... International”. Her home-based art career included graphic design, and teaching recreational drawing and painting classes. As supervisor of her community’s recreational art department, Brenda hired and ... your imagination and make up a unique facial profile. ¬ Have a friend or family member pose sideways and make a contour drawing of his or her profile. ¬ Take a photo of someone’s facial profile, ... You can have lots of fun creating and sharing a personalized collection of faces and vase drawings. Think about creating making unique gifts for your family and friends with this amusing illusion....
Ngày tải lên: 21/01/2014, 08:20
... would probably inves- tigate the real estate market in the immediate area. 7. Do you speak a foreign language? (If you speak another language fluently, by all means say so. This is an asset. However, ... with each other, and eventually it was too late to salvage anything. I’ve learned that, to earn respect and honesty, you have to communicate openly and be prepared to give honesty and respect. ... origin, age, gender, marital status, physical handicap, medical condition, arrest information, or other un - lawful criteria. In spite of the law, illegal questions get asked every day, and company...
Ngày tải lên: 05/10/2012, 09:47
RELATIONSHIP BETWEEN ALLOCHTHONOUS DOC CONCENTRATION AND A SPECIFIC UV254 ABSORBANCE (SUVA) AT A MESO-STRATIFIED RESERVOIR
Ngày tải lên: 05/09/2013, 08:40
Configuring a Stub Area and a Totally Stubby Area
... instead to create a smaller and more stable routing table using a stub or totally stubby area configuration. Step 1 Build and configure the network according to the diagram. Configure multiarea ... Recall that interarea (IA) routes point to networks in different areas within the same OSPF autonomous system. Because Area 2 is a stub area, all external routes (Type 5 LSAs) have been ... a default route. Step 4 You decide that stub area configuration is not making a significant-enough impact on Area 2. Because Capetown can use the default route to its ABR for all nonlocal...
Ngày tải lên: 27/10/2013, 08:15
Ma trận LED 7 x 5 dislay 0 - 9 and A to N
... noi vao Cot thong qua con ULN2803 // #include // part specific constants and macros #include "PSoCAPI.h" // PSoC API definitions for all User Modules unsigned char m,n,lap; ... void dislay() { for(m=0;m<23;m++) { for(lap=0;lap<250;lap++) { for(n=0;n<5;n++) { PRT2DR=quetcot[n]; PRT0DR=codeled[m][n]; delay(); PRT0DR=0xff; // Tat tat ca cac hang PRT2DR=0x00; ... Ma trận LED 7 x 5 dislay 0 - 9 and A to N Ngu ồn : biendt.biz Các pác nhìn thấy các bảng quang báo người ta quảng cáo có các dòng chữ chatyj từ phải qua trái hay ngược lại. Cái...
Ngày tải lên: 04/11/2013, 17:15
Structural and semantic features of english idioms referring to head and a contrastive analysis with vietnamese idioms
Ngày tải lên: 20/12/2013, 18:33
Tài liệu SEXUAL HEALTH EDUCATION A T SCHOOL AND A T HOME: ATTITUDES AND EXPERIENCES OF NEW BRUNSWICK PARENTS pptx
... parents in support of SHE in rural Ontario (McKay et al., 1998) and 95% in rural Nova Scotia (Langille et al., 1996), and suggests that the fears teachers and administrators have of parental and ... school, and issues such as homosexuality and relationships have no place in an academic institution. Issues such as avoiding sexual abuse and awareness of 25 The Canadian Journal of Human Sexuality, ... of SHE at school? The answer to this SEXUAL HEALTH EDUCATION AT SCHOOL AND AT HOME: ATTITUDES AND EXPERIENCES OF NEW BRUNSWICK PARENTS Angela D. Weaver E. Sandra Byers Heather A. Sears Jacqueline...
Ngày tải lên: 14/02/2014, 14:20
Tài liệu Báo cáo khoa học: Homologous expression of the nrdF gene of Corynebacterium ammoniagenes strain ATCC 6872 generates a manganese-metallocofactor (R2F) and a stable tyrosyl radical (Y•) involved in ribonucleotide reduction ppt
... GTA GGT TGA TTT CAT GTC GAA TG-3¢; additional XbaI site underlined) and OB 3 (5¢-AAA AGA ATT CTT AGA AGT CCC AGT CAT CGT C-3¢; additional EcoRI site underlined). The amplified PCR fragment (Taq ... all measurements. For GF-AAS measurements, an AAS5 EA system (Carl Zeiss GmbH, Jena, Germany) was used. Manganese was determined at a wavelength of 279.8 nm and iron at 248.3 nm; for each analysis, ... nrdF + gene was sequenced by a primer walking approach. For DNA analysis, dnastar software (DNAS- TAR Inc., Madison, WI, USA) and clone manager 5.0 (Scientific & Educational Software, Cary, NC, USA)...
Ngày tải lên: 15/02/2014, 01:20
Tài liệu Báo cáo khoa học: Proteomic analysis of dopamine and a-synuclein interplay in a cellular model of Parkinson’s disease pathogenesis docx
... cellular model of Parkinson’s disease pathogenesis Tiziana Alberio 1 , Alessandra Maria Bossi 2 , Alberto Milli 2 , Elisa Parma 1 , Marzia Bruna Gariboldi 1 , Giovanna Tosi 3 , Leonardo Lopiano 4 and ... kinase, 60S acidic ribosomal protein P2 (RPLP2), eukaryotic initiation factor 5A (eIF 5A) , parathymosin, L7 ⁄L12, annexin A2 , annexin A5 , aldolase A, fascin 1 and peroxyredoxin 1] displayed quantitative ... biochemical alterations associated with the interplay of cytosolic dopamine and increased a- synuc- lein are still unclear. Catecholaminergic SH-SY5Y human neuroblastoma cells are a suitable model...
Ngày tải lên: 15/02/2014, 01:20
Tài liệu Đề tài " Logarithmic singularity of the Szeg¨o kernel and a global invariant of strictly pseudoconvex domains " docx
... conformal invariants from the heat kernel k t (x, y) of the conformal Laplacian, and their CR analogue for CR invariant sub-Laplacian by Stanton [22]. For a conformal manifold LOGARITHMIC SINGULARITY ... boundary ∂Ω. Moreover, it is shown in [11] and [8] that this conformal invariant can be expressed as the integral of Branson’s Q-curvature [3], a local Riemannian invariant which naturally arises ... {Ω t } t∈I be a real analytic family of strictly pseudoconvex domains, where I ⊂ R is an open interval. Here a real analytic family means that Ω={(x, t) ∈ M = M × I : x ∈ Ω t } admits a real analytic...
Ngày tải lên: 16/02/2014, 05:20
Tài liệu Police Personnel Challenges After September 11 - Anticipating Expanded Duties and a Changing Labor Pool pdf
... Standards to Ensure They Are Realistic and Relevant Law enforcement agencies have rigorous standards for recruiting and have begun to examine those standards to make sure they are realistic and ... SECURITY POPULATION AND AGING PUBLIC SAFETY SCIENCE AND TECHNOLOGY SUBSTANCE ABUSE TERRORISM AND HOMELAND SECURITY TRANSPORTATION AND INFRASTRUCTURE WORKFORCE AND WORKPLACE The RAND Corporation is a nonprofit ... police department budgets, local agencies can make little investment in planning and analysis functions. As an initial step toward addressing the planning and analysis gap for local law enforcement agencies,...
Ngày tải lên: 17/02/2014, 22:20
Tài liệu Báo cáo khoa học: How disorder influences order and vice versa – mutual effects in fusion proteins containing an intrinsically disordered and a globular protein docx
... (5¢-TACCGTTAACATCGATATGCATCATCATC ATCATCATGC-3¢) was designed to insert a ClaI restric- tion site at nucleotide position )6, whereas the reverse primer (5¢ -ATCGCCATGGTCCCGGGCATATGGGATC CCTGGAAGTACAGGTTTTCCTTTTTAATGGGTGTC CC-3¢) ... (5¢-TAC CTGGCCAATGAATATGCATCATCATCATCATCATA CTCCGTCGACCCCACC-3¢) designed to introduce a hexahistidine tag and a ClaI restriction site at nucleotide position –6 and a reverse primer (5 ¢ -A TCGCCATGGTC CCGGGCATATGGGATCCCTGGAAGTACAGGTTTT CGCCATGCTCTTGATCCC-3¢) ... to thank Antonino Natalello and Silvia Maria Doglia for their assistance with the fluorescence spectroscopy, as well as for critically reading the manuscript. We are indebted to Maria Samalikova...
Ngày tải lên: 18/02/2014, 04:20
Tài liệu Báo cáo khoa học: The chitinolytic system of Lactococcus lactis ssp. lactis comprises a nonprocessive chitinase and a chitin-binding protein that promotes the degradation of a- and b-chitin doc
... 5¢-GGTATTGAGGGTCGCCATGGTTATGTTC AATCACCA-3¢; reverse primer, 5¢-AGAGGAGAGTTAG AGCCTTACAAGAAGGGTCCAAAGA-3¢). The PCR product was purified, treated with T4 exonuclease to create vector-compatible overhangs and annealed to a prepared ... chitinolytic machineries, such as in the lactic acid bacterium (LAB) Lactococcus lactis ssp lactis IL1403. LABs are Gram-positive, facultatively, anaerobic, fermentative bacteria that are of major importance ... FEBS containing 100 lm of (GlcNAc) 1–4 was analysed at the start, in the middle and at the end of each series of sam- ples. The resulting average values of the standards (display- ing standard deviations...
Ngày tải lên: 18/02/2014, 08:20
Tài liệu Báo cáo khoa học: Verprolin function in endocytosis and actin organization Roles of the Las17p (yeast WASP)-binding domain and a novel C-terminal actin-binding domain doc
... organization Roles of the Las17p (yeast WASP)-binding domain and a novel C-terminal actin-binding domain Thirumaran Thanabalu 1,2 , Rajamuthiah Rajmohan 2 , Lei Meng 2 , Gang Ren 4,5 , Parimala R. ... polyclonal GFP-spe- cific antiserum was a gift from J. Kahana and P. Silver (Dana Farber Cancer Center, Boston, MA). The anti-actin mAb was MAB1501 from Chemicon International (Teme- cula, CA). The anti-hexokinase ... hand, and in cortical actin-patch polarization, on the other hand, are at least partially distinct [23]. However, there may still be a functional link between endocytosis and actin-patch polarization....
Ngày tải lên: 18/02/2014, 16:20
Tài liệu Báo cáo khoa học: The nuclear lamina Both a structural framework and a platform for genome organization pdf
... family, one type in lower phyla like cnidaria or nematodes and four major forms in mammals, designated A- type (lamin A and lamin C) and B-type (lamin B1 and lamin B2), in addition to an increasing ... Gullotta F, Lattanzi G, D’Apice MR, Capanni C, Nardone AM, Columbaro M, Scarano G, Mattioli E, Sabatelli P, et al. (2005) Alterations of nuclear envel- ope and chromatin organization in mandibuloacral ... for chromosomes, chromatin and ⁄ or DNA [24,32–35]. Because chromatin and the nuclear lamina exhibit an intimate spatial relationship, it has been suggested that chromosomes are anchored, at least to some...
Ngày tải lên: 19/02/2014, 02:20
Bạn có muốn tìm thêm với từ khóa: