Cytophysiologic effects and molecular inhibition of a functional actin specific ADP ribosyltransferase CDT from clostridium difficile 3

Furthermore, we have explored cdt gene expression since knowledge on this aspect is lacking, unlike the PaLoc toxin genes whose expression has been well-characterized to follow both mono

Chapter 3 Molecular Characterization of a binary cdt toxin genes from a variant

Clostridium difficile strain with truncated pathogenicity locus

3.1 Introduction

Several approaches have been used to identify virulence proteins in recent years For example, random transposon mutagenesis was useful through creation of Pseudomonas aeruginosa mutants which were screened for virulence reduction (Rahme, Tan et al 1997; Jander, Rahme et al 2000) Gaining increasing application is nucleotide microarray chip technology (Lan and Reeves 2000) which allows identification of differential genes between pathogenically diverse organisms However, availability of genetic sequences is necessary for inclusion into the array More recently, phenotype microarray has allowed comparison of differential proteome expression amongst six strains (Bochner, Gadzinski et al 2001) As knowledge in phenotypic variations has become popular in understanding disease processes and formulation of directed defense, detection of virulence genes by phenotype analysis between wild-type and isogenic knock-out strains for example, has become promising Again, differences in protein products is dictated by gene diversity and this highlights the importance on our continued discovery of genetic sequences

Recently, genomic subtraction (GS) between virulent P aeruginosa pathogen PA14 and avirulent PA01 revealed Yersinia pestis ybtQ virulence homolog in P aeruginosa using G mellonella and burned mouse model (Sawada, Kokeguchi et al 1999; Choi, Sifri et al 2002) Moreso, Sawada et al (1999) detected insertion sequence IS1598 involved in necrotic abscess formation among virulent Porphyromonas gingivalis strains after failed attempts to identify virulence determinants from strain differences using biochemical means (Neiders, Chen et al 1989) Use of this technique has likewise resulted in rapid isolation of gene islands and pathogenes between closely related organisms (Klee, Nassif et al 2000; Choi, Sifri et al 2002)

In this study, we have adopted a similar approach and have localized 19126-specific

virulence gene portions which to our knowledge is the first report of genomic subtraction administered between two C difficile strains Putative pathogenes were concentrated as genomic library probe through elimination of closely homologous DNA from two sets of genome that have hybridized The process has led to the identification of several virulence genes and characterization of variant forms of cdt whose detection was reported at about 6% of C difficile clinical isolates (Stubbs, Rupnik et al 2000; Geric, Rupnik et al 2004; Goncalves, Decre et al 2004) This has illustrated the efficiency of the technique in enriching specific genomic subset involved in pathogenicity and those encoding unknown or hypothetical proteins with possible novel identity Furthermore, we have explored cdt gene expression since knowledge on this aspect is lacking, unlike the PaLoc toxin genes whose expression has been well-characterized to follow both mono- and polycistronic transcription with higher expression of downstream mRNA (tcdA>tcdB mRNA) Finally, we have studied the functional role of several conserved amino acid residues in CDTa confirming identity of the genes isolated

3.2 Results

3.2.1 Isolation of putative 19126-specific virulence DNA

Initially, we performed genomic subtraction between pathogenic (19126) and nonpathogenic (11186) C difficile strains to derive virulence gene fragments Identity of DNA source strains were first ascertained by detecting a portion of toxin B gene, tcdB using colony PCR (see Table 2.2 for primers used) Results showed the presence of 1362 bp segment in genomes of known C difficile pathogens ATCC 43596 and 19126 which was not amplified from

11186 (Fig 3.1) Using enzyme immunoassay, toxin A was produced by 19126 (OD450=0.589) and 20309 (0.446) which are higher than the >0.200 cut-off for positive result but not 11186 (0.036) These indicated the presence of PaLoc-encoded toxins in 19126 and absence in 11186

Enrichment of 19126 DNA was achieved by allowing its reassociation with excess of sheared, biotinylated subtractor DNA from 11186 (Fig 2.1) The streptavidin-bound biotinylated

Figure 3.1 Characterization of C difficile reference strains for the presence of tcdB gene portion using colony PCR The PaLoc gene was amplified from chromosomal DNA of ATCC 43596 (lane1), CCUG 19126 (lane 2) and VPI 11186 (lane 3) M, 1 kb plus DNA ladder (Gibco BRL)

DNA species (single-stranded, homoduplexes and heteroduplexes) were removed by organic phase extraction with streptavidin while unbound DNA subjected to more rounds of subtraction cycle Rounds 1-4 extracts contained amplicons of wide-ranged sizes whereas fifth round products were limited to 100 to 300 bp, suggesting more complete range of target DNA template until the 4th round Using colony and dot blot hybridization, pathogenic ATCC43596 and 48 out

of 292 library clones reacted with the probe but not 11186 and E coli containing pUC18, SK1200 (Table 2.1)(Fig 3.2A,B,C,E) Accordingly, clinical isolate CD108, screened as non-PaLoc containing was not recognized by the probe (Fig 3.2E) These indicate efficient enrichment through successive subtractive cycles and have shown probe identity to PaLoc toxigenic elements and other putative pathogenes

3.2.2 Identification of insert fragments with putative virulence function

Nineteen representative plasmids with inserts ranging from 100 bp to 1 kb fragments were sequenced (GenBank accession no CC927338-CC927348) and submitted to NCBI BLAST programs for homology search (Table 3.1) Majority of clone inserts at 42% showed identity to

1.6

M 1 2 3

1.3 kb

Figure 3.2 Colony hybridization showing autoradiogram of CCUG 19126 genomic library clones detected by round 4 subtraction product A-C, discs blotted with 292 colonies starting from slot A1 up to C93 For all discs, slots 101-104 contained the following colonies: SK1200-JM109 carrying pUC18 (negative control), ATCC 43596 (Positive control), CCUG 19126 (test), and VPI 11186 (test) shown by arrows on disc A Disc A had colonies 1-100 exclusively, disc B with colonies 101-200, and disc C had colonies 201-292 D, template grid used for colony blotting E, dot blot of C difficile genome probed with round 4 subtraction product: 1-SK1200, 2-CD108, 3-CCUG 8884, 4-VPI 11186, 5-CCUG 4938, 6-ATCC 43596, 7-CCUG 19126

Table 3.1 Protein similarities of CCUG 19126 library inserts

GenBank access no GS05 382 Phage-related protein Xylella fastidiosa Temecula1 2.E-01 68% NP779526

GS41 348 Toxin A locus CDTOXA, X5179, AA1-142 Clostridium difficile 2.E-10 100% CAA36093

TcdE locus CDI011301, AJ011301 Clostridium difficile 5.E-09 90% CAC19892

GS68 725 Carbamoyl-phosphate synthetase subunit Clostridium perfringens 6.E-04 91% NP563488

GS166 194 HD superfamily hydrolase, HD-GYP domain Clostridium acetobutylicum 2.E-08 92% NP347489

GS241 164 DnaK heat shock protein Clostridium acetobutylicum 5.E-02 56% NP347113

bacterial virulence homologs with clones GS10 and GS104 containing portions of tcdB covering

an average 112 amino acid residues, while GS41 carries portions of tcdA at amino acids 112-142

and tcdE at amino acids 135-165 On the other hand, 32% matched with unknown, hypothetical

or phage-associated factors and 26% with housekeeping proteins Although the proportion of

identified DNA here is small relative to complete genome sequences, similarity in categorical

identity are reflective of those in many genome projects like in Clostridium perfringens and

E.coli K-12 where 38% of ORFs had homology to hypothetical or unclassified proteins and

87.8% to known factors (Blattner, Plunkett et al 1997; Shimizu, Ohtani et al 2002) Detection of

several virulence-encoding fragments is expected as our library was probed with nucleotides

which have been potentially rid of strain-specific complementary duplexes that are likely

maintenance genes

3.2.3 CCUG 19126 and CCUG 20309 encodes variant forms of cdt

To further support applicability of genomic subtraction, we validated the identity of GS80 insert by attempting to capture and functionally characterize the complete cdt in 19126 and other C difficile strains The clone has a 573 bp insert of 75% identity to iota toxin component

Ib of C perfringens (nt 638-786) and 98% to C difficile CD196 ADP-ribosyltransferase binding component, CDTb with extensive coverage of 148 amino acid residues (nt 639-787) (Perelle, Gibert et al 1997a) Based on CD196 nucleotide sequence, primer pairs were designed to detect cdt from various C difficile strains

Our preliminary survey of toxin A-producing hospital isolates yielded 13 toxinotypes of PaLoc and cdt gene variants with none of the complete cdt Strain 19126 encodes a 1,282 bp truncated cdt (GenBank accession no AY341253) Sequence identity encompass 533 bases downstream of cdtA start site and 3’end of cdtB punctuated with a large block deletion of 1,958

bp (Fig 3.3) The incomplete orf was sequenced from pDA579 in clone SK1222 (Table 2.1) Among the reference strains tested including ATCC 43596, nonpathogenic VPI 11186 and VPI

8884, only CCUG 20309 contained the full cdtA, cdtB and binary genes of 0.9, 1.8 and 3.2 kb amplicon sizes, respectively (Fig 3.3) cdtA is 1,392 bp long encoding a 463-amino acid protein (53 kDa, pl of 8.81), whereas cdtB has 2,631 bp encoding a polypeptide of 876 amino acid residues (99 kDa, pl of 4.74) The higher prevalence of C difficile with truncated cdt (40%) over the complete cdt toxinotype is reflected on our survey

In comparison to CD196, 9 additional nucleotides (ACCAGAAGA) were located 165 bp downstream of cdtA translational start site This resulted in the replacement of Ser55 by Arg55, Pro56, Glu57 and Asp58 resulting in 4 conservative deduced amino acid substitutions Immediately upstream lies the putative cleavage site (Lys42-Val43) that is essential for the release of proposed cdtA N-terminal transmembrane signal peptide (Klein, Kanehisha et al 1985; Perelle, Gibert et al 1997a) A similar cleavage site was found in cdtB (Lys42-Glu43)

Figure 3.3 Comparative genetic map of CCUG 19126 and CCUG 20309 cdt genes Double arrow heads indicate amplicon position and sizes with corresponding bands on 1% agarose gel (M, DNA ladder; lanes 1-3, from template 20309; lanes 4, 5 and 6, from templates VPI 10463, 11186 and 19126, respectively Single arrow head points to the direction and location of primers (see Table 2.2) Block circles show the location of

(TATACAAAACAAATTATTTAA), 20309 cdtB (ACTACAAATTATTCCCATACA), and 19126 truncated cdt (TATACAAGACAAATTATTACCATACA) Dashed lines show the extent of cdt deletion (not drawn to scale)

3.2.4 Analysis of cdt regulatory region

Primer extension generated a first strand cDNA product (52 bp) which terminated at the 5’ transcription initiation site (TSS) that was mapped to an adenine residue at nt -24, that is 25 bp and 14 bp upstream of start codon and RBS, respectively (Fig 3.4)(Angeles, Leong et al 2004) The 542 bp sequence upstream of cdtA ATG start site (GenBank accession no AY029209) showed several features including a ribosomal binding site (RBS) located 6 bp upstream of start site (Fig 3.4) An RBS was also found 5 nucleotides upstream of cdtB that is conserved in iota

Ib Inverted repeats of 11 bp and 8 bp in length were also located 47 bp and 325 bp respectively, upstream of start site Two putative promoter regions were detected with one -10 region located

34 bp upstream of start site, separated from the -35 region by 15 nucleotides while the other at

128 bp upstream of start site has -10 and -35 regions with 18 intergenic spaces (Fig 3.4) The –

10 consensus promoter sequence at nt –33 to –38 (TTCAAG) was located 9 bases whereas the –

35 site at nt –54 to –59 (TATAAT) is 32 bases upstream of TSS (Fig 3.4)(Table 3.2) The –45 AT-rich region upstream of promoter which is conserved in Gram-positive bacteria was also identified at nt –69 to –80 This 0.58 kb regulatory region was also detected in 19126 while the 0.9 kb cdtB downstream region containing inverted repeats at nt 161-173 and 186-198 was not present

Comparison with truncated cdt revealed a single copy of 10 bp direct repeat (ACAAATTATT) in place of deleted block also found flanking the deletion region in 20309 cdt (Fig 3.3) Such intergenic repeat sequences may represent insertion or deletion site remnants of transposable DNA elements mediating mutation through gene transfer or recombination Manifestations exist in 19126 cdt as intermittent deletion, base substitution and insertion that resulted in premature termination (TGA) at the 69th codon

3.2.5 Growth dependent transcription of cdt

Figure 3.4 Characteristic features of 20309 cdt regulatory sequences The initiation (ATG) and termination (TAA) codons are labeled Putative RBS sequences are shown in bold, putative promoters are italicized and underlined and the transcription initiation site

is italicized and labeled (+1) Arrows indicate the direction and position of inverted repeats Intergenic sequence between cdtA and cdtB are in lower case and flanked with spaces Numerical designation on the right indicates sequence position of the last nucleotide in the line

GAACCATCTCTTTTTTTATACAAAAAAAGTAGTTCCTAAGAAT -310

CCTCTATA TCTCTTTAAAATATT -160 CAGTTGTTATTTTGTACTGACATATCATATAAATACATATTTT -117

TACCTTAA tattttttcacataaataatttaatatttttcaa

atttaaggAGGAGAaaca ATGAAAATACAAATGAGGAATAAA 24 Stop

Start cdtA

Start cdtB+1

Table 3.2 Comparison of clostridial promoter sequences with bacterial consensus DNA

Bacterial source Gene -35 -10

Intergene space (bp) Reference

TTTACA CTCCTT 17 Dupuy & Sonenshein, 1998

C difficile tcdB TTTACA GTCTTT 17 Dupuy & Sonenshein, 1998

TTAGCA TATAGT 17 Song & Faust, 1998 TTTACA TTATTC 21 von Eichel-Streiber et al., 1992

*lower case letters represent less conserved sequences

To characterize transcription pattern of cdt, gene expression of the complete and truncated form were initially compared using RT-PCR At OD600, C difficile growth phases followed a typical sigmoid curve with the early log phase observed between 9 to 10 h proceeding

to peak at 19 h (Fig 3.5A) Preliminary control assays proved experimental validity by showing

no amplicon when total RNA template was digested or no first-strand synthesis was performed while similar treatments without DNAse I digestion generated PCR products (Fig 3.5B) Temporal expression at 5 growth points revealed that cdtA is transcribed from the exponential phase between the 8th and 12th h, which waned starting from stationary phase (Fig 3.5C,D) Similar expression pattern was observed for cdtB and higher transcription of the truncated form which seemingly persisted up to the 24th h (Fig 3.5E,F) In addition, primer pairs flanking both cdtA and cdtB regions of 20309 produced a 690 bp amplicon at the exponential phase (Fig 3.5G) Taken together, such synchronous transcription suggests possible expression of cdt locus as a bicistronic operon controlled by similar if not identical regulatory elements

3.2.6 Transcription of cdt relative to tcdE of the PaLoc

Using semiquantitative RT-PCR, transcription of cdt mRNA was then compared with tcdE of the PaLoc to determine intra-strain relative expression in 20309 Determination of optimum primer annealing temperature was initially conducted for each primer pairs using Biometra gradient cycler (Fig 3.6A-C)(Table 2.2) Thereafter, cDNA level of specific genes was measured starting with the relatively high expression of internal control 16S rRNA (Fig 3.6D)(Table 2.2) Throughout most growth points, band intensities showed abundance of tcdE over cdtA and cdtB mRNAs which were not detected in 11186 (Fig 3.6E-G) and reiterated by densitometric data (Fig 3.6H) Considering mean values for all timepoints, the transcription ratio for cdtA, cdtB and tcdE was 0.7: 0.6: 1.0 with significant difference in values for tcdE against cdtA (2.1x10-2) and cdtB (1.6x10-5) but not for cdtA against cdtB (0.11) at p<0.05 These indicate more efficient transcription of tcdE and possibly the rest of PaLoc polycistron genes Although comparatively lower band intensities for cdt were already measurable at early exponential growth phase, distinct staining was only apparent at the 12th h, whereas tcdE transcripts were evident as early as the 7th h of growth (Fig 3.6E-G) Furthermore, tcdE expression peaked from 14th to the 18th h (stationary phase) while those of cdts were observable at the 16th to 18th h, indeed implying earlier production of PaLoc toxin genes

Real-time quantitation confirmed higher transcription of tcdE over cdt Normalized corrected mean threshold cycle values (CT) were consistently and significantly higher for both cdtA (3.1x10-4) and cdtB (3.2x10-6) relative to tcdE (Fig 3.6I) Accordingly, mean calculated cdtB and cdtA amplicon concentration for all timepoints exhibited a 4.3-fold and 1.5-fold increase, respectively, compared to tcdE (Fig 3.6J) Conforming with RT-PCR results, initial two-fold rise in tcdE mRNA concentration was evident at the 7th h In addition, peak concentration for cdtA (42.19) and cdtB (15.23) were recorded earlier in real-time measurements

at the 14th h indicating improved sensitivity of fluorogenic detection system

Figure 3.6 Comparison of growth-dependent transcription between cdt and tcdE of

20309 through real-time RT-PCR A-C, optimization at various annealing temperature indicated for cdtA, cdtB and tcdE amplification, respectively D, 16S rRNA expression at indicated times E-G, time-dependent mRNA expression of cdtA, cdtB and tcdE, respectively Lanes 1 contained 20309 total RNA with no first-strand synthesis Lanes 2-4 and 5-12 had 11186 and 20309 cDNA template, respectively, reverse transcribed from total RNA (2 µl) extracted at indicated timepoints H, comparative expression with respect to internal control (densitometric pixel unit) I and J, relative CT and calculated concentration values, respectively, with respect to internal control (arbitrary unit) M, DNA ladder Data points represent mean pixel values from triplicate measurements which were corrected by subtraction from non-template background over the total area measured, then normalized with reference to 16S rRNA values

3.2.7 Expression of wild-type and mutant C difficile 20309 CDTa

CDTa (52 kDa) and CDTb (99 kDa) were purified as 6XHis-fusion proteins from recombinant pQE-30 vectors pDA577 under tight regulation by a plasmid-encoded repressor in E coli M15 designated as SK1214 and pDA578 in SK1215, respectively To establish identity of cdtA from 20309 as an ADPRT-encoding gene and to localize functionally important amino acid components, the ability of CDTa to ADP-ribosylate G-actin was assessed and compared with products of mutant constructs with modified amino acid residues that are conserved among ADP-ribosyltranferases (Fig 3.7) and possibly involved in NAD binding or enzyme activities Substrate pDA577 which was subjected to site-directed mutagenesis, transformed into DH5α-T1 and reintroduced into pQE-30, yielded clones producing mutated CDTa listed in Table 2.1 Mutations were confirmed through restriction analysis, size comparison of purified mutant toxins with recombinant wild-type in SDS-PAGE, and sequencing Gel analysis showed similar restriction band sizes, pattern (Fig 3.8A) and protein mass weight of approximately 52 kDa as wild-type CDTa (Fig 3.8B,C,D), indicating identity of mutant toxins with substitution of amino acid residues ascertained and illustrated in sequence electropherograms (Fig 3.9)

3.2.8 Conserved ADP-ribosyltransferase residues are essential for enzymatic function

We then investigated the ability of CDTa and its variant forms to mediate direct hydrolysis of [32P]NAD and attachment thereafter of radiolabeled ADP-ribose moiety to muscle G-actin in an in vitro ADP-ribosylation assay Modified toxins include CDTaY344N and CDTaY344Pwhose Tyr344 was replaced with asparagine and proline, respectively; CDTaR345P whose Arg345 was replaced with proline, CDTaS388H whose Ser388 was replaced with histidine and CDTaE430Awhich had a glutamic acid to alanine substitution in residue 430 (Fig 3.9) Not observed in control and other test lanes, multiple trial phosphorscreen images for wild-type and CDTaY344P-treated lanes, consistently showed a single radiolabeled band of 42 kDa that corresponds to the size of monomeric actin (Fig 3.10A), indicating specificity in substrate labeling

Most mutant toxins exhibited undetectable or weak labeling by CDTa at 4.2% of wild-type band intensity in pixel unit (100%), except for CDTaY344P which exhibited 97.8% of wild-type activity (Fig 3.10A) Complete loss or significant reduction in wild-type ARTase activities implicate Tyr344, Arg345, Ser388 and Glu430 as essential components for optimum biological function of CDTa Our results also suggest that substitution of Tyr344 is not as crucial since it could be replaced by non-polar amino acid proline with differential but only partial reduction in enzymatic activities This has been established in assays with increasing NAD to derive initial rate data for enzyme kinetics where mixtures containing CDTaY344P showed gradual increase in ADP-ribose labeling of actin as the wild-type (Fig 3.10B)

UV Photolabeling of CDTa with [32P]NAD was performed to further explore mechanistic basis for the attenuation or inhibition of ARTase activities by variant CDTa Binding of NAD to CDTaR345P, CDTaS388H and CDTaE430A was beyond the detection limit suggesting that inhibition in ARTase activities is largely if not entirely attributable to steric hindrances posed by altered residue side chains in the docking of NAD to CDTa (Fig 3.10C) On the other hand, disruption

in NAD interaction with both CDTa and actin appeared contributory in Tyr344 mutations as only partial 23.7% and 41.6% reduction in NAD photoinsertion of the wild-type, were observed on asparagine and proline replacements, respectively (Fig 3.10C) Furthermore, photolabeling in both Tyr344 mutants had no significant difference from wild-type (p>0.05, n=3), unlike for ARTase, whereby asparagine replacement showed significant difference to wild-type activities (p=2.1X10-3, n=4) while proline replacement did not (p=0.67, n=4) This indicates that substantial loss in CDTaY344N ARTase activities is not predominantly caused by obstruction in NAD binding, but possibly due to weakened NAD hydrolysis or interaction with actin

Figure 3.7 Alignment of conserved amino acids (red letter) of ADPRT toxins: CDTa,

C difficile 20309 wild-type toxin (AF271719); SK1238, SK1252, SK1228, SK1236 and SK1242 produce CDTa mutated toxins (Table 2.1); Ia, C perfringens iota (X73562); C2,

C botulinum (D63903); C3, C botulinum (M74038); CT: Vibrio cholerae (X58785); PT: Bordetella pertussis (E01352); LT: E coli heat-labile enterotoxin (M17894); and Bacillus cereus VIP2 (Han et al 1999) Putative functions of the 3 conserved regions are indicated (yellow shade)

CDTa 298 LTVYRRSGP 341 PNFISTSIGSV 381 GYAGEYEVLLN

SK1238 298 LTVNRRSGP 341 PNFISTSIGSV 381 GYAGEYEVLLN

SK1252 298 LTVPRRSGP 341 PNFISTSIGSV 381 GYAGEYEVLLN

SK1228 298 LTVYPRSGP 341 PNFISTSIGSV 381 GYAGEYEVLLN

SK1236 298 LTVYRRSGP 341 PNFIHTSIGSV 381 GYAGEYEVLLN

SK1242 298 LTVYRRSGP 341 PNFISTSIGSV 381 GYAGEYAVLLN

Ia 291 LIVYRRSGP 334 PNFISTSIGSV 374 GYAGEYEVLLN

C2 295 LIAYRRVDG 344 LSFSSTSLKST 383 GFQDEQEILLN

C3 84 IILFRGDDP 130 YGYISTSLMN 168 AFAGQLEMLLP

CT 4 KLYRADSR 58 GYVSTSISLR 106 PHPDEQEVSAL

PT 6 TVYRYDSR 48 SAFVSTSSSRR 123 LATYQSEYLAH

LT 4 KLYRADSR 58 GYVSTSLSLR 106 PHPYEQEVSAL

VIP2 345 ITVYRWCG 383 GYMSTSLSSE 422 GFASEKEILLDK

e- transfer/

H-bonding

NAD binding

H-bonding/

salt bridge formation/

NAD binding

Figure 3.8 Comparison of recombinant CCUG 20309 wild-type and mutant cdt and purified His-fusion CDT and mutant CDTa proteins A, restriction analysis of cdt constructs digested with BamHI and HindIII Two microliter aliquot from each methylation and mutation reaction mixture containing 100 ng of pDA577 were loaded per lane Lane 1contained digested pQE-30E whereas lanes 2-7 had digested pDA577, pDA587, pDA594, pDA582, pDA586 and pDA589, respectively (see Table 2.1) M, 1

kb plus DNA ladder (Gibco BRL) B, purified CDTa expressed from pDA577 of SK1214 and visualized in 12% SDS-PAGE Lanes 1-8 contained protein fractions from uninduced clones, induced clones, cell lysate, flow-thru, buffer D1, D2, E1 and E2 eluates, respectively M, high molecular weight protein ladder (Bio-Rad) C, CDTb expressed from pDA578 of SK1215 in 12% SDS-PAGE Lanes 1-6 contained protein fractions from uninduced clones, induced, cell lysate, flow-thru, buffer D1 and D2 eluates, respectively M, high molecular weight protein ladder D, Lane 1 contained cellular extract from pQE-30 of induced SK1203 Lane 2 had CDTa and CDTb expressed from pDA576 of SK1216 in 10% SDS-PAGE Lanes 3-7 had mutant CDTa expressed from mutated pDA577 including pDA587, pDA594, pDA582, pDA586 and pDA589, respectively (see Table 2.1) M, high range protein molecular weight standards (Gibco BRL)

Figure 3.10 ADP-ribosyltransferase activities of various CDTa isoforms in their ability

to radiolabel rabbit skeletal muscle actin with [adenylate-32P] ADP-ribose moiety A, Protein profile in 12% SDS-PAGE (left) and phosphorscreen autoradiogram showing ARTase reactions of CDTa variants Lane 1, contained reaction mixture with purified wild-type CDTa from SK1214; lane 2 with SK1203; lane 3, with no CDT; lanes 4-8, with CDTaY344N, CDTaY344P, CDTaR345P, CDTaS388H and CDTaE430A B, protein profile (upper panel) and autoradiogram (lower panel) showing ARTase reactions at increasing NAD concentrations Lanes 1-3, 4-6, 7-9, 10-12, 13-15 and 16-18 contained wild-type CDTa, CDTaY344N, CDTaY344P, CDTaR345P, CDTaS388H and CDTaE430A, respectively at 2, 6 and

12 nCi concentrations of [32P]NAD C NAD photoaffinity labeling of CDTa from SK1214, CDTa from SK1203, CDTaY344N, CDTaY344P, CDTaR345P, CDTaS388H and CDTaE430A (lanes 1-7) M, BenchMark protein ladder (Invitrogen)

of subtractive hybridization eliminated homologous interspecies DNA touted to be housekeeping determinants of basic metabolic processes

The specificity of enriched subtraction products was realized when it hybridized with DNA from known virulent C difficile strains and failed to do so with nonpathogen DNA and library host strain containing the vector only Moreover, detected clone fragments showed homology to annotated virulence factors of C difficile and other organisms (Table 3.1) Several clones contained PaLoc genes including partial copies of adjacent tcdA and tcdE and gene portions of tcdB encoding for toxins involved in the attachment of glucose moiety from donor UDP-glucose to acceptor Thr37 of GTP-binding RhoA protein (Just, Selzer et al 1995a; Just, Wilm et al 1995b) Other toxin homologs include Corynebacterium diphtheriae Tox protein, Aeromonas hydrophila alpha-hemolysin and ADP-ribosylating toxin which was pursued further

in this study GS110 insert matched a short N-terminal sequence of fragment A (193 kDa) of C diphtheriae toxin which is part of a proteolytically activated holotoxin that ADP-ribosylates and inactivates elongation factor 2 (Collier 1967; Bishai, Rappuoli et al 1987) GS157 showed 65% identity to alpha-hemolysin and although amino acid coverage is not extensive, its presence in pathogenic C difficile is warranted since hemolytic toxin causes septic arthritis by promoting secretion of proinflammatory factors from immune cells (Krull, Dold et al 1996) Secretion of a similar protein which participates in colonic inflammation, a sequelae of infection, is not

surprising The toxin has also been reported to mediate cell lysis by forming heptamers upon insertion into target membrane (Song, Hobaugh et al 1996) and to aid S aureus in biofilm formation on plastic surfaces (Caiazza and O'Toole 2003) A similar protein may be at work for efficient C difficile adsorption and colonization of intestinal epithelium as the polysaccharide matrix formed by multiple aggregate not only stabilize but also protects the colony from antimicrobials and host defense onslaught In fact, a related homolog C perfringens luxS (Ohtani, Hayashi et al 2002) which participates in quorum sensing has been recently isolated with its characterization under way (Song, personal communication) Other virulence homologs include catalases from diverse species (Bethards, Skadsen et al 1987; Wood, Setubal et al 2001) which protect organisms from toxic peroxides and cell damaging activated oxygen radicals whose elimination is a key step to survival (Markillie, Varnum et al 1999) A socE portion was also matched in GS101, whose complete gene expression in C difficile may participate in the regulation of spore-forming process (Crawford Jr and Shimkets 2000) Of special interest is a structural S-layer homolog traced to C difficile strain 630 As cell envelope component and due

to its propensity to extracellular matrix-binding, the S-layer can enhance virulence by facilitating bacterial adhesion to target membrane surface (Doig, Emody et al 1992) and resisting interaction with host immune effectors (Kotiranta, Lounatmaa et al 1997) The crystalline protein lattice linked to cell wall teichuronic acid polymer also serve as portal for the diffusion of exoenzymes that are adhered to the structure (Sleytr, Messner et al 1993; Lemaire, Myras et al 1998)

Homology to unknown and hypothetical proteins was detected at 26%, a proportion which approximates those in complete genome sequences For example, 511 out of 2185 (23%) ORFs in the D radiodurans genome matched with hypothetical protein (White, Eisen et al 1999) while nearly 40% in E.coli K-12 remains uncharacterized (Blattner, Plunkett et al 1997) Even closely related C perfringens contains 44.1% of ORFs that are similar to proteins with either no known function or with unique sequences (Shimizu, Ohtani et al 2002) Detection of such sequences underscores the efficiency of the subtraction process

GS80 insert has homology to cdtB portion of the binary cdt in strain CD196 of toxinotype VIII (Stubbs, Rupnik et al 2000) Our preliminary survey revealed 39% of truncated form in

19126 and among clinical strains The complete binary genotype was solely traced to CCUG

20309, a unique cytotoxic serotype F strain with full tcdB but truncated tcdA genes However, despite the large toxin A deletion (3’-end) and possession of a weak enterotoxin undetectable in immunoassays (Borriello, Wren et al 1992), vigilant monitoring of its distribution must be sustained since it has been shown to cause diseases even in animals and has been increasingly implicated in outbreaks of antibiotic associated diarrhea during the past years (Kato, Kato et al 1998; Alfa, Kabani et al 2000) Given these, the contribution of CDT in pathogenesis as an ADPRT is potentially considerable

Analysis of 19126 and 20309 cdt gene regions also revealed the presence of identical repeat sequences as possible transposition remnants of mobile elements such as cryptic phage or insertion sequences (IS) In Shigella flexneri genome (Wei, Goldberg et al 2003), 46 such insertion sequences were found as gene-flanking direct repeats, while in E.coli K-12, these were classified into groups and even found to comprise large genomic segments of 5.7 to 9.6 kb in length (Bachellier, Clement et al 1997; Clement, Wilde et al 1999) Mobile DNA can encourage intra- and interstrain promiscuity which is manifested as intragenic punctuation or disruption resulting in genetic rearrangement

Genetic mobility through horizontal transfer could be manifested as heterogeneity in cdt characterized by block deletion in 19126 and cassette insertion in 20309 As patches of direct repeats were located along boundaries or internal to cdt of 20309 and 19126, the locus shows properties of a pathogenicity islet or its being part of a larger pathogenicity island (PAI), which are composed of virulence gene clusters interrupted by IS, transposons, phage integrons or plasmids (Groisman and Ochman 1996; Hacker, Blum-Oehler et al 1997) In S flexneri chromosome, several islands with such elements have also been identified including the SHI series encoding for transporter, enterotoxin (Al-Hasani, Rajakumar et al 2001), antibiotic

resistance factor (Turner, Luck et al 2001), sideophore system involved in iron acquisition (Moss and Vaughan 1988) and criR regulator involved in the expression of invasion plasmid antigen (Walker and Verma 2002) The PaLoc locus is one pathogenicity islet in C difficile It was replaced with a 127 bp portion carrying repeats with predicted secondary structure in 11186 This may have been the entry point of IS-flanked toxin cluster either through homologous recombination or transposon-mediated insertion, a process reminiscent in Bacteroides fragilis whereby a 17 bp sequence in the nontoxigenic strain served as target for insertion of a pathogenicity islet containing the tandem enterotoxin fragilysin and metalloprotease genes (Moncrief, Duncan et al 1998) A parallel event may have occurred in the creation of varying cdt genotypes and as such, it is tempting to speculate that 19126 with truncated cdt may have been a descendant of 20309 after it has undergone block deletion Furthermore, it would be interesting

to explore adjacent sequences beyond the PaLoc and cdt in order to determine whether the loci comprise a more extensive pathogenicity island

Aside from variations in interstrain toxin genotype, non-conforming regulation in transcription may account for differences in the degree of pathogenicity In this regard, we have analyzed the transcription pattern of the cdt relative to PaLoc toxin genes to elucidate the interrelations between Tcd and CDT production While expression studies have aided in the investigation of PaLoc gene properties (Hundsberger, Braun et al 1997), similar data on cdt is lacking despite its importance in functional evaluation and development of effective therapeutic intervention As such, we have characterized the cdt regulatory region before comparison of mRNA production with a PaLoc polycistron gene, tcdE with respect to an internal standard whose production is maintained at relatively high but constant level

For comparative studies, amplicons were first quantitated as band densities then confirmed as significant fluorogenic threshold intensities recognized in real-time detection The level of fluorescence is proportional to exponential increase in labeled amplicon products, hence,

samples with minimal target sequence would require more cycles to generate sufficiently significant signal that would result in higher CT value transposable into concentration

Similar pattern and magnitude in mRNA production of cdtA and cdtB and absence of consensus promoter sequence upstream of cdtB, suggest possible bicistronic configuration of cdt operon Compared to tcdE, cdt had significantly lower transcript level which conforms with earlier findings on high expression of PaLoc toxins TcdA and TcdB at a ratio of 3:1 (von Eichel-Streiber, Harperath et al 1987) Readthrough mRNA screening of the PaLoc identified tcdE as part of multiple transcription units such as one comprised of tcdD, tcdB, tcdE and tcdA, which is transcribed in one direction opposite the tcdC cistron (Hundsberger, Braun et al 1997) Separation of cistron units was revealed by absence of readthrough transcript and detection of bidirectional terminator including one that is located at the tcdA and tcdC intergenic region (von Eichel-Streiber and Sauerborn 1990) Furthermore, presence of multiple transcription initiation sites indicated the presence of several promoters within the PaLoc, leading to elevated gene expression due to combined monocistronic and polycistronic transcription Thus, more efficient transcription of tcdE compared to cdt is not surprising

Differential virulence gene expression is not unique to C difficile Recently, transcription of streptococcal capsular polysaccharide genes was revealed to have marked discrepancies through time and in various growth conditions (Ogunniyi, Giammarinaro et al 2002) Unsynchronized regulation appears universal and necessary as living cells coordinate protein synthesis for physiologic adaptation As such, differential cdt and tcdE expression may

be due to discrepancy in promotional activities despite controlled amplification efficiency through usage of primers that would anneal at similar temperatures and amplify products of comparable sizes In addition, stringent experimental controls were also employed to minimize the effect of varying transcript stability and turnover rate, generating consistent intra- and inter-assay results However, although RT-PCR has been used extensively in many fields particularly

in diagnostics and shown to be sensitive, reproducible and applicable for simultaneous

quantitation (Seeger, Kreuzer et al 2001; Solassol, Kreuzer et al 2001), direct interpolation of gene level to translated product should be considered with caution In fact, discrepant mRNA and protein profiles for several toxins was reported previously (Lachumanan, Armugam et al 1999)

Compared to cdt, tcdE transcripts were more abundant throughout most stages in the growth cycle, but similar peak patterns notable in the early stationary phase for both loci genes

As part of PaLoc cistron unit, prompt expression of tcdE may equate to simultaneous production

of large clostridial toxins which may be advantageous during early stages of infection PaLoc toxins induce colitis characterized by inflammatory intestinal secretion consisting of necrotized epithelial and proinflammatory cells (Castagliuolo, Keates et al 1998) that release chemokines resulting in enhanced phagocytic infiltration, host permeability and death (Pothoulakis and Lamont 2001) In fact, inactivation of toxin substrate, Rho protein was reported to increase cellular and blood-lumen permeability through weakening of tight junction and disruption of cytoskeletal integrity (Riegler, Sedivy et al 1995) Therefore, it is perceivable that destruction and breach of intestinal epithelium would take precedence to facilitate toxin entry prior to Rho monoglucosylation and actin ADP-ribosylation by C difficile toxins CDT may assume an adjunct role to major toxins whose prompt synthesis seemed critical for effective infiltration and perhaps evasion of nonspecific host defenses Since gene regulation is multifactorial, it would likewise be interesting to explore changes in expression pattern in vivo where influences of complex environmental and host factors are involved

Binary CDT and constructed mutant forms of CDTa were then expressed for functional characterization Using in vitro biochemical assay, the actin-specific ADPRT action of CDTa was demonstrated Identified were important residues for ADP-ribosyltransferase activity namely Arg345, Ser388 and Glu430 which correspond to C botulinum C2I toxin’s Arg299, Ser348 and Glu389, respectively (Barth, Preiss et al 1998) Similar residues were also located in other ADPRTs such as C perfringens Ia toxin (Nagahama, Sakaguchi et al 2000), V cholera CT toxin (Spangler 1992), E coli heat-labile LT enterotoxin (Spangler 1992), Pseudomonas exoenzyme