GROWTH PERIOD (1998 TO 2006) The Asian financial crisis began with the financial collapse of Thailand’s...
Ngày tải lên: 18/02/2014, 18:20