Báo cáo khoa học: Identification of NF1 as a silencer protein of the human adenine nucleotide translocase-2 gene pptx

NF1 purified from rat liver and HeLa cell nuclei bind to both silencer Site-2 and Site-3, resulting in a DNase I footprint identical to that obtained with purified recombinant NF1.. A thir

Identification of NF1 as a silencer protein of the human adenine nucleotide translocase-2 gene

Peter Barath1,2, Daniela Poliakova1,2, Katarina Luciakova1,2and B Dean Nelson1

1

Department of Biochemistry and Biophysics, Arrhenius Laboratories, Stockholm University, Sweden;2Cancer Research Institute, Slovak Academy of Sciences, Bratislava, Slovak Republic

The human adenine nucleotide translocase-2 (ANT2)

pro-moter contains a silencer region that confers partial

repres-sion on the heterologous herpes simplex virus thymidine

kinase (HSVtk) promoter [Barath, P., Albert-Fournier, B.,

Luciakova, K., Nelson, B.D (1999) J Biol Chem 274,

3378–3384] Two sequences in the silencer (Site-2 and Site-3)

are protected in the DNase I assay in vitro, and one of these

is a repeated GTCCTG element previously shown to act as

the active repressor element We have now purified the DNA

binding protein, and identified it using MALDI-TOF MS

as a 33-kDa member of the nuclear factor 1 (NF1) family of

transcription factors NF1 purified from rat liver and HeLa

cell nuclei bind to both silencer Site-2 and Site-3, resulting in

a DNase I footprint identical to that obtained with purified recombinant NF1 Furthermore, transient transfection experiments with reporter constructs containing mutated silencer Site-2 and/or Site-3 show that both sites contribute

to repression of the HSVtk promoter Finally, chromatin immunoprecipitation analysis reveals that NF1 is bound

to both elements on the endogenous HeLa cell ANT2 promoter Our data support the belief that NF1 acts as a repressor when bound to silencing Site-2 and Site-3 of the ANT2 gene

Keywords: adenine nucleotide translocase; NF1; promoter regulation; silencer protein; transcription

Two major isoforms of the adenine nucleotide translocase

(ANT) are expressed in mammalian cells Both catalyse the

exchange of mitochondrial ATP for cytosolic ADP, thereby

playing key roles in maintaining the cytosolic

phosphory-lation potential, adenylate charge, and the energy status

of the cell The two forms, ANT1 and ANT2 [1–4], are

differentially expressed in mammalian tissue ANT1 is

expressed predominately in heart and skeletal muscle [5,6]

whereas ANT2 is more widely expressed [5,7,8] ANT2

is strongly growth regulated [9,10], and expression of the

gene is downregulated in growth arrested cells [10] and

re-activated in cells entering the G1growth phase

Activa-tion of ANT2 expression is mediated at the level of

transcription [10]

To understand ANT2 expression, we have undertaken

a study of its promoter Constitutive ANT2 expression is

maintained by two synergistically interacting Sp1 elements

(the AB boxes) in the proximal promoter [11] However, activation via the AB box Sp1 is modulated by three separate repressor regions One of these is an Sp1 binding element (C box) juxtaposed to the transcriptional start site, which, when occupied, decreases ANT2 expression several-fold [11] Repression appears to involve a direct interaction between Sp1 bound to the AB and C boxes [12] A second repressor region, that is responsible for ANT2 down regulation in growth-arrested cells, has recently been identified in the distal promoter [10] This region contains two DNA elements, Go-1 and Go-2, that bind nuclear factor 1 (NF1) in arrested cells, but not in growth-activated cells [13] NF1 binding is associated with growth arrest repression of ANT2 transcription

A third repressor (silencer) region, which does not participate in growth arrest repression of the gene [13], but confers repression on a heterologous herpes simplex virus thymidine kinase (HSVtk) reporter gene, has also been located in the ANT2 promoter between the AB activation boxes and the Go repressor region [14] Two DNA sequences in the silencer region (Site-2 and Site-3) are strongly protected in the DNase I assay One of these (Site-2) is a repeated element (GTCCTG) shown to have a role in repressing the HSVtk promoter [14] In the present study, we have purified the silencer element binding protein, and identified it as a member of the NF1 family

of proteins (see [15] for review) NF1 binds to Site-2 and Site-3 both in vitro and in vivo, and repression of the heterologous HSVtk promoter is relieved by mutating either element Thus, NF1 plays a major role in regulating ANT2 expression by modulating (repressing) the efficiency with which Sp1 functions as a constitutive activator

Correspondence to K Luciakova, Cancer Research Institute, Slovak

Academy of Sciences, Vlarska 7, 833 91 Bratislava, Slovak Republic.

Fax: + 421 259327250, Tel.: + 421 259327110,

E-mail: Katarina.Luciakova@savba.sk

Abbreviations: ANT, adenine nucleotide translocase; NF1, nuclear

factor 1; CAT, chloramphenicol acetyl transferase; HSVtk, herpes

simplex virus thymidine kinase; wt, wild-type; mut, mutant;

Site-2 and Site-3, NF1 binding elements 2 and 3 in the

silencer region; Go-1 and Go-2, Go NF1-binding repressor

elements 1 and 2.

Note: P Barath and D Poliakova contributed equally to this work.

(Received 5 December 2003, revised 5 March 2004,

accepted 15 March 2004)

Materials and methods

Plasmid preparation

ANT2 promoter fragments ()374/)235) bearing the

wild-type (wt) or mutated Site-3 ()374/)347) elements were

prepared by PCR using the wt or mutated Site-3 element

(5¢-GGGTTCTTTTTAAATCCCTGTAGC-3¢, underlined

nucleotides represent mutation of the wt, GGC, sequence)

as the 5¢ primer The M13 reverse primer from

HSVtk-chloramphenicol acetyltranferase (CAT) [16] was used as

the 3¢ primer Template DNAs [HSVtk-CAT-ANT2 ()413/

)235)] carrying the wt or the mutated Site-2 element were

described previously [14] PCR was performed with Vent

DNA polymerase (BioLabs) according to the manufacturer

Amplified DNA containing the wt and/or mutated Site-2

and Site-3 were digested with BglII and ligated into

HSVtk-CAT plasmid All clones were checked for fragment size

and orientation by digestion with restriction enzymes, and

mutations were verified by sequencing

A DNase I footprint probe containing Site-2, 3 and Go-2

elements was made by adding XbaI sites to both ends of

ANT2)825/)795 [13] This oligonucleotide, which includes

Go-2, was ligated into the XbaI site of the pCAT-ANT2

()546/)235)wt [14] The clones were checked by restriction

enzyme digestion and sequencing

Cell culture and transfection

Growth and transfection of HeLa cells experiments were

performed as by Li et al [11] Five micrograms of reporter

plasmid DNA containing the CAT gene and 2 lg of control

luciferase plasmid DNA (pGL3, Promega) were used for

transfection CAT and luciferase activities were measured as

described [17]

DNase I protection assay

Rat liver and HeLa nuclear extracts were prepared as

described previously [18,19] The DNase I protection assay

was performed as described [17] Radioactive probes were

prepared by PCR using 5¢ [32P]-labelled CAT primer, the

M13 primer and pCAT-ANT2-()546/)235)wt [14] or

pCAT-Go-2-ANT2()546/)235)wt [13] as the template

Electrophoretic mobility shift (EMSA) and supershift

assay

EMSA analyses were performed as by Li et al [11] For

supershift experiments, 2 lL of antibody raised against

human NF1-C (rabbit polyclonal antiserum, 8199, kindly

provided by N Tanese, New York University Medical

Center, NY, USA) were added to the binding reaction and

incubated on ice for a further 15 min Complexes were

separated on 4% nondenaturing polyacrylamide gel The

gels were dried and autoradiographed Competitor DNAs

used in EMSA analysis were: NF1 wt, 5¢-TTTTG

GATTGAAGCCAATATGATA-3¢; NF1 mut, 5¢-TTTT

GGATTGAATAAAATATGATA-3¢; Site-2 wt, 5¢-GCGT

CTCACCCTAGTCCTGGTCCTGCTCCAAGGGTTTT

TGTCC-3¢; Site-2 mut, 5¢-GCGTCTCACCCTAGTAA

TGGTAATGCTCCAAGGGTTTTTGTCC-3¢; Site-3 wt,

5¢-GGGTTCTTTTGGCATCCCTGTAGC-3¢; Site-3 mut, 5¢-GGGTTCTTTTTAAATCCCTGTAGC-3¢

Chromatin immunoprecipitation Chromatin immunoprecipitation of NF1 from exponenti-ally growing HeLa cells was performed as described previously [13] Immunoprecipitation was performed with either 2 lL of antiserum 8199 prepared against a central domain of the NF1 C protein (kindly provided by

N Tanese) or 2 lL of antirat liver b-F1ATPase (unrelated protein) Amplification of immunoprecipitated DNA frag-ments (2 lL) was performed using the primer set: )525

(5¢-GCTACAGGGATGCCAAAAGAACCC-3¢) for the Site-3, and primer set )346 (5¢-GCGTCTCACCCTAGT

TCCAGAGAACA-3¢) for the Site-2 element PCR was performed for 32 cycles with 30 s of denaturation at 94C, followed by 30 s of annealing at 60C and 30 s of extension

at 72C The last step included extension for 10 min at

72C

NF1 purification from nuclear extracts Rat liver nuclei were purified as described by Kadonaga [20] Nuclei from HeLa cells were prepared according to Dignam et al [18] Proteins were extracted from nuclei by addition of an equal volume of extraction buffer (20 mM Hepes pH 7.9, 820 mMNaCl, 5 mMMgCl2, 1 mMEDTA,

1 mM EGTA, 0.5 mM phenylmethanesulfonyl fluoride,

1 mM benzamidin, 0.5 mM dithiothreitol) The various fractionation steps are described by Luciakova et al [13] Site-2 and Site-3 binding activity in all fractions was monitored by the in vitro DNase I protection assay The DNA affinity column, used as the last step in the purification, was prepared with an oligonucleotide contain-ing either the Site-2 and Site-3 elements (nucleotides)404/ )240) or the Go-2 element (nucleotides )825/)792, [13]) The columns were prepared according to Kadonaga [20] Proteins were eluted in two salt steps (200 mMand 500 mM NaCl) in 20 mM Hepes pH 7.9, 5 mM MgCl2, 5 mM 2-mercaptoethanol, 5% glycerol, 0.1% Nonidet P-40 Protein fractions were stored at)70 C

Size exclusion chromatography was carried out on samples fractions from the Heparin Sepharose XK 16/20 column that contained Site-2/Site-3 DNase I footprinting activity (see above) A Superdex 200 HR 10/30 column (Amersham Biosciences) equilibrated in elution buffer (20 mMHepes pH 7.9, 420 mMNaCl, 5 mM MgCl2) was loaded with 0.25 mL of sample The column was eluted at 0.1 mLÆmin)1 Fractions of 0.5 mL were collected after the void volume of the column

SDS/PAGE and protein identification by MALDI-TOF MS Samples from the DNA affinity column were precipitated for 20 min on ice in 10% trichloroacetic acid, followed by a

15 min centrifugation at 10 000 g and two washes with ice-cold acetone Samples were air dried, dissolved in sample buffer, and separated in 10% SDS/PAGE Proteins were visualized by silver staining and bands of interest were cut

out In-gel tryptic digestion and sample preparation was

carried out as described by Luciakova et al [13]

MALDI-TOF analysis was performed in reflector mode using a

(Applied Biosystems) Internal calibration was performed

with autodigested trypsin Data were analysed using

MOVERZsoftware (Proteometrics, LLC, Winnipeg, Canada),

and database searches were done with MASCOT (http://

www.matrixscience.com)

Results

Purification and identification of the silencer binding

proteins

The promoter of the human ANT2 gene contains three

repressor regions (see Fig 1A for a summary) The silencer

region between nucleotides )412 and )235, has been

characterized and shown by DNase I protection to include

three protein binding sites [14], two of which (Sites-2 and -3,

Fig 1A and B) are consistently and strongly protected

in vitro To identify the Site-2 and Site-3 binding proteins,

they were purified from rat liver nuclei using the)404/)240

ANT2 fragment (termed Site-2/Site-3 oligonucleotide) as a

DNA affinity probe Purification was monitored using the

DNase I assay As seen in Fig 2, proteins that protect Sites

2 and 3 from DNase I coelute from both the Resource Q (Fig 2A) and the DNA affinity (Fig 2B) columns DNA affinity is the last step in the purification scheme Foot-printing activity is eluted from the DNA affinity column only in fractions 1 and 2 of the low salt (200 mMNaCl) wash (Fig 2B) SDS/PAGE analysis revealed the presence of several polypeptides in fractions 1 and 2 (Fig 2C) How-ever, only one, with an apparent mass of around 33 kDa, is found specifically in the active fractions (Fig 2B) All other polypeptides in low salt fractions 1 and 2 are also present in inactive fractions eluted with 500 mMsalt

The 33-kDa polypeptide (marked with a dot in Fig 2C) was identified as a member of the NF1 family of transcrip-tion factors [15] by trypsin fragment mass analysis using MALDI-TOF MS Out of 13 peptide masses, nine (69%) were matched to different isoforms of NF1 from different species covering up to 58% of the total protein sequence The matched peptides originate from a conserved, 240-residue N-terminal DNA binding domain [21] (Fig 2D), thus excluding the possibility of determining the specific isoform

of NF1 (for review see [15]) involved No other transcription factors were detected in the purified preparations

Identification of a 33 kDa NF1 polypeptide is consistent with our earlier studies in which a 33–38 kDa silencer-binding protein was suggested based on crosslinking and South-western analysis with HeLa cell nuclear extracts [14] However, gel filtration of the rat liver Heparin Sepharose fraction shows that Site-2/Site-3 binding activity (33 kDa NF1) is present only in fractions 12 and 13 (Fig 3A) which contain polypeptides of a greater mass These data suggest that the Site-2/Site-3 binding protein exists as a complex, most likely as a dimer

Proteins that bind the Site-2/Site-3 elements and the upstream growth arrest (Go) elements copurify NF1 also binds two upstream growth arrest elements (Go-1 and Go-2) in the ANT2 promoter [13] To determine if the Site-2/Site-3 and Go-element binding activities are identical,

we constructed a DNAse I protection probe that included both the Go-2 and the Site-2/Site-3 elements (see Methods)

As seen in Fig 3A, Site-2/Site-3 and Go-2 binding proteins comigrate during gel filtration, suggesting that the same or similar proteins bind to both sets of elements As a further test, Go element binding-proteins were purified from rat liver nuclei by DNA affinity chromatography, and tested in the DNase I protection assay (Fig 3B) Identical footprints were obtained on the Site-2/Site-3 elements using proteins purified from the Go- or the Site-2/Site-3 affinity columns These data support the notion that NF1 footprints both the

Go and Site-2/Site-3 elements However, the affinity of NF1 for the Site-2/Site-3 elements is lower than for the Go element, as indicated by elution from the Site-2/Site-3 affinity column in low (200 mM) salt, whereas elution of footprinting activity from the Go affinity column requires

500 mMNaCl (Fig 3B)

Purified recombinant NF1 binds to the Site-2/Site-3 elements To obtain further proof that NF1 is the Site-2/ Site-3 binding protein, DNase I protection analysis was carried out using purified recombinant human NF1 As anticipated, recombinant NF1 protected both Site-2 and Site-3 (Fig 4A) Furthermore, the pattern of protected and

Fig 1 Summary of the human ANT2 promoter region (A) Repressor

elements in the Sp1 C box, the silencer region (Site-2/Site-3), and Go

regions of the human ANT2 promoter are shown in grey The two Sp1

AB box activation elements are shown as open symbols (B) DNA

sequence of the silencer region (nucleotides )413/)235) of the human

ANT2 gene Data are from Barath et al [14] Lines above the

sequences mark the Site-1, Site-2, and Site-3 regions footprinted in the

in vitro DNase I protection assay The arrows in Site-2 indicate a

repeated hexanucleotide (GTCCTG) element identified as an active

repressor element [14] The arrow in the Site-3 indicates a NF1

protein-binding half site described in the present study The mutations

intro-duced into the Site-2 and Site-3 elements are indicated above the

sequence.

hypersensitive sites produced by recombinant NF1 are

similar, if not identical, to those observed with rat liver

nuclear extracts (Figs 2 and 3A), affinity purified NF1 from

rat liver (Figs 2B and 3B and [13]) and HeLa nuclear extracts [14] NF1 did not footprint Site 1 [14] of the silencer region, which is also present in the probe used in Fig 4A

Fig 2 Purification and identification of the silencer Site-2 and Site-3binding-protein Rat liver nuclear extracts were purified as described (A) Fractions eluted from Heparin Sepharose in a 100 m M to 300 m M NaCl linear gradient, or (B) fractions eluted from the DNA affinity column in 200

or 500 m M NaCl were monitored for DNase I protection activity using the ANT2–546/ )235 silencer region as a probe Activity was also determined in samples loaded onto the affinity column (S) and in flow through (F) fractions Location of Site-2 and Site-3 elements are indicated on the right Asterisks mark hypersensitive sites, open circles mark protected nucleotides (C) SDS/PAGE analysis of polypeptide eluted from the DNA affinity column The dot beside lane 1 indicates the polypeptide band identified as NF1 by MALDI-TOF MS (D) Peptide mass alignment Sequences in bold match the trypsin fragment masses from the SDS band in (C).

A direct DNase I protection analysis comparing HeLa cell

nuclear extract, DNA-affinity purified proteins from HeLa

cells and purified recombinant human NF1 show the same

pattern of protected nucleotides (Fig 4B), thus confirming

that NF1 binds to the silencer elements

EMSA also showed that oligonucleotides bearing Site-2

and Site-3 elements inhibit binding of HeLa nuclear extract

proteins to a bipartite consensus NF1 element (Fig 4C), but

less efficiently than the consensus NF1 element itself

Purified recombinant NF1 exhibit the same specific binding

as the HeLa nuclear extract proteins Supershift experiments

confirm the identity of NF1 as the factor bound to Site-2/

Site-3 (Fig 4C)

In vivo occupation of Site-2 and Site-3 as revealed

by chromatin immunoprecipitation (ChIP) analysis

To determine if Site-2 and Site-3 are occupied in vivo, ChIP

analysis was carried out on HeLa cells (Fig 5) Both

elements are occupied by NF1 in vivo (Fig 5) as detected

by EtBr staining of amplified products Together, the above

experiments demonstrate clearly that NF1 is the Site-2 and

Site-3 binding protein

Site-2 and Site-3 both contribute to repression of the ANT

promoter Deleting the Site-2/Site-3 silencer elements

eliminates repression of the HSVtk promoter in

transfected HeLa cells [14] To study the roles of Site-2

and Site-3 individually, they were mutated and placed in

front of the HSVtk promoter These constructs were

transfected into HeLa cells Fig 6 shows that promoter

activity is increased approximately threefold when both sites

are mutated, but appear to be only partially activated when

the elements are mutated individually Thus, it seems likely

both elements participate in repression

Discussion

We earlier reported the presence of a silencer region in the human ANT2 promoter that conferred repression on the heterologous HSVtk promoter [14] Three protein-binding sites were found by in vitro DNase I footprinting, one of which contained a GTCCTG repeat required for repres-sion A 33–38 kDa DNA binding protein was purified using the GTCCTG element (silencer Site-2) as an affinity probe In the present study, we identify the GTCCTG binding protein as a member of the NF1 family of transcription factors We also show that NF1 binds to a second silencer element (Site-3, Fig 1) upstream of the GTCCTG repeat, and that both elements contribute to repression of the HSVtk promoter Furthermore, NF1 occupies both silencer elements in HeLa cells in vivo, implicating NF1 as a possible repressor even under endogenous conditions

The NF1 polypeptide identified in the present experi-ments exhibits a mass of 33 kDa, which is slightly less than that reported in our previous study [14], but fits well with the mass of the protein that cross-linked to the GTCCTG element [14] We also reported the copurifica-tion of p33 together with a 49-kDa polypeptide [14] p49 appeared not to bind DNA, but was loosely associated with p33, perhaps enhancing p33 binding [14] Using the present purification scheme for the Site-2/Site-3 binding proteins, which is substantially modified from that used in [14], p49 does not appear as a major polypeptide in the purified fractions This result is consistent with the loose association to p33 observed earlier However, partially purified Site-2/Site-3 binding activity (NF1) moves on a gel filtration column with an apparent molecular mass greater than 33 kDa, suggesting that it exists as a complex, and most likely as a dimer

Fig 3 The Site-2 and Site-3 silencer

elements and the Go-2 repressor binding

proteins cofractionate (A) Rat liver nuclear

extracts were fractionated on a Heparin

Sepharose column Eluted fractions (1–19)

were monitored by the DNase I assay using a

probe engineered to include both the Site-2

and Site-3 silencer elements and the Go-2

repressor element Asterisks and open circles

mark hypersensitive and protection

nucleo-tides, respectively (B) Rat liver nuclear

proteins were purified from a DNA affinity

column containing the Go-2 element as a

binding matrix [13] (Materials and methods).

Site-2, Site-3, and Go-2 elements are indicated

on the right Asterisks denote hypersensitive

and open circles protected nucleotides.

Repression of the HSVtk promoter via the silencer region

is partially relieved by mutating Site-2 or Site-3, suggesting

that NF1 bound to these elements cooperate in some

manner NF1 binding to Site-2 and Site-3 is not

co-operative, because Site-3 remains protected in the DNase I

assay when Site-2 is mutated [14] Thus, repression most

probably requires a concerted action between NF1s bound

to the two sites, or with a third component The possibility

of an additional component is consistent with our observa-tions concerning p49 (see above) However, this issue remains to be resolved In any event, the results of ChIP analysis demonstrating the in vivo occupation of Site-2 and Site-3 by NF1 strongly suggest that these interactions are of physiological relevance

Fig 4 Identification of the Site-2 and Site-3 binding protein as a member of the NF1 family

of transcription factors (A) Binding of purified, recombinant NF1 to the Site-2 and Site-3 elements was monitored by the DNase I protection assay of ANT2 oligonucleotide ( )546/)235) Only the coding strand is shown Competitor oligonucleotides contained either

a wt or mutated (mut) Site-2, Site-3 or NF1 element Asterisks denote hypersensitive nucleotides, open circles denote protected nucleotides (B) Proteins from HeLa cells and purified recombinant NF1 protect the same nucleotides in the ANT2 silencer region Asterisks denote hypersensitive nucleotides and open circles denote protected nucleotides

in the Site-2/Site-3 region (C) EMSA and supershift analysis was performed with 10 lg

of HeLa nuclear extract or with purified recombinant NF1 (as indicated) and the

32 P-labelled oligonucleotide probe containing

a NF1 bipartite consensus binding sequence (probe NF1 wt, Santa Cruz Biotechnology) Wild-type (wt) or mutated (mut) competitor oligonucleotides were added The NF1 element was added in 50-fold excess, and oligonucleotides containing the Site-2 ( )339/ )310) or Site-3 element ()374/)347) were added in 100-fold excess Samples in lanes marked with Ab NF1 were incubated with antibody 8199 (Materials and methods) Preimmune serum was used as a control for supershift experiments The major shifted complex is marked by an arrow Free probe is seen near the bottom of the gel.

The NF1 family of proteins plays a wide role in

replication of several viral DNAs and in transcription of

many cellular genes A significant role for NF1 proteins

in regulating the growth state, hormonal induction and

repression and oncogenic processes has been also described

(see [15] for review) The NF1 family is composed of four

genes, NF1-A, -B, -C and -X (see [15] for review), and a

large number of splice variants of each gene [22–24] Most

expressed isoforms contain a highly conserved 240-residue,

N-terminal DNA binding domain Because our

identifica-tion of NF1 by MALDI-TOF MS is based primarily on

peptide mass matches within the conserved DNA binding

domain, we cannot distinguish between the various

isoforms Furthermore, NF1 exist in the cell as homodimers

or heterodimers [25], and the large number of possible dimers that can be formed complicate identification of the active species on any particular promoter

Several isoforms of NF1 can act as transcription repres-sors [26–30], and in some cases repressor domains have been located within the protein [30,31] Furthermore, repression/ activation by individual NF1 isoforms can also depend on cell context [13,30–32], suggesting that the molecular action

of NF1 depends on cell-specific factors Indeed, a variety of factors is reported to interact directly with NF1; including coactivators p300/CBP and SRC-1 [33], histone H3 [34] and the general transcription factor Sp1 [35], TFIIB [36], and TAFII155 [37] Thus, the molecular mechanisms of NF1 repression on ANT2 remain to be elucidated

The physiological role of the Site-2/Site-3 repressor elements remains to be investigated Deletion of these elements has no apparent influence on growth-arrest repression of ANT2 exerted via the Go-2/Go-3 growth-arrest elements [13] Thus, we speculate that NF1 bound to Site-2/Site-3 elements most probably has a role in adjusting the tissue-specific constitutive expression of ANT2, similar

to that proposed for the unique Sp1 repressor element (C box) juxtaposed to transcription start [11]

Acknowledgements

This study was supported by the Swedish Research Council (to B D N.), the Slovak Science and Technology Assistance Agency (APVT) Grant 26-002102 and the Slovak Grant Agency (VEGA) 2/3087/23 (to

K L.) The authors thank O¨ Wrange for recombinant human NF1 and

N Tanese for the generous gift of antihuman NF1-C serum.

References

1 Neckelmann, N., Li, K., Wade, R.P., Shuster, R & Wallace, D.C (1987) cDNA sequence of a human skeletal muscle ADP/ATP translocator: Lack of a leader peptode, divergence from a fibro-blast translocator cDNA, and coevolution with mitochondrial DNA genes Proc Natl Acad Sci USA 84, 7580–7584.

2 Houldsworth, J & Attardi, G (1988) Two disctinct genes for ADP/ATP translocase are expressed at the mRNA level in adult human liver Proc Natl Acad Sci USA 85, 377–381.

3 Cozens, A.L., Runswick, M.J & Walker, J.E (1989) DNA sequences of two expressed nuclear genes for human mitochon-drial ADP/ATP translocase J Mol Biol 206, 261–280.

4 Ku, D.-H., Kagan, J., Chen, S.-T., Chang, C.-D., Baserga, R & Wurzel, J (1990) The human fibroblast adenine nucleotide translocator gene Molecular cloning and sequencing J Biol Chem 265, 16060–16063.

5 Stepien, G., Torroni, A., Chung, A.B., Hodge, J.A & Wallace, D.C (1992) Differential expression of adenine nucleotide trans-locator isoforms in mammalian tissues and during muscle cell differentiation J Biol Chem 267, 14592–14597.

6 Lunardi, J., Hurko, O., Engel, W.K & Attardi, G (1992) The multiple ADP/ATP translocase genes are differentially expressed during human muscle development J Biol Chem 267, 15267– 15270.

7 Do¨rner, A., Pauschinger, M., Badorff, A., Noutsias, M., Giessen, S., Schulze, K., Bilger, J., Rauch, U & Schultheiss, H.-P (1997) Tissue-specific transcription pattern of the adenine nucleotide translocase isoforms in humans FEBS Lett 414, 258–262.

8 Du¨mmler, K., Mu¨ller, S & Seitz, H.J (1996) Regulation of adenine nucleotide translocase and glycerol 3-phosphate

Fig 6 Site-2 and Site-3elements act in a concerted manner to cause the

repression of ANT2 promoter Transient transfections analysis of the

heterologous )374/)235 ANT2 promoter constructs bearing

combi-nation of the wt (open boxes) or mutated (crossed boxes) Site-2 ( )339/

)310) and Site-3 ()374/)347) elements Promoter fragments were

cloned in front of the HSVtk promoter and transfected into HeLa cells.

CAT activity was normalized for transfection efficiency The values of

the activities are set relative to the activity of the clone carrying wt

Site-2 and Site-3 elements The results represent the mean

value ± S.E of five independent experiments in which each

experi-mental point was determined in triplicate.

Fig 5 The Site 2 and Site 3silencer elements are occupied by NF1

in vivo ChIP was carried out on formaldehyde-crosslinked HeLa cells.

Exponentially growing cells were crosslinked with 0.25%

formalde-hyde Chromatin was isolated and specific DNA–protein complexes

were immunoprecipitated with no antibody (lanes 2 and 7), or with

anti-NF1 8199 (lanes 4 and 9), or with unrelated antibodies (lanes 3

and 8) After reversal of the crosslink, DNA was amplified by PCR

using the specific primers: Site-3, primer set )525/)378; Site-2, primer

set )346/)214 Total chromatin (lanes 5 and 10), and no DNA (lanes 1

and 6) were used as positive and negative PCR controls As a marker

(lane M), the 100-bp gene ruler (Fermentas) was used.

dehydrogenase expression by thyroid hormones in different rat

tissues Biochem J 317, 913–918.

9 Battini, R., Ferrari, S., Kaczmarek, L., Calabretta, B., Chen, S.-T.

& Baserga, R (1987) Molecular cloning of a cDNA for a human

ADP/ATP carrier which is growth-regulated J Biol Chem 262,

4355–4359.

10 Barath, P., Luciakova, K., Hodny, Z., Li, R & Nelson, B.D.

(1999) The growth-dependent expression of the adenine

nucleo-tide translocase-2 (ANT2) gene is regulated at the level of

tran-scription and is a marker of cell proliferation Exp Cell Res 248,

583–588.

11 Li, R., Hodny, Z., Luciakova, K., Barath, P & Nelson, B.D.

(1996) Sp1 activates and inhibits transcription from separate

ele-ments in the proximal promoter of the human adenine nucleotide

translocase 2 (ANT2) gene J Biol Chem 271, 18925–18930.

12 Zaid, A., Hodny, Z., Li, R & Nelson, B.D (2001) Sp1 acts as a

repressor of the human adenine nucleotide translocator-2 (ANT2)

gene Eur J Biochem 268, 5497–5503.

13 Luciakova, K., Barath, P., Poliakova, D., Persson, A & Nelson,

B.D (2003) Repression of the human ANT2 gene in

growth-arrested human diploid cells: The role of nuclear factor 1 (NF1).

J Biol Chem 278, 30624–30633.

14 Barath, P., Albert-Fournier, B., Luciakova, K & Nelson, B.D.

(1999) Characterization of a silencer element and purification of a

silencer protein that negatively regulates the human adenine

nucleotide translocator 2 promoter J Biol Chem 274, 3378–3384.

15 Gronostajski, R.M (2000) Roles of the NFI/CTF gene family in

transcription and development Gene 249, 31–45.

16 Luckow, B & Schu¨tz, G (1987) CAT constructions with multiple

unique restriction sites for the functional analysis of eucaryotic

promoters and regulatory elements Nucleic Acids Res 15, 5490.

17 Promega (1991) Promega Protocols and Applications Guide 2nd

edition Madison, WI.

18 Dignam, J.D., Lebovitz, R.M & Roeder, R.G (1983) Accurate

transcription initiation by RNA polymerase II in a soluble extract

from isolated mammalian nuclei Nucleic Acids Res 11, 1475–

1489.

19 Blobel, G & Potter, V.R (1966) Nuclei from rat liver: isolation

method that combines purity with high yield Science 154, 1662–

1665 issn: 0036–8075.

20 Kadonaga, J.T (1991) Purification of sequence-specific binding

proteins by DNA affinity chromatography Methods Enzymol.

208, 10–23.

21 Gounari, F., De Francesco, R., Schmitt, J., van der Vliet, P.,

Cortese, R & Stunnenberg, H (1990) Amino-terminal domain of

NF1 binds to DNA as a dimer and activates adenovirus DNA

replication EMBO J 9, 559–566.

22 Santoro, C., Mermod, N., Andrews, P & Tjian, R (1988) A

family of human CCAAT/box/binding proteins active in

tran-scription and DNA replication: cloning and expression of multiple

cDNAs Nature 334, 218–224.

23 Rupp, R., Kruse, U., Multhaup, G., Gobel, U., Beyreuther, K &

Sippel, A (1990) Chicken NF1/TGGCA proteins are encoded by

at least three independent genes: NFI-A, NFI-B, and NFI-C with homologues in mammalian genomes Nucleic Acids Res 18, 2607–2616.

24 Kruse, U & Sippel, A.E (1994) The genes for transcription factor nuclear factor I give rise to corresponding splice variants between vertebrate species J Mol Biol 238, 860–865.

25 Kruse, U & Sippel, A.E (1994) Transcription factor nuclear factor I proteins form stable homo- and heterodimers FEBS Lett.

348, 46–50.

26 Adams, A.D., Choate, D.M & Thompson, M.A (1995) NF1-L is the DNA-binding component of the protein complex at the peripherin negative regulatory element J Biol Chem 270, 6975– 6983.

27 Osada, S., Daimon, S., Ikeda, T., Nishihara, T., Yano, K., Yamasaki, M & Imagawa, M (1997) Nuclear factor 1 family proteins bind to the silencer element in the rat glutathione trans-ferase P gene J Biochem (Tokyo) 121, 355–363.

28 Szabo, P., Moitra, J., Rencendorj, A., Rakhely, G., Rauch, T & Kiss, I (1995) Identification of a nuclear factor-I family protein-binding site in the silencer region of the cartilage matrix protein gene J Biol Chem 270, 10212–10221.

29 Liu, Y., Bernard, H.U & Apt, D (1997) NFI-B3, a novel tran-scriptional repressor of the nuclear factor I family, is generated by alternative RNA processing J Biol Chem 272, 10739–10745.

30 Gao, B & Kunos, G (1998) Cell type-specific transcriptional activation and suppression of the alpha1B adrenergic receptor gene middle promoter by nuclear factor 1 J Biol Chem 273, 31784–31787.

31 Osada, S., Ikeda, T., Xu, M., Nishihara, T & Imagawa, M (1997) Identification of the transcriptional repression domain of nuclear factor 1-A Biochem Biophys Res Commun 238, 744–747.

32 Apt, D., Liu, Y & Bernard, H.U (1994) Cloning and functional analysis of spliced isoforms of human nuclear factor I–X: inter-ference with transcriptional activation by NFI/CTF in a cell-type specific manner Nucl Acids Res 22, 3825–3833.

33 Chaudhry, A.Z., Vitullo, A.D & Gronostajski, R.M (1999) Nuclear factor I-mediated repression of the mouse mammary tumor virus promoter is abrogated by the coactivators p300/CBP and SRC-1 J Biol Chem 274, 7072–7081.

34 Alevizopoulos, A., Dusserre, Y., Tsai-Pflugfelder, M., von der Weid, T., Wahli, W & Mermod, N (1995) A proline-rich TGF-beta-responsive transcriptional activator interacts with histone H3 Genes Dev 9, 3051–3066.

35 Rafty, L.A., Santiago, F.S & Khachigian, L.M (2002) NF1/X represses PDGF A-chain transcription by interacting with Sp1 and antagonizing Sp1 occupancy of the promoter EMBO J 21, 334–343.

36 Kim, T.K & Roeder, R.G (1994) Proline-rich activator CTF1 targets the TFIIB assembly step during transcriptional activation Proc Natl Acad Sci USA 91, 4170–4174.

37 Tanese, N., Pugh, B.F & Tjian, R (1991) Coactivators for a proline-rich activator purified from the mutlisubunit human TFIID complex Genes Dev 5, 2212–2224.