ecosystems and human wellbeing a manual for assessment practitioners

... organizations (gos), and international and local nongovernmental organizations (ngos) Trang 11manag-r At i o n A L e F o manag-r g e n D e manag-r i n t e g manag-r At i o n A n D m A i n s t manag-r ... financial resources and power are fundamental to their capacity to access and use health information, make informed decisions about their health and fertility, and to negoti-ate and insist on safe ... international and national health specialists can use this manual when shaping programs responsive to rFAs and rFPs Programs that use gender integration approaches have a strategic advantage in meeting

Ngày tải lên: 28/03/2014, 14:20

... primer: GTAGCCCACTCTCTCGTCCAA Probe: AAGGCACGCCCTCCCAGCG Reverse primer: GAGATTACAGAGGAAGTTATCCTCTGC Probe: TGCAGTGAAGGTTGCTGAGGCTCTGA Reverse primer: AACTCTTGGATTCTATGCATGAAAATGTTA TGTGGTTA Probe: ... Regression analysis was performed using Microsoft Excel Table 1 Probes and primer sequences used Reverse primer: ATGGTGAATATCATCATGAAAAAGATTC Probe: CATGCTCATTCTCAACCACATCACCAACA Reverse primer: GTAGCCCACTCTCTCGTCCAA ... protein Statistical analysis Data are reported as mean ± standard deviation (SD) of repli-cate mean values for separate patient cell cultures However, because of interindividual variation, data in

Ngày tải lên: 09/08/2014, 08:22

... distally along the shoe), medial (greater medial than lateral wear at the heel and forefoot), which may indicate excessive pronation, or lateral (greater lateral than medial wear at the heel and forefoot), ... shoes, and sandals. The range for each quantitative measure from the included footwear can be found in Table 1. Intra-rater reliability Intra-rater ICCs and 95% LOAs for quantitative measures are ... order for health professionals to accurately and effi- ciently critique an individual's footwear and provide advice, a valid and reliable footwear assessment tool is required. The availability

Ngày tải lên: 10/08/2014, 21:23

... Interdisciplinary Food Safety Research Neal M Hooker and Elsa A Murano Automation for Food Engineering: Food Quality Quantization and Process Control Yanbo Huang, A Dale Whittaker, and Ronald E Lacey Trang ... publications in text with author name and year Use “and others” rather than “et al.” In parentheticalcitations, do not separate author and year with a comma Use commas to separate publications ... variables are placed on the x-axis (abscissa) and dependent variables areplaced on the y-axis (ordinate) Generally, use a line graph when the independent variable is continuous, and a bar graph

Ngày tải lên: 21/04/2015, 13:38

... produce a major amount of the capital factor The three companies are analyzed: a German, namely Deutesche Bank and the other two Italian, namely Unicredit and Generali The research data comes from a ... bank sample, which means that bank-affiliated groups tend to pay a lower valuation Fang at al (2012) find that both the estimated parent bank’s (individual) share, as well as all banks’ total ... companies for which the period under review were available financial statement data and reclassified comparable The data related to the reporting of the banks have been derived from the base data

Ngày tải lên: 01/02/2020, 21:55

... should be valid for the children based on their age, culture, ability, home language, and other characteristics, appropriate for the child’s age and characteristics, and aligned with standards which ... richer and more accurate information and helps parents understand the assessment role in students’ learning and motivation 4 Expressive language assessment in preschool children In all the areas ... result gained from partnership assessment Parents and teachers are co-experts in the assessment partnership and share responsibilities in planning for assessment, documentation, evaluation and decision-making

Ngày tải lên: 27/01/2021, 04:38

... UNECA, Virginia Cram-Martos, Jaromir Cekota and Lorenza Jachia at UNECE, Ekaterina Krivonos at UNECLAC, Shamika Sirimanne at UNESCAP, Jian Pak at UNESCWA, and Bernado Calzadilla Sarmiento at ... implementing a national trade facilitation policy; • enabling an active participation in regional and international trade tion forums; facilita-• providing a national forum for information collection and ... have the capacity or budget to mitigate its impact Floods in coast-al areas have destroyed crops and caused widespread human and infra-structural damage, as has drought in sub-Saharan Africa • In

Ngày tải lên: 26/01/2022, 15:31

... imported and labeled as abalone This shellfish is small and tough and quite unlike abalone in appearance, taste and texture preserva-tion, nutritional enhancement and many other good reasons The FDA ... irradiation as an additive Gases that may be used in packaging (as well as certain constituents of packaging materi-als) are also defined as additives Partly for this reason (and partly be-cause of fears ... differently Trang 18BASS Pacific barracuda Sphyraena argentea This fish is also called snake, scooter and California barracuda, but none of these names are nized for interstate trade recog-Caught in

Ngày tải lên: 12/03/2022, 09:21

... figures and tables you can generate a combined index of figures and tables 3.5 Abbreviations Abbreviation that are commonly used and generally accepted can always be used For German papersall abbreviations ... SLUB) for a translation ofstandard formula into text 3.3 Figures and tables Figures and tables serve for a pictorial presentation of the analyzed context They shall support the reading and only ... seminar paper, you are to add the name or number of your group 10 Trang 18 EE2 Seminar Paper How to Write an Academic Paper A Manual for the Preparation of Seminar Papers and the Diploma/Master/Bachelor

Ngày tải lên: 18/10/2022, 19:09

... vaccine to safe storage at the Rayon or Oblast SES and separately account for it.• After a mass campaign using an injectable vaccine, control and safe disposal and destruction of used disposable ... Time-temperature exposure of CCM cardWindows completely blue A AB ABCAt a temperature of 12ºC 3 days 8 days 14 daysAt a temperature of 21ºC 2 days 6 days 11 daysAn example of a CCM card for a vaccine batch ... time are used as the basis of calculation The wastage factor is calculated separately for each vaccine, and for any period for which you have reliable records, using the formula: Index of vaccine

Ngày tải lên: 24/04/2024, 10:56

... training materials available 5.3 Select, organize and evaluate the training program for target groups 6 Human rights in MEASURING IMPACT AND AUDITING 6.1 Set relevant performance indicators ... as data protection, wage fixing, working hours and holidays, non-discrimination, occupational health and safety, and product safety, are all founded in human rights and form part of a company’s ... good.’ Human rights provide a universal and legitimate framework that is applicable everywhere and to any stakeholder group A human rights analysis can help highlight additional risks and opportunities

Ngày tải lên: 29/03/2014, 19:20

... Effort) Summary of Catch and Effort Assessment Based on a Little Biology (Age at First Spawning) Summary of Age at First Spawning Information for a More Complete Assessment Best Available Data AGE, ... caught and landed per year)alone are not very useful Landings can fluctuate up and down for a variety of reasons A trend ofdecreased landings may be a cause for concern, but the amount of effort made ... National Oceanographic and Atmospheric Administration, Saltonstall-KennedyGrant (NA37FD0079-01) and is partly a result of research sponsored by the Mississippi-Alabama Sea Grant Consortiumand NOAA, Office

Ngày tải lên: 31/03/2014, 13:20

... [9] create a model to understand radio narrow band propagation near the body at the 915 MHz and 2.45 GHz bands A model is developed for path loss, small-scale fading, and RMS delay spread Another ... created for each trial A second Java program (Analyze.java) was developed to analyze the saved files containing the received packets Since the transmitted data is known, this program can easily calculate ... for that particular packet All of these packets are picked up by BaseStation.java listening on the USB port and it saves each consecutive packet in a file for future analysis A new file is created

Ngày tải lên: 21/06/2014, 18:20

... and P(B) are a priori probabilities of objects and backgrounds, and P(O/B) and P(B/O) are the probabilities of error in classi-fying objects as background and vice versa: Applying PE to a case ... segmentation and the segmentations have been integrated to form the ideal segmentation for each image, comparisons between the segmentation found and the ideal segmenta-tion can be made to obtain a ... thermographic images and also to find the optimum parameters of each al-gorithm 2 PREVIOUS EVALUATION METHODS Zhang [2] proposes a classification of existing assessment methods as “analytical,”

Ngày tải lên: 22/06/2014, 23:20

... Behavioral-Based Procrastination, which is usually caused by a lack of information or training, Fear-Based Procrastination is caused by, as its name implies, fear. Fear is unfortunately a major ... I disagree. As humans, we are subject to death, disease, disappointment, loss, heartbreak, natural disaster and human- made disaster, among many other afflictions. Fear is, in my view, an entirely ... write anything over the weekend. That’s what ‘real’ writers do, and if you can’t do it, that means you’re just a faker and a fraud.” It’s a stream of self-abuse, guilt, shame, and blame: I call...

Ngày tải lên: 21/02/2014, 22:20

... Medical Association and state and county medical societies d. National, state, and local specialty and subspecialty organizations (e.g., AAFP, ACP, AAP) e. Nationally recognized charitable organizations ... California Pacific Medical Center, San Francisco, California. J. Westley McGaughey, BA , is Research Analyst, Grants and Study, in the Program in Medicine and Human Values, California Pacific Medical ... Palliative Care in the Department of Medicine at the Alameda County Health Center, Oakland, California. Alexis Lopez, BA , is a Research Technician with the Program in Medicine and Human Values, California...

Ngày tải lên: 07/03/2014, 10:20

... gen- der-specific quantitative and qualitative data that the information can be meaningfully incorporated into management decisions and reporting. It is as important to involve participants and stakeholders in ... adolescents’ and men’s atti- tudes and behavior. Advocacy through social groups and their lead- ers can provide an enabling context for changes in values and norms that allow individuals to make new ... chief also lent his support by saying that life changes and traditions change. • The Bambara village where this series of data collection, analysis, and attitudinal change took place also made...

Ngày tải lên: 14/03/2014, 15:20

... detailed analyses a) and b). Nakamura K et al. Kekkaku 1970; 45: 221. WHO/CDS/TB/99.272 TUBERCULOSIS A Manual for Medical Students By NADIA AIT-KHALED and DONALD A. ENARSON World Health Organization ... BCG or atypical mycobacteria). TUBERCULOSIS A MANUAL FOR MEDICAL STUDENTS CHAPTER I 17 Criteria for identification of mycobacteria M YCOBACTERIA ASPECT OF NIACIN NITRATE CATALASE CATALASE 68° COLONIES ... accompany active pulmonary tuberculosis. FOREWORD This manual aims to inform medical students and medical practitioners about the best practices for managing tuberculosis patients, taking into account...

Ngày tải lên: 15/02/2014, 13:20

... degraded, and the degraded area continues to expand. [4] Changing Land Use and Land Cover Current rates of land cover change are greatest for tropical moist forests and for temperate, tropical, and ... Trinidad Downstream Mekong Wetlands, Viet Nam Western China Alaskan Boreal Forest Arafura and Timor Seas Argentine Pampas Central Asia Mountains Colombia coffee-growing regions Eastern Himalayas Sinai ... TYPES SUB-GLOBAL ASSESSMENT ECOSYSTEM SERVICES Altai-Sayan Ecoregion San Pedro de Atacama, Chile Caribbean Sea Coastal British Columbia, Canada Bajo Chirripo, Costa Rica Tropical Forest Margins India Local...

Ngày tải lên: 17/02/2014, 19:20

... the Amazon, Central Af- rica, and Southeast Asia; coastal and marine ecosystems in the Caribbean Sea and Papua New Guinea, and urban eco- systems in Sweden and Brazil, among others. Many assess- ments ... Atacama, Chile Caribbean Sea Coastal British Columbia, Canada Bajo Chirripo, Costa Rica Tropical Forest Margins India Local Villages Glomma Basin, Norway Papua New Guinea Vilcanota, Peru Laguna ... Altai-Sayan and Trinidad). Local factors include market access (for example, distance to market, as in Papua New Guinea), disease prevalence (malaria, as in India Local and Papua New Guinea), or localized...

Ngày tải lên: 17/02/2014, 19:20