... from the adsorptive surface Since for neutrally charged JNPs, the electrostatic repulsions between positively charged beads of JNPs and the surface are approximately balanced by the attractions ... distribution area of JNPs changes little as ρ+is increased For the cases of ρw= 0.02σ−2, the change in the locations of the main concentrated area of JNPs is similar to the cases of ρw= 0.06σ−2 at ρ+= 0.1 ... in other cases Because the adsorptive surfaces are positively charged, a thin layer of negative counterions appears near the surface In addition, along with the thin layer of negative counterions
Ngày tải lên: 24/11/2022, 17:40
... principal in organisations The second is the issue of conflicting goals between them with both of them having self interest far above that of the other Since both of them in the relationship are utility ... by the agent and the expectations of the principal that would have maximised the welfare of the principal if the difference had been eliminated or minimised The import of this argument is that, ... Dedication 4 Abbreviations 9 Chapter 1: Introduction 10 1.1 Motivation/Statement of Problem 10 1.2 Objectives of the study 12 1.3 The choice of Methodology 13 1.4 Organisation of the thesis
Ngày tải lên: 10/12/2016, 13:31
PhD Thesis submitted to the Faculty of Economics at the University of Neuchâtel
... when they make smoking-related decisions Fully rational individuals are assumed to be very aware of the future implications of addiction and to incorporate those considerations into their decisions ... incorporate the future into their decisions has an important impact on the interpretation of the model Some subgroups within the population are assumed to have greater rates of time preference (they ... implemented in the last decade hardly influenced smoking participation among youths Another strategy that could potentially influence the behavior of this at-risk population is the dissemination of proper
Ngày tải lên: 11/12/2016, 20:35
Quantifying solar radiation at the earth surface with meteorological and satellite data
... measured solar radiation 32 radiation at operational weather stations 50 radiation 51 xvii Trang 18xviii List of Figuresobserved radiation at operational weather stations 52 3.8 Annual ... estimates 1.2 Solar radiation data sources Direct measurements of solar radiation at weather stations are the most accuratesource of solar radiation data, provided that the equipment is well-maintainedand ... quantitative analysis of the influence of each source of error on the accuracy of solar radiation estimates is not in the scope of this thesis It is expected that the accuracy of solar radiation
Ngày tải lên: 03/03/2017, 10:10
Arterial stiffness, thickness and association to suitable novel markers of risk at the origin of cardiovascular disease in obese children
... inversely related to the arterial nitrate-mediated dilatation likely being involved in early atherosclerosis [26] In other studies, oxLDL was associated with the incidence of MetS, the sum of obesity, ... the superior border of the iliac crest and the lower most margin of the ribs at the end of normal expiration and waist to height ratio (WTHR) calculated as rough estimate of visceral obesity ... timing of the reflected waves that, in turn, are preliminarily related to peripheral vascular resistance and distensibility of the aortic wall [3] Since it reflects the combination of all these features
Ngày tải lên: 15/01/2020, 16:28
A STUDY ON DIFFICULTIES OF AND HOW TO ENHANCE COMMUNICATION SKILLS OF STAFF AT THE CONSULTATIVE INSTITUTE FOR SOCIO ECONOMIC DEVELOPMENT OF RURAL AND MOUNTAINOUS AREAS (CISDOMA)
... interviews 17 3.2 Data analysis 18 3.2.1 Years of learning English of staff at CISDOMA 18 3.2.2 Level of English proficiency of staff at CISDOMA 19 3.2.3 Emotions of the staff at CISDOMA when they use ... difficulties theyhave to overcome, and what methods and/or solutions they may use to enhance theirverbal communication skills 1.6 Scope of the study The scope of this study is 30 staff of The Consultative ... when they talk in their mother-tongue language.They worry that others learners might mock them or laugh at them when they makemistakes A research of Tuan and Mai (2015) shows that eight out of
Ngày tải lên: 12/05/2020, 11:00
OsHKT1;4-mediated Na+ transport in stems contributes to Na+ exclusion from leaf blades of rice at the reproductive growth stage upon salt stress
... analysis of the approximate mapping region of the Nax1 locus has suggested that the effect is attributable to the HKT1;4 gene, TmHKT1;4-A2 [33] In rice, a copy of the OsHKT1;4 gene was found in the ... depolarized status, dependent on increases in the Na+ concentration in the bath solution (Fig 2a-g) A 10-fold increase in the Na+ con-centration in the bath resulted in the shift of the reversal ... water in the presence of 2 mM or 20 mM Na+with a step pulse protocol described below g, Current –voltage relationships of oocytes injected with 3 ng of OsHKT1;4 cRNA or water, bathed in solutions
Ngày tải lên: 22/05/2020, 03:51
A STUDY ON DIFFICULTIES OF AND HOW TO ENHANCE COMMUNICATION SKILLS OF STAFF AT THE CONSULTATIVE INSTITUTE FOR SOCIO ECONOMIC DEVELOPMENT OF RURAL AND MOUNTAINOUS AREAS (CISDOMA)
... interviews 17 3.2 Data analysis 18 3.2.1 Years of learning English of staff at CISDOMA 18 3.2.2 Level of English proficiency of staff at CISDOMA 19 3.2.3 Emotions of the staff at CISDOMA when they use ... difficulties theyhave to overcome, and what methods and/or solutions they may use to enhance theirverbal communication skills 1.6 Scope of the study The scope of this study is 30 staff of The Consultative ... when they talk in their mother-tongue language.They worry that others learners might mock them or laugh at them when they makemistakes A research of Tuan and Mai (2015) shows that eight out of
Ngày tải lên: 28/08/2020, 07:53
Định hướng giá trị của sinh viên học viện Cảnh sát Nhân dân = Studying the value orientation of students at The People Police Academy
... ta có th dễ dàng theo đuổi các giá trị li n k trong v ng tr n với cùng một hành động, trong khi không th đồng thời theo đuổi các giá trị nằm đối diện trong v ng tr n Tuy nhiên theo Schwartzm con ... giá trị mà sinh viên Học viện CSND hướng tới nhi u nh t và hệ giá trị của sinh viên sắp xếp theo thứ bậc theo thang đo của Schwartz Định hướng giá trị của sinh viên Học viện CSND có th chịu sự chi ... CÁI VIẾT TẮT Trang 9DANH MỤC CÁC ẢNG Bảng 1 10 giá trị cũ theo lý thuyết của Shalom H Schwartz (1992) 19 Bảng 3.1 10 giá trị sắp xếp theo thứ bậc mong muốn của sinh viên 45 Bảng 3.2 Bảng đi m
Ngày tải lên: 22/09/2020, 00:16
A study of the english quantifiers as hedges used in theses by MA students of english at the university of languages and international studies, vietnam national university, hanoi
... the rationales, the aims and the research questions, together with the scope of the study More importantly, this is also the chapter giving the clearest guideline for the whole research 1 Rationales ... quantifiers in the Introductions and Discussions of English MA theses at ULIS? 2 What are the uses of quantifiers as hedges in MA theses at ULIS? 4 Scope of the study The study only focuses on ... other written or conversational registers It is analyzed in terms of pragmatics Data analysis concentrates on Introduction and Discussion sections of the MA theses Trang 105 Organization of the
Ngày tải lên: 30/09/2020, 12:22
Định hướng giá trị của sinh viên học viện cảnh sát nhân dân, studying the value orientation of students at the people police academy
... ta có th dễ dàng theo đuổi các giá trị li n k trong v ng tr n với cùngmột hành động, trong khi không th đồng thời theo đuổi các giá trị nằm đối diện trong v ng tr n Tuy nhiên theo Schwartzm con ... giá trị mà sinh viên Học viện CSND hướng tới nhi u nh t và hệ giá trị của sinh viên sắp xếp theo thứ bậc theo thang đo của Schwartz Định hướng giá trị của sinh viên Học viện CSND có th chịu sự chi ... CHỮ CÁI VIẾT TẮTTrang 9DANH MỤC CÁC ẢNGBảng 1 10 giá trị cũ theo lý thuyết của Shalom H Schwartz (1992) Bảng 3.1 10 giá trị sắp xếp theo thứ bậc mong muốn của sinh viên Bảng 3.2 Bảng đi m trung
Ngày tải lên: 27/10/2020, 21:12
(Luận văn thạc sĩ) định hướng giá trị của sinh viên học viện cảnh sát nhân dân, studying the value orientation of students at the people police academy
... ta có th dễ dàng theo đuổi các giá trị li n k trong v ng tr n với cùng một hành động, trong khi không th đồng thời theo đuổi các giá trị nằm đối diện trong v ng tr n Tuy nhiên theo Schwartzm con ... giá trị mà sinh viên Học viện CSND hướng tới nhi u nh t và hệ giá trị của sinh viên sắp xếp theo thứ bậc theo thang đo của Schwartz Định hướng giá trị của sinh viên Học viện CSND có th chịu sự chi ... CÁI VIẾT TẮT Trang 9DANH MỤC CÁC ẢNG Bảng 1 10 giá trị cũ theo lý thuyết của Shalom H Schwartz (1992) 19 Bảng 3.1 10 giá trị sắp xếp theo thứ bậc mong muốn của sinh viên 45 Bảng 3.2 Bảng đi m
Ngày tải lên: 09/12/2020, 18:47
Study the distribution of PM10 and the relationship to public health for proposing solutions to prevent diseases
... Simulation results PM10 dispersion in District 5 shows the annual average concentrations of PM10 in District 5 of 30 The results of the model calculations and estimates BenMAP show that number of ... of deaths due PM10 are 5 persons / year for a total population of 194,228 people in District 5 This death rate occupied of 0.0025% of the total population of District 5 Resuls of calculated and ... Study the distribution of PM10 and the relationship to public health for proposing solutions to prevent diseases The research uses the EMISENS model for PM10 emissions inventory, uses the FVM
Ngày tải lên: 23/01/2021, 11:08
Factors influencing the research productivity of academics at the research oriented university in vietnam
... Association of Southeast Asian Nations (ASEAN), to strengthen its global presence and foster cooperation with other nations.Asian Nations and the World Trade Organisation has gradually strengthened ... Theory of Job Satisfaction, the Theory of Organisational Commitment, and the Theory of Motivation, to inform its research This section aims to provide a concise overview of how these theories relate ... discusses the implications for policy and practice, and concludes the thesis by addressing the study's limitations and offering suggestions for future research.Contexts of the Vietnamese Higher Education
Ngày tải lên: 01/08/2021, 10:04
PROBLEMS AND SOME SUGGESTED SOLUTIONS IN STUDYING WRITING ENGLISH OF SOPHOMORES AT THE DEPARTMENT OF FOREIGN LANGUAGE IN SAIGON UNIVERSITY
... due to the short duration of the study, which requires limiting the object of the study.This limitation makes the study not cover all students at different levels Besides, the results ofthe survey ... 3: THE RESULTS 3.1 Analysis CHAPTER 4: THE DISCUSSION 4.1 Original hypothesis 4.2 The findings and the explanation of the findings Trang 2010 RESEARCH LIMITATIONNaturally, the scope of this ... 1.2 The literature review 1.3 Notion of original review 1.4 The purpose CHAPTER 2: THE METHOD 2.1 The approach 2.2 The population 2.3 The location 2.4 Time 2.5 The technique 2.6 The
Ngày tải lên: 21/05/2022, 20:37
Identifying common errorss in written english of students of english at the intermediate level
... discussed in the contents of the thesis, point out the limitations of the study and give some suggestions for further research 4 Part II: content Chapter theoretical background 1.1 .the overview of writing ... students of English at the intermediate level in particular - help us widen our knowledge of English Subjects of the study are a group of eighty students of English at the intermediate level of Foreign ... deals with the theoretical background Chapter is about the study and presentation of common written English errors of students of English at the intermediate level The description of research...
Ngày tải lên: 19/12/2013, 10:39
Tài liệu One Hundred Eleventh Congress of the United States of America - AT THE SECOND SESSION pptx
... (A) the extent of the leverage of the company; (B) the extent and nature of the United States related off-balance-sheet exposures of the company; (C) the extent and nature of the transactions ... regulations prior to the expiration of the 3-year period following the date of publication of final regulations, the Office, in consultation with the Chairperson, may implement such regulations ... assess the state of the United States financial system, including— (A) an analysis of any threats to the financial stability of the United States; (B) the status of the efforts of the Office...
Ngày tải lên: 17/02/2014, 21:20
Tài liệu Báo cáo khoa học: The Saccharomyces cerevisiae vacuolar acid trehalase is targeted at the cell surface for its physiological function docx
... AGCAAGCACTACGTATCACGACAAACCAAC GCTTCTGGATCGTAGTTCAA CATTATTGGAATGAGGAAAT ATTTCCTCATTCCAATAATG TTGAACTACGATCCAGAAGC GGATCCTCATTGAGAACAATTTCCTTGA GGATCCATCATGTTCTCATCATCATAATATG GGATCCGTTAAATATAATGCAGTGACGAAGATA GGATCCAAGTCAAACCTTGAGAAAGAACGA ... ATGATGATGATAACAAAGGAGCTACAATCAAGGAAATTGTTCTCAATGATCGGATCCCCGGGTTAATTAA ATCCAAACTTATAATATTAAAAAAAGCGCTACTTATATGCATCATTTCATGAATTCGAGCTCGTTTAAAC GCACTAGTATGAAAAGAATAAGATCGCTTT GCCCCGGGATCATTGAGAACAATTTCC GCGGATCCGTATGACCACATTCTATACTGA ... CACGGCATATTATGATGATGAGAACATGATGGATCTCG CGCGGATCCCCGGGTTAATTAA TTTAGAATGGCTTTTGAAAAAAATAAAAAAGACAATAAGTTTTATAACCTGAATTCGAGCTCGTTTAAAC ATTTCCTCATTCCAATAATG TACCCATACGATGTTCCTG CAAAGCGATCTTATTCTTTT...
Ngày tải lên: 18/02/2014, 06:20
Báo cáo "QUATERNARY GEOLOGICAL MAP OF THE CONTINENTAL SHELF OF VIETNAM AT THE SCALE OF 1:1,000,000 " potx
... Vu The selection of scale of the map is very important for interpretation and performance of geological formation on the map Stratigraphical boundaries in Quaternary are divided by comparison the ... developed along the littoral zone at different times, especially Holocene corals The typical ones located in the Gulf of Tonkin, near shore of Central Vietnam, in the Paracel and Spratley The coral ... another coral platform was produced at recent depth of 2-3 meters The active transgression has produced coral platform and wave-cut bench The corals of Paracel and Spratley Corals had a large atoll...
Ngày tải lên: 05/03/2014, 16:20
Signaling at the Cell Surface in the Circulatory and Ventilatory Systems docx
... intracellular concentrations of second messengers and, in turn, the latter change the concentrations of and activate via posttranslational modifications and conformational variations their signaling ... at Université Pierre et Marie Curie in the framework of prerequisite training of Master “Mathematical Modeling”, part of Master of “Mathematics and Applications”, Centre de Recherches Mathématiques, ... pathways occur at the cell membrane and cortex The dynamics of a biochemical process can be represented by a set of equations that link the time variations of concentrations of implicated substances...
Ngày tải lên: 05/03/2014, 22:21