human amp 8211 robot interaction as a cooperative game

Báo cáo khoa học: Novel repressor of the human FMR1 gene ) identification ¨ of p56 human (GCC)n-binding protein as a Kruppel-like transcription factor ZF5 ppt

Báo cáo khoa học: Novel repressor of the human FMR1 gene ) identification ¨ of p56 human (GCC)n-binding protein as a Kruppel-like transcription factor ZF5 ppt

... assay RNA interference assay Three siRNAs for human ZF5 mRNA were selected based on general rules for siRNA selection [43] The first siRNAZF5 5¢-GGUUGAGGAUGUGAAAUUCUU-3¢ and 5¢-GAAUUUCACAUCCUCAACCUU-3¢) ... 5¢-GAAUUUCACAUCCUCAACCUU-3¢) matched bases 192–210; the second siRNAZF5 (5¢-GAGGAAGCAUGA GAAACUCUU-3¢ and 5¢-GAGUUUCUCAUGCUUCCU CUU-3¢) matched bases 945–963; and the third siRNA ZF5 (5¢-GGUCCUGAACUACAUGUACUU-3¢ and 5¢-GUAC ... (5¢-GGCCTTCAAGGCATTAAG-3¢, 5¢-AAACAAATGG CCTGTCCG-3¢) spanned a 958 bp 5¢-part of the ZF5 coding region; the second pair (5¢-CCCCTCAAGCCTT AACAT-3¢, 5¢-TCTCCACTTTCCAGGCAA-3¢) spanned a 686 bp 3¢-part of...

Ngày tải lên: 07/03/2014, 05:20

15 473 0
báo cáo hóa học:" Force-feedback interaction with a neural oscillator model: for shared human-robot control of a virtual percussion instrument" doc

báo cáo hóa học:" Force-feedback interaction with a neural oscillator model: for shared human-robot control of a virtual percussion instrument" doc

... human musicians [5] As the community learns how to design robots that behave more like humans, more knowledge is created about human- computer interaction, human robot interaction, new media art, ... rhythm similarly to a human 3.2 Mechanical analog of Large oscillator In order to facilitate robust force–feedback interaction with the Large oscillator, we obtain mechanical analog parameters for ... Force–feedback interaction with a neural oscillator model: for shared human robot control of a virtual percussion instrument Edgar Berdahl∗ (edgar.berdahl@imag.fr), Claude Cadoz (claude.cadoz@imag.fr) and...

Ngày tải lên: 21/06/2014, 17:20

58 330 0
Tài liệu Báo cáo khoa học: Trophoblast-like human choriocarcinoma cells serve as a suitable in vitro model for selective cholesteryl ester uptake from high density lipoproteins pdf

Tài liệu Báo cáo khoa học: Trophoblast-like human choriocarcinoma cells serve as a suitable in vitro model for selective cholesteryl ester uptake from high density lipoproteins pdf

... proliferation and invasion Choriocarcinoma is a malignant neoplasm that represents the early trophoblast of the attachment phase or as later invasive stage [46–48] Thus, in most cases, choriocarcinoma ... reproductive and cardiovascular pathophysiology Proc Natl Acad Sci USA 96, 9322–9327 62 Imachi, H., Murao, K., Sayo, Y., Hosokawa, H., Sato, M., Niimi, M., Kobayashi, S., Miyauchi, A. , Ishida, T & Takahara, ... cell association was calculated as the difference between total and nonspecific cell association In a parallel set of experiments, the cell association of [3H]CE-HDL3 by choriocarcinoma cells was...

Ngày tải lên: 20/02/2014, 23:20

12 473 0
Báo cáo khoa học: Identification of carbonic anhydrase 9 as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells ppt

Báo cáo khoa học: Identification of carbonic anhydrase 9 as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells ppt

... b-Actin GAAGAAGGGCCAGACGC CCTTCGCTGAGTTCCTGC ACATCAGCGGATACTACAGAG TTTGAATGGGCGAGTGATTG CGGAAACGCCTTAAGTCCAG AATAAGCTTCCGACTCTAGCCGC AGCTGGTGCAGGAGGAAGTA CCGAGAACCGAACTTACCAA AGGAAGCACCCAGCAATACCA ... AGGAAGCACCCAGCAATACCA CACCTTGGATGGGTATTCCA CACAGCTCCCATTCATTCCA TCCTCCCTGGAGAAGAGCTA CTCCTGGGACACGATGC CTGCGGTGCTGTTGTGG CACCATCATAAGGGTAAACAT ACAGCAAAAAGGAGGCCAAA GCCACAATCCAGTCATTCCA GATAAGCTTGTGGAAGTCGCGT ... cervical squamous carcinomas, ovarian carcinomas, colorectal carcinomas, esophageal carcinomas, bladder carcinomas and non-small cell lung carcinomas CA9 is strongly induced by hypoxia via the transcription...

Ngày tải lên: 06/03/2014, 22:21

13 565 0
Báo cáo khoa học: Identification of NF1 as a silencer protein of the human adenine nucleotide translocase-2 gene pptx

Báo cáo khoa học: Identification of NF1 as a silencer protein of the human adenine nucleotide translocase-2 gene pptx

... gene and lg of control luciferase plasmid DNA (pGL3, Promega) were used for transfection CAT and luciferase activities were measured as described [17] DNase I protection assay Rat liver and HeLa ... 5¢-TTTTG GATTGAAGCCAATATGATA-3¢; NF1 mut, 5¢-TTTT GGATTGAATAAAATATGATA-3¢; Site-2 wt, 5¢-GCGT CTCACCCTAGTCCTGGTCCTGCTCCAAGGGTTTT TGTCC-3¢; Site-2 mut, 5¢-GCGTCTCACCCTAGTAA TGGTAATGCTCCAAGGGTTTTTGTCC-3¢; ... carried out as described by Luciakova et al [13] MALDITOF analysis was performed in reflector mode using a Voyager-DE STR MALDI-TOF mass spectrometer (Applied Biosystems) Internal calibration was performed...

Ngày tải lên: 07/03/2014, 15:20

8 427 0
Báo cáo khoa học: 2-Pyrimidinone as a probe for studying the EcoRII DNA methyltransferase–substrate interaction docx

Báo cáo khoa học: 2-Pyrimidinone as a probe for studying the EcoRII DNA methyltransferase–substrate interaction docx

... scintillation uid The lter-bound radioactivity was measured on Tracor Analytic Delta 300 scintillation counter (ThermoQuest/CE Instruments, Piscataway, USA) and the amount of methylated DNA was determined ... The ratio of bound to free DNA was plotted vs concentration of bound DNA (a Scatchard plot, Fig 3) [23] An 18-mer DNA duplex 5Â-GAG CCAACCTGGCTCTGA-3Â/3Â-CTCGGTTGGACCGAG ACT-5Â (IÂ) was used as ... determined and the fraction of bound DNA was calculated as (cpmbound)/(cpmbound + cpmfree) K dapp was calculated by tting the data to the following equation derived from a standard bimolecular binding...

Ngày tải lên: 07/03/2014, 15:20

9 437 0
Báo cáo khoa học: The oxidative effect of bacterial lipopolysaccharide on native and cross-linked human hemoglobin as a function of the structure of the lipopolysaccharide A comparison of the effects of smooth and rough lipopolysaccharide ppt

Báo cáo khoa học: The oxidative effect of bacterial lipopolysaccharide on native and cross-linked human hemoglobin as a function of the structure of the lipopolysaccharide A comparison of the effects of smooth and rough lipopolysaccharide ppt

... pH range from 5.3 to Tsuruga and Shikama [21] confirmed that the fast phase of oxidation was due to the a chains and the slow phase was due to the b chains Tsuruga et al found that the beta chain ... a water molecule which can then accelerate the displacement of the protonated superoxide anion, as was suggested by Tsuruga and Shikama [21] to explain the increase in oxidation rate of the a ... the auto-oxidation of Hb A0 has been the subject of several studies Mansouri and Winterhalter [5] reported that the oxidation of the a chains of Hb A0 was 10 times faster than that of the beta...

Ngày tải lên: 08/03/2014, 10:20

6 749 0
Báo cáo khoa học: Identification of mitogen-activated protein⁄extracellular signal-responsive kinase kinase 2 as a novel partner of the scaffolding protein human homolog of disc-large docx

Báo cáo khoa học: Identification of mitogen-activated protein⁄extracellular signal-responsive kinase kinase 2 as a novel partner of the scaffolding protein human homolog of disc-large docx

... mutagenic primers were: GRRF-PDZ1: 5¢GAAAGGGGAAATTCAGGGCGTCGT TTCAGCATTGCAGGAGG-3¢; GRRF-PDZ2: 5¢-ATTA AAGGTCCTAAAGGTCGTCGGTTTAGCATTGCTGGA GG-3¢; RAAV-MEK2: 5¢-CACCCACGCGCGCCGCCGT GTGA-3¢ and ... RT-PCR using PlatiniumÒ Taq DNA High Fidelity Polymerase (Invitrogen) and the primers: PDZ-1-2, forward: 5¢-CCGAATTCGAAGAAATCACACTTGAAAGG-3¢, and reverse: 5¢GGATCCCCATCATTCATATACATACTTGT GGGTT-3¢; ... 5¢-GTGGGGAAATATGCTCTTGAGGAGGT-3¢; primers 2, forward: 5¢-GTGACTTCAGAGACACTGCCA-3¢, and reverse: 5¢-CCCTTTCAAGTGTGATTTCTTC3¢; primers 3, forward: 5¢-ACCAGATGGTGAGAGCGAT-3¢, and reverse: 5¢-CTGTCTTTCATAGGTCCCAAT-3¢...

Ngày tải lên: 22/03/2014, 16:20

11 420 0
Báo cáo khoa học: Hematopoietic differentiation from human ESCs as a model for developmental studies and future clinical translations Invited review following the FEBS Anniversary Prize received on 5 July 2009 at the 34th FEBS Congress in Prague docx

Báo cáo khoa học: Hematopoietic differentiation from human ESCs as a model for developmental studies and future clinical translations Invited review following the FEBS Anniversary Prize received on 5 July 2009 at the 34th FEBS Congress in Prague docx

... Nature 460, 909–913 89 Hong H, Takahashi K, Ichisaka T, Aoi T, Kanagawa O, Nakagawa M, Okita K & Yamanaka S (2009) Suppression of induced pluripotent stem cell generation by the p53–p21 pathway ... a CD34+ hESC-derived starting population has been considered as a potential AIDS therapy, and as a way to alleviate secondary effects produced by anti-retroviral drugs [16] Various studies have ... engraftment was achieved using both methods as shown by expression of human CD45 3–6 months post-transplantation Additionally, secondary engraftment was achieved following intravenous transplantation...

Ngày tải lên: 22/03/2014, 17:20

12 551 0
The leg-to-body ratio as a human aesthetic criterion pdf

The leg-to-body ratio as a human aesthetic criterion pdf

... to as necessary The testing session lasted about 15 and participants were debriefed following the experiment Results A Â Â repeated measure analysis of variance (ANOVA) with 71 participants was ... the arms was altered accordingly The legs were measured as the distance between the bottom of the feet and top of the pelvic region (above the hips and below the waist) The body was measured as ... stimuli and LBR were treated as within subjects factors, and participant gender was treated as a between subjects factor The Greenhouse–Geisser correction was applied to results involving LBR, as...

Ngày tải lên: 30/03/2014, 16:20

7 408 0
Báo cáo hóa học: "IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in organ-specific autoimmunity: implications in pathophysiology and translation to human disease" doc

Báo cáo hóa học: "IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in organ-specific autoimmunity: implications in pathophysiology and translation to human disease" doc

... type diabetes subjects Immunogenetics 2010, 62:101-107 36 Kawasaki E, Awata T, Ikegami H, Kobayashi T, Maruyama T, Nakanishi K, Shimada A, Uga M, Kurihara S, Kawabata Y, et al: Genetic association ... Cobbold S, Alyanakian MA, Gouarin C, Barriot S, Garcia C, Waldmann H, Bach JF, Chatenoud L: Autoimmune diabetes onset results from qualitative rather than quantitative age-dependent changes in pathogenic ... 48:6-11 19 Bernasconi A, Marino R, Ribas A, Rossi J, Ciaccio M, Oleastro M, Ornani A, Paz R, Rivarola MA, Zelazko M, Belgorosky A: Characterization of immunodeficiency in a patient with growth hormone...

Ngày tải lên: 18/06/2014, 16:20

12 581 0
Báo cáo sinh học: "Glutamate carboxypeptidase activity in human skin biopsies as a pharmacodynamic marker for clinical studies" docx

Báo cáo sinh học: "Glutamate carboxypeptidase activity in human skin biopsies as a pharmacodynamic marker for clinical studies" docx

... activity assay provides a simple and direct measurement of GCP activity from tissue samples easily assessable in human subjects Abbreviations GCP: glutamate carboxypeptidase; NAAG: N-acetyl-aspartyl-glutamate; ... internal standard peak was observed Rojas et al Journal of Translational Medicine 2011, 9:27 http://www.translational-medicine.com/content/9/1/27 sample Paw pads from animals that were treated ... (NAALADase) inhibition on painful and sensory diabetic neuropathy J Neurol Sci 2006, 247:217-223 16 Zhang W, Slusher B, Murakawa Y, Wozniak KM, Tsukamoto T, Jackson PF, Sima AA: GCPII (NAALADase)...

Ngày tải lên: 18/06/2014, 19:20

8 406 0
Báo cáo toán học: " Music expression with a robot manipulator used as a bidirectional tangible interface" pptx

Báo cáo toán học: " Music expression with a robot manipulator used as a bidirectional tangible interface" pptx

... move towards a virtual attractor in 3D Cartesian space as if its dynamics was equivalent to a virtual mass concentrated in its end-effector and attached by a virtual spring and damper We propose ... generalizing a task in a humanoid robot IEEE Trans Syst Man Cybern Part B 37(2), 286–298 (2007) 27 S Calinon, P Evrard, E Gribovskaya, A Billard, A Kheddar, Learning collaborative manipulation tasks ... musician, who played with the robot as part of his live stage setup Keywords: robot music interface; physical human robot interaction; haptic feedback; human robot collaboration; learning by imitation...

Ngày tải lên: 20/06/2014, 20:20

34 326 0
Báo cáo toán học: " Music-aided affective interaction between human and service robot" pptx

Báo cáo toán học: " Music-aided affective interaction between human and service robot" pptx

... A conversational robot called ‘Mel’ introduced a new paradigm of service robots that leads human robot interaction by demonstrating practical knowledge [14] A cat robot was designed to simulate ... bimodal ( e ) , was set to zero so as to be ignored The second experiment was conducted in a more natural way, supported by human participants Each participant was asked to carry out the same behavior ... monitoring home safety Figure summarizes several hardware and functions A 7-inch LCD touch screen and a 1.3-megapixel camera as well as general sound devices such as a speaker and a microphone are equipped...

Ngày tải lên: 20/06/2014, 20:20

44 277 0
Advances in Human-Robot Interaction pot

Advances in Human-Robot Interaction pot

... Yoshikawa, Masanao Koeda and Munetaka Sugihashi 12 Toward Human Like Walking – Walking Mechanism of 3D Passive Dynamic Motion with Lateral Rolling – Advances in Human- Robot Interaction 191 Tomoo Takeguchi, ... analyze the passive dynamic walking experimentally In Chapter 13, Yasuhisa Hirata, Takuya Iwano, Masaya Tajika and Kazuhiro Kosuge propose a wearable walking support system, called Wearable Walking ... Takeguchi, Minako Ohashi and Jaeho Kim 13 Motion Control of Wearable Walking Support System with Accelerometer Based on Human Model 205 Yasuhisa Hirata, Takuya Iwano, Masaya Tajika and Kazuhiro Kosuge...

Ngày tải lên: 27/06/2014, 15:20

354 299 0
Human-Robot Interaction pdf

Human-Robot Interaction pdf

... Predictive Tracking in Vision-based Hand Pose Estimation using Unscented Kalman Filter and Multi-viewpoint Cameras 155 Albert Causo, Kentaro Takemura, Jun Takamatsu, Tsukasa Ogasawara, Etsuko Ueda and ... the sociability values of participants according to gender and age categories As a result, the average value for male participants was -0.378 and the average value for female participants was 0.434 ... they always have a certain unpredictability, and they are possible carriers of disease and allergies Therefore, the use of robots instead of animals has more advantages and has a better chance...

Ngày tải lên: 27/06/2014, 15:20

308 275 2
uncharted_ big data as a lens on human culture-erez aiden

uncharted_ big data as a lens on human culture-erez aiden

... absolute pageturner, it fascinated us from cover to cover, from the dramatic beginning: Chapter One A AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAA And all the way through the surprising finish: Chapter ... omissions are often inconsistent, even within what is thought of as a single dataset That’s because big datasets are frequently created by aggregating a vast number of smaller datasets Invariably, ... hypotheses, and to gradually assemble what they’ve learned into causal stories and eventually mathematical theories Blunder about in any reasonably interesting big dataset and you will inevitably make...

Ngày tải lên: 06/07/2014, 02:09

336 489 0
w