... functional programming (new design) Many features remain the preserve of functional languages ◦ Datatypes & pattern matching ◦ Higher-kinded types, existentials, sophisticated modules ◦ Unification/constraint-based ... additional features in C# 3.0 were driven by the LINQ project (Language INtegrated Query) Contrast Scala, which started with (almost) a clean slate: ◦ Object-oriented programming (new design) + functional ... & iterators ◦ And even: GADTs (polymorphic inheritance) This talk: is it serious competition for ML and Haskell? ◦ (Note: Java 5 has many but not all of the above features) Trang 4A brief
Ngày tải lên: 23/10/2014, 15:20
... lmeerten@aecom.yu.edu; Sara Calattini - scalatt@pasteur.fr; Antoine Gessain - agessain@pasteur.fr; Lars Kiemer - lars@cbs.dtu.dk; Renaud Mahieux* - rmahieux@pasteur.fr * Corresponding author Abstract ... Zeiss Axiocam HRc (color) camera and the Zeiss Apotome software Images of cells that are representative of the entire population are shown (C): Western-blot analysis of cytoplasmic and nuclear ... factor (ATF) binding (CREB/ATF) pathway, while in the cytoplasm the viral transactivators interact with several members of the NF-κB transduction pathway [5,37] Tax1/Tax2 activation of CREB/ATF
Ngày tải lên: 13/08/2014, 09:21
An overview of computers and programming language
... Trang 1C++ Programming: From Problem Analysis to Program An Overview of Computers and Programming Languages Trang 2Updated by: Malak Abdullah The Evolution of Programming Languages (cont'd.) ... High-level languages include Basic, FORTRAN, COBOL, Pascal, C, C++, C#, and Java Compiler: translates a program written in a high-level language machine language C++ Programming: From Problem Analysis ... area of a rectangle The perimeter and area of the rectangle are given by the following formulas: perimeter = 2 * (length + width) area = length * width Trang 12Updated by: Malak Abdullah Example
Ngày tải lên: 23/10/2014, 14:23
The future of the cobol programming language
... Trang 1The Future of the COBOL Programming Language Karl Schenk University of Wisconsin-Platteville Department of Computer Science and Software Engineering Trang 3 COBOL and higher Education ... Trang 18COBOL History 1959 Department of Defense wanted a universal Business Application Language CODASYL was formed attendees Trang 20 COBOL and higher EducationEmployment Opportunities and ... Computer Programming in COBOL 4 other classes Systems Analysis and Design Systems Design and Implementation CICS Application Programming Applications of Information Systems Trang 41COBOL and
Ngày tải lên: 23/10/2014, 20:10
Cytophysiologic effects and molecular inhibition of a functional actin specific ADP ribosyltransferase CDT from clostridium difficile 5
... extracellularly and initiating intracellular survival signals Biochim Biophys Acta 1593, 249-258 Aktories, K., Ankenbauer, T., Schering, B., and Jakobs, K H (1986a) ADP-ribosylation of platelet actin ... 69-77 Karjalainen, T., Waligora-Dupriet, A J., Cerquetti, M., Spigaglia, P., Maggioni, A., Mauri, P., and Mastrantonio, P (2001) Molecular and genomic analysis of genes encoding surface-anchored ... J., and Woodgett, J R (1994) The stress-activated protein kinase subfamily of c-Jun kinases Nature 369, 156-160 Lachumanan, R., Armugam, A., Durairaj, P., Gopalakrishnakone, P., Tan, C H., and
Ngày tải lên: 16/09/2015, 15:54
Cytophysiologic effects and molecular inhibition of a functional actin specific ADP ribosyltransferase CDT from clostridium difficile 4
... muscle actin Each data point was mean + SD of triplicate assays Trang 125.3 Discussion We have characterized a bacterial ADPRT (CDT) whose actin-specific actions were challenged with potential inhibitors ... 2004; Obara et al., 1991) post-Having demonstrated the actin-specific ADPRT activity of CDT, the abundance and equimolar concentration of G- and F-actin must be protected against modifying agents ... the NAD cavity among ADPRTs Although crystallographic data for CDT has not been reported, mutagenesis studies have revealed the presence of conserved amino acid residues for catalysis and NAD
Ngày tải lên: 16/09/2015, 15:54
Cytophysiologic effects and molecular inhibition of a functional actin specific ADP ribosyltransferase CDT from clostridium difficile 3
... of the last nucleotide in the line GAACCATCTCTTTTTTTATACAAAAAAAGTAGTTCCTAAGAAT -310 CCTCTATA TCTCTTTAAAATATT -160 CAGTTGTTATTTTGTACTGACATATCATATAAATACATATTTT -117 TACCTTAA tattttttcacataaataatttaatatttttcaa ... tattttttcacataaataatttaatatttttcaa atttaaggAGGAGAaaca ATGAAAATACAAATGAGGAATAAA 24 Stop Start cdtA Start cdtB+1 Trang 10Table 3.2 Comparison of clostridial promoter sequences with bacterial consensus DNA Bacterial ... Single arrow head points to the direction and location of primers (see Table 2.2) Block circles show the location of (TATACAAAACAAATTATTTAA), 20309 cdtB (ACTACAAATTATTCCCATACA), and 19126 truncated
Ngày tải lên: 16/09/2015, 15:54
Cytophysiologic effects and molecular inhibition of a functional actin specific ADP ribosyltransferase CDT from clostridium difficile 2
... of toxin A and toxin B was observed to increase (Yamakawa, Karasawa et al 1996) Instead of acting as Trang 19transcriptional regulator therefore, TcdD may function as a sigma factor that promotes ... essential functions in mammalian cell including cell adhesion, microfilament organization, nuclear signaling, pseudopod formation and re-shaping (intravasation) of phagocytes and many signal transduction ... improvement on handwashing and use of barrier precautions such as isolation of symptomatic patients (Samore 1999), fluid and electrolyte replacement and administration of agents that slows intestinal motility
Ngày tải lên: 16/09/2015, 15:54
Cytophysiologic effects and molecular inhibition of a functional actin specific ADP ribosyltransferase CDT from clostridium difficile 1
... research and clinical applications Using ADP-ribosyltransferase assay (ARTase), analyses of wild-type and mutant CDTa activities revealed conserved amino acid residues that are crucial for its ability ... integrin-cAMP-stress-related MAPK-ATF2 but not the MEK2-ERK1/2-AKT-Stat3 route In addition, activation of caspase-3 and inability of CDT to mediate phosphoinactivation of BAD (Bcl-activated death promoter) ... profiles and autoradiograms showing ADP-ribosylated actin by various CDTa isoforms and NAD photolabeled CDTa 81 3.11 Proposed mechanism of ADP-ribosylation of actin by ADPRT 90 4.1 Effects of CDT
Ngày tải lên: 16/09/2015, 15:54
Teacher’s Perception of A good English Language Teacher
... gia 2020 sử dụng, dựa vào công trình của Dudzik (2008) [6] Bà đã đưa ra biểu đồ các nhóm năng lực của giáo viên dựa trên các mô hình của Bransford, Darling-Hammond et al (2005) [4], và của Ball ... tham chiếu với khung phân tích lý thuyết là Khung năng lực giáo viên tiếng Anh (KNLGV TA) dành cho Việt Nam do ĐA NNQG 2020 ban hành để đưa ra các đối sánh và đánh giá [5] Hiểu được KNLGV TA ... nghiên cứu dựa vào Khung năng lực giáo viên tiếng Anh Việt Nam của Dudzik (2008) và sách Hướng dẫn sử dụng Khung năng lực giáo viên tiếng Anh viêt Nam của Đề án Ngoại ngữ Quốc gia (ĐA NNQG) 2020
Ngày tải lên: 14/12/2017, 23:03
Scala from a functional programming perspective
... Trang 13Chapter 1An Introduction to Functional Programming Languages Functional programming is a programming paradigm that has one of its roots in the programming language LISP LISP, which stands ... programming language for research, exploiting itsfunctional programming characteristics, and Standard ML for teaching functionalprogramming This greatly influenced the way I program Programming languages ... Functional Programming Languages We have underlined above that functional programming has as its main characteristic in that programs are based on the definition of functions Functions are the mainelements
Ngày tải lên: 14/05/2018, 15:43
Teacher’s perception of “a good english language teacher
... gia 2020 sử dụng, dựa vào công trình của Dudzik (2008) [6] Bà đã đưa ra biểu đồ các nhóm năng lực của giáo viên dựa trên các mô hình của Bransford, Darling-Hammond et al (2005) [4], và của Ball ... tham chiếu với khung phân tích lý thuyết là Khung năng lực giáo viên tiếng Anh (KNLGV TA) dành cho Việt Nam do ĐA NNQG 2020 ban hành để đưa ra các đối sánh và đánh giá [5] Hiểu được KNLGV TA ... nghiên cứu dựa vào Khung năng lực giáo viên tiếng Anh Việt Nam của Dudzik (2008) và sách Hướng dẫn sử dụng Khung năng lực giáo viên tiếng Anh viêt Nam của Đề án Ngoại ngữ Quốc gia (ĐA NNQG) 2020
Ngày tải lên: 19/10/2022, 18:11
Influence of a Functional Knee Brace and Exercise on Lower Extrem
... mid-stance, two-way ANOVA with repeated measures for each dependent variable was run Level of statistical significance was set at p < 05 for all comparisons The statistical analysis was performed ... that may be introduced to the unbraced limb as a result of the brace application REFERENCES 1 Andriacchi, T.P Functional analysis of pre and post knee surgery; total knee arthroplasty and ... to calculate the kinematic values generated by the subjects during the jogging gait trials All data were time matched using an external trigger (Motion Analysis Corporation, Santa Rosa, CA)
Ngày tải lên: 30/10/2022, 21:17
mycobacterium tuberculosis phosphoribosylpyrophosphate synthetase biochemical features of a crucial enzyme for mycobacterial cell wall biosynthesis
... Universita` del Piemonte Orientale ‘‘A Avogadro’’, Novara, Italy, 3 Dipartimento di Biochimica ‘‘A Castellani’’, Universita` degli Studi di Pavia, Pavia, Italy Abstract The selection and soaring spread ... the addition of 50 mM Pi Main Characteristics of MtbPRPPase Oligomeric state—The enzyme migrated in 12% SDS-PAGE as a protein of apparent molecular mass of approximately 35 kDa (Fig 2A) and eluted ... favoured region of the Ramachandran plot, 8.0% in the additional allowed region with Figure 5 Steady state kinetics ofMtbPRPPase (A) Steady state kinetics of MtbPRPPase as a function of R5P All
Ngày tải lên: 02/11/2022, 14:28
reinforcement learning and dopamine in schizophrenia dimensions of symptoms or specific features of a disease group
... reward CS and neutral CS in patients The analysis of fMRI data also focused on CS and revealed that increased activa-tion in striatal and prefrontal areas of healthy controls to reward CS was accompanied ... flexible behav-ioral adaptation and reversal learning, in particular, are important features of schizophrenia patients with an increased tendency to switch as a potential specific mechanism (76,77) ... the appli-cation of fixed-effects parameters to fMRI data rather appears as a workaround based on the observation that noisy parameters based on maximum-likelihood estimates potentially add further
Ngày tải lên: 04/12/2022, 16:11
A study on the syntactic features of english and vietnamese lyrics adopting the functional grammar approach clause as a message
... combination Therefore, language and its mechanism have been taught at school as part of the curriculum However, teachers and students pay much more attention to the vocabulary and grammar of a language ... exchange meanings.” The tendency to approach a functional analysis in language is inevitable since language has developed for Trang 3the satisfaction of human needs and the way it is organized is functional ... language than to the making use of grammatical knowledge in order to have effective communication A typical example of this is the teaching and learning of English as a foreign language at Vietnamese
Ngày tải lên: 14/05/2016, 18:38
A study on the semantic and lexicogrammatical features of the short story mr know all by w somerset maugham a systemic functional analysis
... where grammatical and ungrammatical sentences are distinguished clearly” (Lock, 1996:1), functional grammar “is a way of looking at language in terms of how grammar is used” (Martin et al, 1997) ... Know All Trang 11Chapter 3: Data analysis – analyses the semantic and lexicogrammatical features of the story Mr Know All to see how transitivity, mood & modality, and theme are patterned ... part, Mr Kelada took upon himself to arrange all the social affairs of the cruise The passengers called him Mr Know All to his face and Mr Kelada takes it as a compliment Mr and Mrs Ramsay are
Ngày tải lên: 25/10/2016, 09:27
A descriptive analysis of linguistic features of advertising language used in english slogans for food and drink products
... space or temporal reasons Because of the special communicative purposes of advertising language and the obvious limitation of the space, the grammar of advertising language shows certain features ... message of the advertisement 1.3 FEARURES OF ADVERTISING LANGUAGE Language has made a powerful influence on people and their behavior and this is especially exact in the field of marketing and advertising ... most major aspects of the advertising register and the genre of advertising as a text type characterized by specific features Register can be defined as a set of lexical and grammatical features
Ngày tải lên: 30/09/2020, 12:22
A study on the semantic and lexicogrammatical features of the short story mr know all by w somerset maugham a systemic functional analysis
... where grammatical and ungrammatical sentences are distinguished clearly” (Lock, 1996:1), functional grammar “is a way of looking at language in terms of how grammar is used” (Martin et al, 1997) ... Know All Trang 11Chapter 3: Data analysis – analyses the semantic and lexicogrammatical features of the story Mr Know All to see how transitivity, mood & modality, and theme are patterned ... part, Mr Kelada took upon himself to arrange all the social affairs of the cruise The passengers called him Mr Know All to his face and Mr Kelada takes it as a compliment Mr and Mrs Ramsay are
Ngày tải lên: 30/09/2020, 12:28
Features of a .NET Class
... shorthand syntax for declaring properties that map directly onto a field and have trivial get and set methods. A field is created automatically for such a property, as well as the default get and ... Classes (MFC), you know about the message map. Events in C++/CLI are a language feature that builds into the language the idea of a mapping between events and functions that handle those events. ... delegate declaration. BeginInvoke has the same parameters as the usual Invoke function, plus two additional parameters: the first is an AsyncCallback class and the second is the delegate. EndInvoke...
Ngày tải lên: 05/10/2013, 07:20