Báo cáo khoa học: Identification of mitogen-activated protein⁄extracellular signal-responsive kinase kinase 2 as a novel partner of the scaffolding protein human homolog of disc-large docx

Coimmunoprecipitation assays in both human VSMCs and human embryonic kidney 293 cells, demonstrated that endogenous hDlg physically interacts with MEK2 but not with MEK1.. Taken together

Identification of mitogen-activated protein⁄extracellular signal-responsive kinase kinase 2 as a novel partner of the scaffolding protein human homolog of disc-large

Oumou Maı¨ga1, Monique Philippe1, Larissa Kotelevets2, Eric Chastre2, Samira Benadda3,

Dominique Pidard1, Roger Vranckx1and Laurence Walch1

1 INSERM U698, Universite´ Paris 7, France

2 INSERM U773, Centre de Recherche Biome´dicale Bichat Beaujon, Paris, France

3 Plateau de Microscopie Confocale ICB-IFR 02, Paris, France

Keywords

human disc-large homolog; human vascular

smooth muscle cells; MAPK ERK kinase 2;

scaffold protein; synapse-associated

protein 97

Correspondence

L Walch, INSERM U698, Cardiovascular

Haematology, Bio-Engineering and

Remodelling, Bichat-Claude Bernard

Hospital, 46 rue Henri Huchard, F-75877,

Paris, Cedex 18, France

Fax: +33 1 40 25 86 02

Tel: +33 1 40 25 75 22

E-mail: laurence.walch@inserm.fr

(Received 11 January 2011, revised 29 April

2011, accepted 20 May 2011)

doi:10.1111/j.1742-4658.2011.08192.x

Human disc-large homolog (hDlg), also known as synapse-associated protein 97, is a scaffold protein, a member of the membrane-associated guanylate kinase family, implicated in neuronal synapses and epithelial– epithelial cell junctions whose expression and function remains poorly char-acterized in most tissues, particularly in the vasculature In human vascular tissues, hDlg is highly expressed in smooth muscle cells (VSMCs) Using the yeast two-hybrid system to screen a human aorta cDNA library, we identified mitogen-activated protein⁄ extracellular signal-responsive kinase (ERK) kinase (MEK)2, a member of the ERK cascade, as an hDlg binding partner Site-directed mutagenesis showed a major involvement of the PSD-95, disc-large, ZO-1 domain-2 of hDlg and the C-terminal sequence RTAV of MEK2 in this interaction Coimmunoprecipitation assays in both human VSMCs and human embryonic kidney 293 cells, demonstrated that endogenous hDlg physically interacts with MEK2 but not with MEK1 Confocal microscopy suggested a colocalization of the two proteins at the inner layer of the plasma membrane of confluent human embryonic kidney

293 cells, and in a perinuclear area in human VSMCs Additionally, hDlg also associates with the endoplasmic reticulum and microtubules in these latter cells Taken together, these findings allow us to hypothesize that hDlg acts as a MEK2-specific scaffold protein for the ERK signaling path-way, and may improve our understanding of how scaffold proteins, such

as hDlg, differentially tune MEK1⁄ MEK2 signaling and cell responses

Structured digital abstract

l hDlg and MEK2 colocalize by fluorescence microscopy (View Interaction 1 , 2 , 3 )

l hDlg physically interacts with MEK2 by two hybrid (View Interaction 1 , 2 , 3 )

l hDlg physically interacts with MEK2 by anti bait coimmunoprecipitation (View Interac-tion 1 , 2 )

l MEK2 physically interacts with hDlg by anti bait coimmunoprecipitation (View Interac-tion 1 , 2 )

Abbreviations

CHO, Chinese hamster ovary; ERK, extracellular signal-responsive kinase; GK, guanylate kinase; hDlg, human disc-large homolog; HEK-293, human embryonic kidney 293; hVSMC, human vascular smooth muscle cell; MAGUK, membrane-associated guanylate kinase; MAPK, mitogen-activated protein kinase; MEK1 ⁄ 2, MAPK ERK kinase 1 ⁄ 2; PDZ, PSD-95, disc-large, ZO-1.

The mitogen-activated protein kinases (MAPKs) are a

family of S⁄ T-protein kinases, including p38, c-Jun

N-terminal kinase and extracellular signal-responsive

kinase (ERK)1⁄ 2, which control several biological

processes such as proliferation, differentiation, survival

and apoptosis The ERK signaling pathway includes

three major components that are activated in cascade

by phosphorylation Raf phosphorylates two serine

residues in the activation loop of mitogen-activated

protein⁄ ERK kinase (MEK)1 ⁄ 2 MEK 1 ⁄ 2

phosphory-lates ERK1⁄ 2 on both the threonine and tyrosine

resi-dues in the conserved TEY sequence [1] and activated

ERK phosphorylates the serine or threonine residues

on the S⁄ T-P consensus site in more than 100 nuclear,

cytosolic or membrane substrates with diverse

func-tions [2] The outcomes of ERK activation are as

vari-ous as the ERK substrates, and so an accurate

regulation of the ERK signaling pathway is necessary

This pathway is under the control of different

regula-tory elements such as phosphatases, docking domains

and scaffold proteins [2–4] Docking domains are

consensus sequences that MAPK recognize both on

their substrates, as well as on relevant down-regulating

phosphatases and scaffold proteins [4] The latter can

be divided into two categories [2] Upstream scaffold

proteins interact with at least one MAPK implicated

in ERK activation to facilitate a functional interaction

and regulate the localization and the duration of the

signal For example, the MEK partner 1 directs the

ERK cascade to the surface of the late endosomes [5]

Downstream scaffold proteins bind ERK and direct it

to specific substrates For example, the phosphoprotein

enriched in astrocyte-15 binds ERK1⁄ 2 and ribosomal

protein S6 kinase 2, a direct substrate of ERK, thereby

enhancing the activation of this latter kinase [6]

Human disc-large homolog (hDlg) is a member of

the membrane-associated guanylate kinase (MAGUK)

scaffold protein family [7] Interaction with MAGUK

permits the formation of multiprotein complexes,

sta-ble subcellular localizations of interacting partners and

the coordination of their activities MAGUK contain a

number of protein–protein interaction domains, such

as PSD-95, disc-large, ZO-1 (PDZ), Src-homology 3

and guanylate kinase (GK) domains In particular,

PDZ domains contain a specific GLGF sequence that

constitutes a hydrophobic cavity where the X-S⁄

T-X-V⁄ L C-terminal motif of their target proteins binds [8]

hDlg expression has been established in a variety of

cells, including neurons, astrocytes, epithelial cells and

T lymphocytes, where hDlg interacts with cytoskeleton

proteins, ion channels, receptors or signaling proteins,

such as kinases The association of hDlg with kinases allows the orchestration of cell-specific signaling path-ways For example, hDlg⁄ p38 association coordinates

T cell receptor signaling in T lymphocytes, whereas hDlg recruits phosphatidylinositol 3-kinase to E-cadh-erin complexes, allowing integrity of the adherent junc-tion in epithelial cells [9,10] It should be noted that there has been no demonstration to date showing that MAGUK are implicated in the ERK cascade

Little is known about the role of hDlg in the cardio-vascular system Previous studies have shown that hDlg is expressed in the myocardium where it can form complexes with K+channels such as the inwardly-rec-tifying K+channel 2.2 or the voltage-gated K+ chan-nel, allowing functional channel clustering and an enhancement of the K+current [11–13] However, the putative expression and functions of hDlg remain to be established in vascular tissues To gain insight into hDlg expression and specific functions in human vascu-lar tissues, we examined hDlg expression in human arteries and, more particularly, in human vascular smooth muscle cells (hVSMCs), and searched for PDZ domain-dependent binding partners A screening of a human aorta cDNA library by the yeast two-hybrid assay allowed us to identify MEK2 as a new potential binding partner for hDlg This interaction was then validated by biochemical procedures, including coim-munoprecipitation and confocal immunomicroscopy colabeling using cultured hVSMCs, as well as Chinese hamster ovary (CHO) and human embryonic kidney

293 (HEK-293) cells as models

Results

hDlg protein is present in hVSMCs

As shown inFig 1A, immunohistochemical labeling of hDlg carried out on sections of nonpathological human mammary arteries revealed that, among the arterial tissue layers, the media specifically exhibited a strong staining Because VSMCs are the only cell type found in the healthy arterial media, hDlg expression and subcellular localization were then investigated in cultured primary hVSMCs Immunoblot analysis of total or subcellular protein extracts prepared from con-fluent hVSMCs identified the presence of two molecu-lar immunoreactive species both in the total extract and in the membrane fraction (Fig 1B), whereas they were absent in the cytosolic fraction Taken together, these data suggest that hDlg is associated with membrane components By immunofluorescent labeling

coupled with confocal microscopy, hDlg was observed

to be widely distributed within the cytoplasm of

hVSMCs (Fig 1C–E) Costaining with various

orga-nelle markers showed that hDlg partially colocalized

with endoplasmic reticulum-associated calreticulin

(Fig 1C), with Golgi-associated GM130 (Fig 1D) and

with tubulin at the cell periphery, as well as in the

cytoplasm (Fig 1E), and locally with cortical F-actin

(Fig 1F) Taken together, these data suggest that hDlg

is mainly associated with internal membrane structures

and with the cytoskeleton in hVSMCs

Two hDlg isoforms are expressed in human arteries

hDlg mRNAs are known to contain three regions that encompass alternatively spliced exons (Fig 2A), lead-ing to several hDlg isoforms [14,15] To further charac-terize hDlg isoforms expressed in hVSMCs, primer pairs were chosen within the exons that surround the region of alternative splicing (Fig 2A) and RT-PCR experiments were carried out on human de-endothelial-ized pulmonary arterial RNA extracts (Fig 2B–D),

Ct

200 µm hDlg

B A

C

D

E

F

hDlg

N-cadherin

RSK

Fig 1 Detection of hDlg in hVSMCs (A)

Serial frozen sections of human mammary

artery were stained with monoclonal hDlg

antibody or an irrelevant mouse IgG1(Ct).

(B) Total hVSMC lysate, or a lysate

fraction-ated into membrane-associfraction-ated and

cyto-solic proteins, was submitted to western

blot detection of hDlg and the fraction

markers N-cadherin and ribosomal S6 kinase

(RSK) (C–F) Cultured hVSMCs were stained

for hDlg (green signal) and, as a red signal,

(C) calreticulin, an endoplasmic reticulum

marker, (D) GM130, a Golgi marker, (E)

tubulin or (F) F-actin Cells were analyzed by

confocal microscopy; colocalization (overlay)

appears in yellow and is indicated by white

arrowheads.

followed by amplification product sequencing (Fig S1).

Taken together, the results allow us to conclude that the

larger form of hDlg expressed in hVSMCs corresponds

to the I1A–I1B and I3–I5 insertions, whereas the shorter

form contains I1B and I3–I5 insertions Both isoforms

contain a Lin-2,-7 domain

hDlg interacts with MEK2 as assessed by the

yeast two-hybrid system

We then sought to identify hDlg interacting partners

in hVSMCs Accordingly, we used a vector encoding

the hDlg PDZ1 and PDZ2 domains as bait in a yeast

two-hybrid screening assay of a human aorta cDNA

library Interestingly, two independent clones were

identified as containing the C-terminal region of the

human MEK2 cDNA To analyze in more detail the

interacting sites within hDlg and MEK2, mutant

deriv-atives of PGKBT7-PDZ-1-2 and pACT2-MEK2 were

constructed On the one hand, the conserved GLGF

sequences present in the PDZ1 and PDZ2 domains

were mutated to the positively charged inactive GRRF

sequence [16] On the other hand, the C-terminal

RTAV putative PDZ-binding motif of MEK2 was

either mutated to RAAV, or deleted The expression

levels of the mutated forms and of their wild-type

counterparts were similar in yeasts (Fig 3B, D) These

data suggest that the PDZ1 and PDZ2 domains of

hDlg are separately able to interact with the

C-termi-nus of MEK2, even though the interaction implicating PDZ2 is stronger, whereas the PDZ3 domain shows

no interaction Coexpression of the MEK2 mutant forms with wild-type PDZ-1-2 abolished yeast growth (Fig 3C), demonstrating the crucial involvement of the MEK2 C-terminus in the interaction Taken together, these results indicate that the PDZ2 domain of hDlg and the C-terminal RTAV sequence of MEK2 are required for the optimal interaction of the two protein partners

Coimmunoprecipitation of endogenous hDlg and MEK2 proteins

To determine whether endogenous hDlg and MEK2 physically interact, coimmunoprecipitation assays were carried out in HEK-293 (used as a cell model) and in confluent hVSMC cell lysates The specific hDlg anti-body was able to coimmunoprecipate MEK2 from HEK-293 (Fig 4A) and hVSMC (Fig 4C) cell lysates, whereas, reciprocally, the specific MEK2 antibody coimmunoprecipitated hDlg from both cell lysates (Fig 4B, D) hDlg and MEK2 were not (or minimally) detectable after immunoprecipitation with irrelevant antibodies These results suggest that the hDlg iso-forms expressed endogenously in HEK-293 cells or in confluent hVSMCs can physically interact with MEK2, even though only a small fraction of MEK2 is coim-munoprecipitated with hDlg, as shown by the large

β1 β2 β3 α1 2 Ι1Α Ι1Β 3 // 12 13 Ι3 Ι2 Ι5 Ι4 14 15 //

L27

A

//

//

//

19

//

Primers 1 Primers 2 Primers 3

bp 600 500

Primers 1

Primers 3

Primers 2

Primers GAPDH

400

3

200

3

Fig 2 Two hDlg isoforms predominate in human arterial tissues (A) Schematic representation of the hDlg genomic structure Open boxes represent constitutive exons and gray boxes indicate alternatively spliced exons Three b exons encode an Lin-2,-7 domain (b isoform) and one a exon a cystein doublet (a isoform) Various combinations of two (I1A and I1B) or four (I2–I5) insertions were described as being tran-scribed in a tissue-specific manner Arrows show the relative position of the primer pairs used for RT-PCR (B–E) Transcripts obtained by RT-PCR, using (B) primer pair 1, (C) primer pair 2, (D) primer pair 3 or (E) primers directed against GAPDH, on mRNAs extracted from three different pulmonary artery samples.

amount of MEK2 remaining after hDlg precipitation

in hVSMCs (Fig S2A) Subsequently, the ability of

hDlg to interact with other members of the ERK

cas-cade was tested Under our experimental conditions,

the hDlg antibody was unable to coimmunoprecipate

MEK1, Raf or ERK1⁄ 2 proteins from hVSMCs

(Fig S2B)

Colocalization of hDlg and MEK2

The localization of transfected full-length EGFP-hDlg

and human HA-MEK2 in CHO cells was assessed by

confocal immunofluorescence microscopy EGFP-hDlg

and HA-MEK2 exhibited a diffuse staining with an

occasional patchy appearance and both types of

label-ing partially colocalized in these patches, suggestlabel-ing

the presence of aggregates (Fig 5A) In addition, the

localization of endogenous hDlg and MEK2 was

assessed in 293 cells and in hVSMCs In

HEK-293 cells, hDlg exhibited a general diffuse staining,

although this appeared to be stronger in the region of

the plasma membrane MEK2 appeared to be more homogenously distributed in the cytoplasm, although the two stains overlapped significantly at cell–cell junctions (Fig 5B) In hVSMCs, both hDlg and MEK2 exhibited a diffuse staining, although overlay revealed a colocalization of the two proteins at some perinuclear location (Fig 5C) Taken together, these results suggest that either transfected or endogenous hDlg and MEK2 partially colocalize in mammalian cells

Discussion

In the present study, we show, for the first time, the expression of hDlg in the human vascular cell popu-lation, which is the most abundant in arterial wall tissue (i.e the hVSMCs) This protein exists in the form of two immunoreactive species in membrane fractions Subcellular localization experiments suggest that, in hVSMCs, this MAGUK is mainly associated with the endoplasmic reticulum, as well as with the

PDZ-1-2 PDZ-1mut-2 PDZ-1-2mut PDZ3 Media

SD-LT

SD-LT

SD-LT + X-α-gal

RTAV RAAV Del

RTAV RAAV Del

50

37 50

Myc

AD

GAPDH 50

Ct PDZ-1-2 PDZ-1mut-2 PDZ-1-2mu

WB Myc

AD

kDa 50 37 25 50

GAPDH 50

SD-LT + X-α-gal

Fig 3 The PDZ2 domain of hDlg strongly interacts with the C-terminal sequence RTAV of MEK2 (A, C) Interactions were analyzed by a yeast two-hybrid assay (A) The PDZ-1–2 domains of hDlg, either wild-type or mutated on the GLGF sequence in either the PDZ1 domain (PDZ-1mut-2) or the PDZ2 domain (PDZ-1-2mut), or the hDlg PDZ3 domain, all fused to the GAL4 DNA-binding domain, were co-expressed

in yeasts with the C-terminus of MEK2 fused to the GAL4 activating domain (C) The PDZ-1-2 domains of hDlg fused to the GAL4 DNA-bind-ing domain were co-expressed in yeasts with the C-terminus of MEK2, encompassDNA-bind-ing the PDZ bindDNA-bind-ing sequence, which was intact (RTAV), replaced by an irrelevant sequence (RAAV), or deleted (Del), all fused to the GAL4 activating domain Yeasts were grown on two selection media: SD-LT that selects double transformants, and SD-LTHA + X-a-gal that selects protein–protein interactions with high stringency Yeasts grow and turn blue when GAL-4-responsive genes, which encode galactodidases, are activated (B, D) Western blotting of fusion protein expression: hDlg PDZ domains fused to the Myc-tagged GAL4 DNA-binding domain were detected by Myc antibody (Myc), and MEK2 C-terminus fused to the GAL4 activation domain was detected using GAL4 activation domain antibody (AD) Nontransfected yeast protein extracts were used as control (Ct) and GAPDH detection as a loading control.

microtubular network located both in the cytoplasm

and at the cell periphery hDlg has been previously

shown to be associated with the endoplasmic

reticu-lum in cultured neurons [17–20], where hDlg is

impli-cated in the trafficking of newly-synthesized

receptors, AMPAR and NMDAR, and voltage-gated

K+ channel 4.2 from the reticulum to the plasma

membrane The interaction of hDlg and various

microtubule-associated proteins, such as adenomatous

polyposis coli, and the motor proteins kinesin and

dynein, has also been previously highlighted in

different cell types [19,21,22] In this context, hDlg

controls intracellular trafficking and cell polarity

dur-ing oriented migration

Previews studies performed on various tissues

out-side the vascular system, including the brain, liver and

heart, have initially revealed the existence of several

isoforms of the hDlg protein, containing various

com-binations of alternatively spliced insertions: I1A, I1B,

I2, I3, I4 and I5 [15,23] More recently, two additional

alternative motifs located in the N-terminal region of

hDlg have been described, defining the a and b

iso-forms [14] A CXC motif is present in the a isoform,

with both cysteines being potentially palmitoylated,

and thus conferring membrane targeting to the protein

The b isoform contains a Lin-2,-7 domain that allows

dimerization or interaction with other partners [24]

We found that the two isoforms of hDlg expressed

in hVSMCs are b-I1A-I1B-I3-I5 and b-I1B-I3-I5 Indeed, Godreau et al [25] have described the presence

of two hDlg isoforms expressed in the human atrial myocardium

To date, the I1A and I1B insertions are known to form a src-homology 3 binding domain that may, for example, modulate hDlg self-association, whereas the I3 insertion may direct hDlg to the plasma membrane-associated actin cytoskeleton, particularly through interaction with protein 4.1 [15,23,26,27] The presence

of an I3 insertion in both hDlg isoforms detected in hVSMCs is thus in agreement with our findings indicating that this scaffold protein partly colocalizes with F-actin at the cell periphery To our knowledge, the potential function(s) of the I5 insertion have not yet been investigated

A salient finding of the present study concerns the direct interaction of hDlg with MEK2 Using the PDZ-1-2 domains of hDlg as bait in a yeast two-hybrid screening assay, we identified the MAPK MEK2 as a potential, yet unrecognized, interacting partner of hDlg in human aorta PDZ domains are known to associate with a C-terminally-located X-S⁄ T-X-L ⁄ V motif in their target proteins [8] On the basis of site-directed mutagenesis of both interac-tants, we confirmed the major involvement of the PDZ-2 domain of hDlg in the interaction with the C-terminal sequence RTAV of MEK2 Furthermore,

we observed that hDlg and human MEK2 ectopically expressed in CHO cells partially colocalize in the cytoplasm, thus supporting a direct interaction of the two proteins This interaction was further observed in HEK-293 cells and confluent hVSMCs through coim-munoprecipitation assays performed on endogenous proteins We conducted a phylogenic analysis of the MEK1 and MEK2 amino acid sequence using the Entrez Protein database (http://www.ncbi.nlm.nih.gov/ protein), which revealed a conservation of the MEK2 C-terminal sequence RTAV among mammalian species (human, mouse, rat, cow), thus providing evi-dence of an important role for this sequence in MEK2 functions By contrast, the C-terminal sequence of MEK1 (i.e AAGV) does not correspond

to the PDZ consensus target pattern The results show that MEK2 coimmunoprecipitated with hDlg, whereas MEK1 did not Taken together, these data suggest that the hDlg interaction with MEK2 implicates a functional difference between the two kinases, MEK1 and MEK2

Finally, we raised the hypothesis that hDlg is an upstream, MEK2-specific scaffold protein for the ERK

150

100

50

37

hDlg

MEK2

150

100

50

37

hDlg

MEK2

L IP: hDlg IP: IgG1

150 100

hDlg 50

37

MEK2

150 100

hDlg

L IP: MEK2 IP: IgG

50

37

MEK2

Fig 4 Coimmunoprecipitation of endogenous hDlg and MEK2

pro-teins in human cells Lysates derived from either HEK-293 cells (A,

B) or hVSMCs (C, D) were immunoprecipitated using monoclonal

hDlg antibody (A, C), polyclonal MEK2 antibody (B, D) or a control

IgG Lysates and immunoprecipitates were subjected to western

blotting with hDlg- or MEK2-specific antibodies An experiment

representative of three independent ones is shown in each panel.

signaling pathway Zhang et al [28] have previously

shown that membrane-associated GK-3, a PDZ

domain-containing protein, facilitates lysophosphatidic

acid-induced ERK activation by an unknown

mecha-nism [28] To date, ERK is the only known substrate

for MEK2 and, according to this function, MEK2 is

known to be part of various protein complexes,

includ-ing Raf, ERK and scaffold proteins, that stabilize the

interaction between the ERK cascade members, direct

the complexes to proper subcellular localization, and

control signal duration [1] Under conditions that

allow hDlg and MEK2 coimmunoprecipitation, Raf1

and ERK were not pulled down with hDlg in

hVSMCs Nevertheless, a bioinformatics analysis of

the hDlg amino acid sequence, using a motif scanning

software (http://www.scansite.mit.edu), revealed the

presence of one potential ERK1⁄ 2 D-docking domain

of medium stringency, KRLQIAQLYPISIFI

(con-served amino acids are indicated in bold) [29] located

in the GK domain of hDlg, suggesting that an

hDlg⁄ ERK interaction may still be expected The

highly dynamic nature of D-domain and ERK1⁄ 2

interaction may explain why coimmunoprecipitation

assays failed to detect any hDlg-ERK1⁄ 2 interaction

under our experimental conditions No docking site

for ERK and FXFP domain, the other well known

docking-domain for ERK, was found in the hDlg sequence using the same software To more precisely delineate the location of hDlg in the ERK signaling pathway, it will be necessary to identify other members

of the hDlg⁄ MEK2 complex

In conclusion, in the present study, we report a pre-viously unidentified interaction between the hDlg scaf-fold protein and MEK2, a member of the major ERK signaling pathway, in various human cell types, includ-ing hVSMCs A number of studies have established the involvement of ERK activation in hVSMC migra-tion and proliferamigra-tion, as well as in neointimal forma-tion in a model of balloon arterial injury in rats [30,31] Alternatively, the ERK pathway has been recently implicated in the early secretory pathway in HeLa cells [32] It is of note that, during atherosclero-sis, hVSMCs adopt an active synthetic phenotype [33] Because hDlg and MEK2 colocalize in the perinuclear area of hVSMCs, and hDlg is associated with the endoplamic reticulum and microtubules, hDlg and MEK2 may together regulate the trafficking of newly-synthesized proteins to the cell periphery Therefore,

a better understanding of the role played by hDlg and MEK2 could lead to an improvement of our knowledge about critical signaling events in hVSMC pathophysiology

A

B

C

10 μm

10 μm

10 μm

Fig 5 Transfected and endogenous hDlg

and MEK2 colocalize in mammalian cells.

(A) CHO cells were cotransfected to

express EGFP-hDlg (green signal) and

HA-MEK2 (red signal) (B) Confluent

HEK-293 cells and (C) subconfluent hVSMCs

were stained for endogenous hDlg (green)

and MEK2 (red) The colocalization (overlay)

was analyzed by confocal microscopy.

Materials and methods

Antibodies

The antibodies used were: anti-Dlg (sc-9961) from Santa

Cruz Biotechnology (Santa Cruz, CA, USA); anti-MEK2

(ab32517), anti-MEK1 (ab32091), anti-Raf1 (ab18761),

an-ticalreticulin (ab2907), anti-GM130 (ab52649), anti-RSK1

p90 (ab32114), anti-N-cadherin (ab18203) and

GAP-DH (ab9485) from Abcam (Cambridge, MA, USA);

anti-MEK2 (610236) from BD Biosciences (Franklin Lakes, NJ,

USA); anti-a⁄ b-tubulin (2148), anti-Myc-Tag (2278) and

anti-p44⁄ 42 MAPK (4695) from Cell Signaling Technology

(Beverly, MA, USA); anti-GAL4 activating domain

(630402) from Clontech (Palo Alto, CA, USA); anti-HA.11

(MMS-101R) from Covance (Princeton, NJ, USA);

peroxi-dase-conjugated affiniPure goat anti-(rabbit IgG)

(111-035-144) and anti-(mouse IgG) (115-035-146) from Jackson

Im-munoResearch (West Grove, PA, USA); Mouse TrueBlot

ULTRA: anti-mouse Ig HRP from eBioscience (Carlsbad,

CA, USA); and Alexa Fluor488 goat anti-mouse IgG

highly cross-adsorbed (A11029) and Alexa Fluor555 goat

anti-rabbit IgG highly cross-adsorbed (A21429) from

Invi-trogen (Carlsbad, CA, USA)

RT-PCR assay

Total mRNAs from de-endothelialized human pulmonary

artery segments were extracted in accordance with a method

described previously [34] To evaluate which hDlg isoforms

are expressed in the arterial media, cDNAs were submitted

to PCR using the PlatiniumTaqDNA High Fidelity

Poly-merase (Invitrogen) and specific primers: primers 1, forward:

5¢-GATCTGGTGTAGGCGAGGTCACG-3¢ and reverse:

5¢-GTGGGGAAATATGCTCTTGAGGAGGT-3¢; primers

2, forward: 5¢-GTGACTTCAGAGACACTGCCA-3¢, and

reverse: 5¢-CCCTTTCAAGTGTGATTTCTTC3¢; primers

3, forward: 5¢-ACCAGATGGTGAGAGCGAT-3¢, and reverse:

5¢-CTGTCTTTCATAGGTCCCAAT-3¢ The RT-PCR

products were sequenced (GATC Biotech, Konstanz, Germany)

Expression vectors, cDNA library and

site-directed mutagenesis

cDNAs derived from human mammary arteries were

ampli-fied by RT-PCR using PlatiniumTaqDNA High Fidelity

Polymerase (Invitrogen) and the primers: PDZ-1-2, forward:

5¢-CCGAATTCGAAGAAATCACACTTGAAAGG-3¢, and

reverse: 5¢GGATCCCCATCATTCATATACATACTTGT

GGGTT-3¢; PDZ3, forward: 5¢CCGAATTCCTTGGAGA

TGATGAAATTACAAGGG-3¢, and reverse: 5¢GGATCCA

TTCTTCAGGTCGATATTGTGCAAC-3¢ PCR products

were subcloned by TA-cloning in the PCR2 vector

(Invitro-gen) Inserts were digested by EcoR1 and BamH1 (New

England Biolabs, Beverly, MA, USA) and introduced into

the pGKBT7 vector (Clontech) and sequenced (GATC Bio-tech) The pACT2-MEK2 vector that encodes the 179–400 amino acid sequence of the MEK2 C-terminus resulted from the Human Aorta MATCHMAKER cDNA Library (Clon-tech) To create inactive PDZ domains within the PDZ-1–2 domains, the conserved residues GLGF were mutated to GRRF; similarly, the putative PDZ target sequence, RTAV

in the C-terminus of MEK2 was deleted or mutated to RAAV Mutagenesis was performed by PCR using the QuickChange II Site-Directed Mutagenesis Kit (Strata-gene, La Jolla, CA, USA) in accordance with the manufac-turer’s instructions The sens mutagenic primers were: GRRF-PDZ1: 5¢GAAAGGGGAAATTCAGGGCGTCGT TTCAGCATTGCAGGAGG-3¢; GRRF-PDZ2: 5¢-ATTA AAGGTCCTAAAGGTCGTCGGTTTAGCATTGCTGGA GG-3¢; RAAV-MEK2: 5¢-CACCCACGCGCGCCGCCGT GTGA-3¢ and RTAV-deleted-MEK2: 5¢-CCCGGCACAC CCTAGCGCACCGCCGT-3¢ The resulting plasmids were sequenced

The pEGFPC1-hDlg (b isoform containing the I1B, I3 and I5 insertions) and the pMCL-HA-MEK2 vectors encoding the full-length tagged proteins EGFP-hDlg and HAMEK2 were generous gifts from F Peiretti (INSERM U626, Marseille, France) [35] and N Ahn (University of Colorado, Boulder, CO, USA) [36], respectively

Yeast two-hybrid screening and yeast protein extraction

The yeast reporter strain AH109 was cotransformed by the Human Aorta MATCHMAKER cDNA Library plasmids (Clontech) and the pGKBT7-PDZ-1-2 vector in accordance with the manufacturer’s instructions (Matchmaker Two-Hybrid System 3; Clontech) Bait and library fusion protein interactions were selected by plating the yeasts on a histidine-, adenine-histidine-, leucine- and tryptophan-free medium (SD-LTHA) supplemented with X-a-GAL cDNA clones from positives colonies were isolated using the Yeast Plasmid Isolation Kit from Clontech, used to transform Escherichia coli DH5a bacteria (Invitrogen) and identified by DNA sequencing (GATC Biotech) Yeast proteins were extracted in accor-dance with the urea⁄ SDS method according to the Match-Maker II procedure (Clontech) Protein concentration was evaluated in each sample by measuring A280considering that

a 1 mgÆmL)1 protein solution has an A280of 0.66 Finally,

60 lg of proteins were submitted to western blotting

Cell cultures and transient transfections Cells were cultured in an incubator at 37C with 5% CO2 CHO and HEK-293 cells were maintained with Ham’s F-12 and DMEM high glucose medium (Invitrogen), respec-tively, supplemented with 10% fetal bovine serum (PAA Laboratories, Pasching, Austria) and the antibiotic cocktail (PAA Laboratories): penicillin (5 UÆmL)1), streptomycin

(0.5 lgÆmL)1) and amphotericin B (25 ngÆmL)1) CHO

cells were transfected with the pEGFPC1-hDlg and the

pMCL-HA-MEK2 vectors using Fugene reagent (Roche

Diagnostics, Basel, Switzerland) in accordance with the

manufacturer’s instructions Human lung tissues were

obtained from patients who had undergone surgery for lung

carcinoma at Bichat Hospital (Paris, France) Segments of

pulmonary artery were dissected from macroscopically

nor-mal regions of the diseased lungs and arterial media

sam-ples were digested with 0.3% (w⁄ v) collagenase (Sigma,

St Louis, MO, USA) and 0.05% (w⁄ v) pancreatic elastase

(Sigma) for 2 h at 37C Isolated hVSMCs were cultured

in Smooth Muscle Cell Basal medium 2 (Promocell,

Heidel-berg, Germany) supplemented with the Smooth Muscle

Cells Growth Medium 2 kit (Promocell) and the antibiotic

cocktail Human internal mammary arteries were obtained

from patients undergoing coronary bypass surgery in the

Department of Cardiovascular Surgery at Bichat Hospital

All experiments involving the use of human tissues and cells

were approved by the INSERM Ethics Committee, in

con-formity with Helsinki standards, with these tissues being

considered as surgical waste in accordance with French

Ethical Laws (L.1211-3-L.1211-9) Written consent was

obtained from each patient

Cell lysate fractionation

Arterial pulmonary hVSMCs were lysed in 2 mL of

10 mm Tris-HCl, 150 mm NaCl, 5 mm EDTA (pH 7.4)

supplemented with Protease Inhibitor Cocktail (P8340)

(Sigma) by two freeze⁄ thaw cycles Lysates were

preclari-fied by centrifugation at 800 g for 15 min at 4C Half

the volume (1 mL) was kept as total lysate, whereas the

other half was submitted to an ultracentrifugation

(105 000 g) for 1 h at 4C The resulting pellets

(mem-brane fraction) were resuspended in 1 mL of lysis buffer

supplemented with 1% (v⁄ v) Triton X-100 The

superna-tants corresponded to the cytosolic fraction Protein

con-centrations were determined in each sample using the

BCA Protein Assay (Pierce, Rockford, IL, USA) Finally,

the same volumes of all three fractions, corresponding to

20 lg of proteins in the total lysates, were submitted to

western blotting

Immunocytochemistry

Cells were grown on four-chamber Permanox Lab-Tek

slides (Nalgene Nunc Corp., Rochester, NY, USA) coated

(HEK-293) or not (hVSMCs and CHO) with fibronectin

Cells were fixed with 3.7% (w⁄ v) paraformaldehyde for

15 min, permeabilized with 0.1% (v⁄ v) Triton X-100 for

4 min and blocked with 1% (w⁄ v) BSA Wells were then

incubated with the suitable primary antibody for 1 h at

room temperature Negative control staining was performed

using nonrelevant IgG or whole rabbit serum Cells were

labeled with the appropriate Alexa Fluor fluorochrome-conjugated secondary antibody F-actin was stained with Alexa Fluor633conjugated phalloidin (Invitrogen) Finally, slides were mounted in DAKOCytomation Fluorescent Mouting Medium (Dako, Glostrup, Denmark) and cells were imaged using a confocal microscope (LSM510 META; Carl Zeiss, Oberkochen, Germany)

Immunoprecipitation Cells were lysed with 1% (v⁄ v) Igepal CA-630, 20 mm Tris-HCl, 75 mm NaCl (pH 6.8) [35], supplemented with Prote-ase Inhibitor Cocktail and PhosphatProte-ase Inhibitor Cocktail 1 and 2 (Sigma) Lysates were preclarified by centrifugation (15 000 g at 4C for 15 min) Immunoprecipitation was performed by incubating 600 lg of proteins with 2 lg of antibody for 2 h at 4C Irrelevant IgG were used as con-trols Magnetic beads (30 lL; Ademtech, Pessac, France) coupled with Protein A or to Protein G were used to pre-cipitate the immunocomplexes in accordance with the man-ufacturer’s instructions Immunoprecipitates were finally eluted from the beads by boiling for 5 min in a SDS⁄ PAGE buffer containing bmercaptoethanol Samples were submit-ted to western blotting

Western blotting Samples in Laemmli buffer were separated by SDS⁄ PAGE Proteins were then transferred onto nitrocellulose mem-branes (AmershamHybondECL; Amersham Bioscience, Little Chalfont, UK), membranes were blocked with NaCl⁄ Tris-Tween containing 5% (w ⁄ v) skimmed milk or BSA for 1 h at room temperature, incubated overnight with the primary antibody at 4C and, finally, with the suitable secondary antibody coupled with peroxydase Immune complexes were revealed by enhanced chemiluminescence (ECL+; Amersham Bioscience) and vizualized by expo-sure to films (Amersham HyperfilmECL; Amersham Bioscience)

Immunohistochemistry Serial frozen sections of human mammary artery were fixed with acetone and treated with 3% (v⁄ v) H2O2in deionized

H2O to quench endogenous peroxydase activity Nonspe-cific binding was blocked with NaCl⁄ Tris containing 0.02% (v⁄ v) Tween 20 and 0.06% (w ⁄ v) casein (Sigma) Slides were incubated for 90 min at room temperature with hDlg antibody or an irrelevant IgG1 as control Labeling of the primary antibody was carried out using an appropriate bio-tinylated secondary antibody (Vectastain ABC complex; Vector Laboratories, Inc., Burlingame, CA, USA) and staining was obtained using the DAB substrate chromogen system (Dako) Sections were counterstained with Mayer’s haematoxylin (Sigma)

The authors are grateful to Xavier Norel and the

labo-ratory of Anatomy and Pathological Cytology, CHU

X, Bichat, for providing the pulmonary tissues We

would also like to thank Mary Pellegrin-Osborne for

her kind editorial assistance

References

1 Kolch W (2005) Coordinating ERK⁄ MAPK signalling

through scaffolds and inhibitors Nat Rev Mol Cell Biol

6, 827–837

2 Ramos JW (2008) The regulation of extracellular

signal-regulated kinase (ERK) in mammalian cells Int J

Biochem Cell Biol 40, 2707–2719

3 Pouyssegur J, Volmat V & Lenormand P (2002) Fidelity

and spatio-temporal control in MAP kinase (ERKs)

signalling Biochem Pharmacol 64, 755–763

4 Raman M, Chen W & Cobb MH (2007) Differential

regulation and properties of MAPKs Oncogene 26,

3100–3112

5 Teis D, Wunderlich W & Huber LA (2002) Localization

of the MP1-MAPK scaffold complex to endosomes is

mediated by p14 and required for signal transduction

Dev Cell 3, 803–814

6 Vaidyanathan H, Opoku-Ansah J, Pastorino S,

Renga-nathan H, Matter ML & Ramos JW (2007) ERK MAP

kinase is targeted to RSK2 by the phosphoprotein

PEA-15 Proc Natl Acad Sci USA 104, 19837–19842

7 Funke L, Dakoji S & Bredt DS (2005)

Membrane-asso-ciated guanylate kinases regulate adhesion and plasticity

at cell junctions Annu Rev Biochem 74, 219–245

8 Jelen F, Oleksy A, Smietana K & Otlewski J (2003)

PDZ domains – common players in the cell signaling

Acta Biochim Pol 50, 985–1017

9 Round JL, Humphries LA, Tomassian T, Mittelstadt P,

Zhang M & Miceli MC (2007) Scaffold protein Dlgh1

coordinates alternative p38 kinase activation, directing

T cell receptor signals toward NFAT but not

NF-kap-paB transcription factors Nat Immunol 8, 154–161

10 Laprise P, Viel A & Rivard N (2004) Human homolog

of disc-large is required for adherens junction assembly

and differentiation of human intestinal epithelial cells

J Biol Chem 279, 10157–10166

11 Leonoudakis D, Mailliard W, Wingerd K, Clegg D &

Vandenberg C (2001) Inward rectifier potassium

chan-nel Kir2.2 is associated with synapse-associated protein

SAP97 J Cell Sci 114, 987–998

12 Murata M, Buckett PD, Zhou J, Brunner M, Folco E

& Koren G (2001) SAP97 interacts with Kv1.5 in

heter-ologous expression systems Am J Physiol Heart Circ

Physiol 281, H2575–H2584

13 Godreau D, Vranckx R, Maguy A, Rucker-Martin C,

Goyenvalle C, Abdelshafy S, Tessier S, Couetil JP &

Hatem SN (2002) Expression, regulation and role of the MAGUK protein SAP-97 in human atrial myocardium Cardiovasc Res 56, 433–442

14 Schluter OM, Xu W & Malenka RC (2006) Alternative N-terminal domains of PSD95 and SAP97 govern activ-ity-dependent regulation of synaptic AMPA receptor function Neuron 51, 99–111

15 McLaughlin M, Hale R, Ellston D, Gaudet S, Lue RA

& Viel A (2002) The distribution and function of alter-natively spliced insertions in hDlg J Biol Chem 277, 64066412

16 Ishidate T, Matsumine A, Toyoshima K & Akiyama T (2000) The APC-hDLG complex negatively regulates cell cycle progression from the G0⁄ G1 to S phase Oncogene 19, 365–372

17 Sans N, Racca C, Petralia RS, Wang YX, McCallum J & Wenthold RJ (2001) Synapse-associated protein 97 selec-tively associates with a subset of AMPA receptors early

in their biosynthetic pathway J Neurosci 21, 7506–7516

18 Mauceri D, Cattabeni F, Di Luca M & Gardoni F (2004) Calcium⁄ calmodulindependent protein kinase II phosphorylation drives synapse-associated protein 97 into spines J Biol Chem 279, 23813–23821

19 Jeyifous O, Waites CL, Specht CG, Fujisawa S, Schubert

M, Lin EI, Marshall J, Aoki C, de Silva T, Montgomery

JM et al (2009) SAP97 and CASK mediate sorting of NMDA receptors through a previously unknown secre-tory pathway Nat Neurosci 12, 1011–1019

20 Gardoni F, Mauceri D, Marcello E, Sala C, Di Luca M

& Jeromin A (2007) SAP97 directs the localization of Kv4.2 to spines in hippocampal neurons: regulation by CaMKII J Biol Chem 282, 28691–28699

21 Manneville JB, Jehanno M & Etienne-Manneville S (2010) Dlg1 binds GKAP to control dynein association with microtubules, centrosome positioning, and cell polarity J Cell Biol 191, 585–598

22 Etienne-Manneville S, Manneville JB, Nicholls S, Ferenczi MA & Hall A (2005) Cdc42 and Par6-PKCzeta regulate the spatially localized association of Dlg1 and APC to control cell polarization J Cell Biol 170, 895–901

23 Lue RA, Marfatia SM, Branton D & Chishti AH (1994) Cloning and characterization of hDlg: the human homologue of the Drosophila discs large tumor suppres-sor binds to protein 4.1 Proc Natl Acad Sci USA 91, 9818–9822

24 Doerks T, Bork P, Kamberov E, Makarova O, Muecke

S & Margolis B (2000) L27, a novel heterodimerization domain in receptor targeting proteins Lin-2 and Lin-7 Trends Biochem Sci 25, 317–318

25 Godreau D, Vranckx R, Maguy A, Goyenvalle C & Hatem SN (2003) Different isoforms of synapse-associ-ated protein, SAP97, are expressed in the heart and have distinct effects on the voltage-gated K+channel Kv1.5 J Biol Chem 278, 47046–47052