create a relational database in access 2003

trình bày báo cáo update and retrieval in a relational database though a universal schema interface

trình bày báo cáo update and retrieval in a relational database though a universal schema interface

... Trang 1Trình bày bài báo:Update and Retrieval in a Relational Database Though a Universal Schema Interface GVHD: PGS TS Đồng Thị Bích Thủy. HV: Lý Thanh Tùng. MSHV: 1011066 Trang 21 Giới ... chúng Trang 493.5 Input Patterns Một Input – Pattern của Ri là IP(Ri).  VD tìm IP(R1) của ví dụ đang xét Trang 5050Trang 513.5 Input Patterns Nhận xét:  Với cách làm này thì khi ta nói một ... là có thể thêm nếu thỏa 2 điều kiện sau: A Y A N here A X v r v d v v Trang 34Tính có thể insert của bộ dữ liệu đủ  Trong ví dụ 4.3 thì cả 2 bộ dữ liệu đều thỏa điều kiện insert Vì Y=Ỹ và cả

Ngày tải lên: 27/01/2015, 10:44

59 476 0
Update and retrieval in a relational database through a universal schema interface (USI)

Update and retrieval in a relational database through a universal schema interface (USI)

... <Q6(GI),{I→G}> Muốn xác định vùng duy nhất của CDF: ∪ Fi-F6 = CDFIG… Chứa siêu khóa của Q6 = CDFIG… Chứa siêu khóa của Q6 Các quan hệ cần ktra theo CDF (hay Q2) là: {Q2, Q5, Q6} Chuỗi kết hàm tối ... q ra thành từng object con để insert  Cơ chế ràng buộc khóa ngoại sửa đổi 1. Dựa trên chuỗi kết hàm tối tiểu phủ đầy các thuộc tính Trang 123 PP giải quyết các TH – Insert Nếu q là kết của ... của bài báo  Phương pháp giải quyết cho các trường hợp Trang 2103/11/15 213 PP giải quyết các TH – Update  Trong bài báo này xem thao tác update = delete + insert  Hướng giải quyết của update

Ngày tải lên: 11/03/2015, 16:15

25 713 0
ADOBE DIRECTOR 11.0 CREATE A BASIC MOVIE IN DIRECTOR DI pdf

ADOBE DIRECTOR 11.0 CREATE A BASIC MOVIE IN DIRECTOR DI pdf

... Stage By holding the Shift key, you maintain a straight vertical line in your animation Scrub the playhead to view your animation You can move the playhead to preview your animation Scrubbing ... that you can use in your movie The first is a text cast member It contains the text “Trio Motor Company.” The text cast member thumbnail image that appears in the Cast window contains a small A ... sprites and cast members As you learned earlier in this tutorial, when you drag cast members onto the Stage, you create sprites Sprites are instances of cast members that appear on the Stage and in

Ngày tải lên: 24/03/2014, 01:20

37 612 1
Supporting Finite Element Analysis with a Relational Database Backend docx

Supporting Finite Element Analysis with a Relational Database Backend docx

... a database We have to create a larger event loop to incorporate new input data from the database Here’s how it works First, let us assume we are starting with a small data set This means that ... crystal domains Granite is a familiar polycrystalline material, but most metals and many other materials consist of crystalline grains, each grain being homogenous (See Figure 1 and Appendix A for ... data set A simple approach is to give her minimum and maximum scalar interactors and a menu interactor that permits choosing an attribute field of interest These parameters, the min and max range,

Ngày tải lên: 30/03/2014, 22:20

30 404 0
LLF7+ +how+to+create+a+native+environment+in+your+own+home

LLF7+ +how+to+create+a+native+environment+in+your+own+home

... Trang 132 Creating an immersion Trang 14Creating an immersion environment involves spending your time doing day- to-day things in the target language Trang 15Many people find this hard because ... (news, Google search) Trang 24Trick for finding podcasts: You’re a Spanish learner & travel fan Google translate into Spanish: “travel podcast” Paste result into Google and search Trang 25THE LESSON ... Trang 1HOW TO CREATE A NATIVE ENVIRONMENT IN YOUR OWN HOME LANGUAGE LEARNING FOUNDATIONS Iwillteachyoualanguage.com Trang 2In this module you will learn: The difference between work and play

Ngày tải lên: 09/11/2019, 10:26

28 69 0
microsoft access a primer for relational database design and use

microsoft access a primer for relational database design and use

... unstable with greater than 3-5 Trang 7What is in an MS-Access file - 1?Although the term “database” typically refers to a collection of related data tables, an Access database includes more than ... systems? Cheap, readily available (packaged with MS-Office Premium) Easy to use (relative to other systems –Oracle may require one FTE to maintain the server as a database administrator and another ... Trang 1Microsoft Access - A Primer for Relational Database Design and Use Paul A Harris, Ph.D Director, GCRC Informatics October 3, 2003 Trang 2Microsoft Access – Module 1 An Overview of MS-Access

Ngày tải lên: 24/10/2014, 15:10

38 443 0
Closing the Cancer Divide: A blueprint to expAnd Access in low And middle income countries pdf

Closing the Cancer Divide: A blueprint to expAnd Access in low And middle income countries pdf

... Leslie Lemann Guohong Li Tatiana Lingos Yuanli Liu Amalia Lizárraga Silvana Luciani Roberto Rivera Luna Jing Ma Maricela Macías Laura Maga a Joanne Manrique Angela Marmo Jaime Andres Giraldo Marmolejo ... Science for Health K ing Hussein Cancer Foundation and Center Seattle Cancer Care Alliance American Cancer Society China Medical Board National Cancer Institutes Fogarty International Center ... with cancer in Rwanda finding treatment... FEMAMA Forum of African First Ladies Against Breast & Cervical Cancer Fred Hutchinson Cancer Research Center Fundación Plenitud Global Access

Ngày tải lên: 15/03/2014, 00:20

286 454 0
RDBNorma: - A semi-automated tool for relational database schema normalization up to third normal form docx

RDBNorma: - A semi-automated tool for relational database schema normalization up to third normal form docx

... Trang 1International Journal of Database Management Systems ( IJDMS ), Vol.3, No.1, February 2011RDBNorma: - A semi-automated tool for relational database schema normalization up to third normal ... /*save attribute pointed by Trav in array A1, as End /* note that A1 will always have only one entry 1d Storing attributes participating in partial functional dependencies in A2-dependant and ... efficient and reliable manner increased a great scope for software industries involved in the development of relational database system for their clients Success of relational database modeled for a

Ngày tải lên: 23/03/2014, 12:20

22 392 0
Excess Cervical Cancer Mortality: A Marker for Low Access to Health Care in Poor Communities doc

Excess Cervical Cancer Mortality: A Marker for Low Access to Health Care in Poor Communities doc

... data was available andless is known about the causes of cervical cancermortality disparities among Native Americans inthe Northern Plains and among Alaska Natives, it was also acknowledged that ... declining in many areas, including Appalachia To maintain and better integrate health services in rural areas, it will be important to include this group of providers Though the rural providers are ... example, research in Michigan linking Medicaid, cancer registry, and death certificate data54in that state indicate that about the same percentage of women in Medicaid HMO/managed-care and fee-for-service

Ngày tải lên: 28/03/2014, 23:20

96 285 0
Finding Surprising Patterns in a Time Series Database in Linear Time and Space pdf

Finding Surprising Patterns in a Time Series Database in Linear Time and Space pdf

... +2IA,$&].E8-=&./:o+4tA,$'&C('8A,$t2l*,+0 Trang 5$ aba $ $ ba $ ba$ $ aba aba $ ba $ ba$ ba $ ba$ $ aba $ $ ba $ ba$ 1 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 a b a a b a b a a b a a b a b a a ... ±.ºỗÜ5&B4'+A,&B:iA,$'&]4'+ 5&@>B+*<*,&:<(=+456/47aA,+|A,$'&C:<$+*<A,&:bA R;’Vº9M >P*<*,&4'>&B: Ị A,$8A%84'4+AJ8A,&B:OA,$'&%A<*,&B&G[I6?A,$oA,$'&IU8./P'& KNºZRAJ8€&:T.E6/4&V8* ... Trang 1Finding Surprising Patterns in a Time Series Databasein Linear Time and Space Eamonn Keogh Stefano Lonardi Bill ‘Yuan-chi’ Chiu Department of Computer Science and Engineering University

Ngày tải lên: 30/03/2014, 13:20

11 486 0
Báo cáo sinh học: " Open Access Cloning of the canine RNA polymerase I promoter and establishment of reverse genetics for influenza A and B in MDCK cells" docx

Báo cáo sinh học: " Open Access Cloning of the canine RNA polymerase I promoter and establishment of reverse genetics for influenza A and B in MDCK cells" docx

... TGTTTCGGCGACAGGCAGACAGACGACAGGCAGACGTAAAAGACAGCCGGTCCGTCCGTCGCTCGCCTTAGAGATGTGGGCCTCTGGGCGCGGGTGGGGTTCCGGGCTTGACCGCGCGGCCGAGCCGG canus fam EcoRI BamHI (1809) TGTTTCGGCGACAGGCAGACAGACGACAGGCAGACGTAAAAGACAGCCGGTCCGTCCGTCGCTCGCCTTAGAGATGTGGGCCTCTGGGCGCGGGTGGGGTTCCGGGCTTGACCGCGCGGCCGAGCCGG ... template and forward and reverse primers (5'-CTTGTCTCAAAGATTAAGCCATGCATG-3' and 5'-CAGGGCCTCGAAAGAGTCCTGTATTG-3', respec-Table 2: Plasimid Rescued influenza A & B Viruses In MDCK cells a A ca ... (MDV) strain and the HA and NA gene segments from a wild type (wt) strain The FluMist MDV strains are ca A/Ann Arbor/6/60 and ca B/Ann Arbor/1/66, originally developed by serial passage at successively

Ngày tải lên: 18/06/2014, 18:20

12 567 0
báo cáo hóa học:" Challenges in access to health services and its impact on Quality of Life: a randomised population-based survey within Turkish speaking immigrants in London" ppt

báo cáo hóa học:" Challenges in access to health services and its impact on Quality of Life: a randomised population-based survey within Turkish speaking immigrants in London" ppt

... research project was announced in seven local community-based newspapers, broadcasted in a radio and television interviews The participants in this study were reached using the database of SAfH and ... mixed sampling method cluster sampling and snowball sampling which cannot be regarded as a probability sampling approach A second limitation was the measurement of the accessibility of the health ... to arrive in England and can be traced to the 1920s Increased numbers arrived in the 1940s and late 1950s A large wave from Cyprus came in the Trang 51960s after the island became independent Another

Ngày tải lên: 20/06/2014, 16:20

28 648 0
Báo cáo y học: "Treating patients with fibromyalgia in primary care settings under routine medical practice: a claim database cost and burden of illness study" docx

Báo cáo y học: "Treating patients with fibromyalgia in primary care settings under routine medical practice: a claim database cost and burden of illness study" docx

... (Apenins-Montigalà, Morera-Pomar, Mont-gat-Tiana, Nova Lloreda, and La Riera) that are managed by a health management organization (Badalona Serveis Assisten-cials S.A [BSA], Barcelona, Spain) and that cover ... Sicras-Mainar1, Javier Rejas2, Ruth Navarro1, Milagrosa Blanca3, Ángela Morcillo4, Raquel Larios4, Soledad Velasco4 and Carme Villarroya4 1 Directorate of Planning, Badalona Serveis Assistencials, ... to analysis, in particular to the source of infor-mation pertaining to computerized clinical records (Oficina Médica Informatizada de Atención Primaria Windows version, STACKS, Barcelona, Spain),

Ngày tải lên: 09/08/2014, 14:20

14 637 0
Báo cáo y học: " Paliperidone ER and oral risperidone in patients with schizophrenia: a comparative database analysis" pptx

Báo cáo y học: " Paliperidone ER and oral risperidone in patients with schizophrenia: a comparative database analysis" pptx

... mg/ day, except for increased rates for tachycardia and sinus tachycardia Discontinuation rates due to AEs were comparable, and weight gain for the 2 groups was similar Changes in the mean PANSS ... data, analysis and interpretation of data and drafting of the manuscript and its critical revision for important intellectual content JPL and NS were involved in the interpretation of data, and ... Psychiatric Rating Scale; ESRS = Extrapyramidal Symptoms Rating Scale. Trang 4evaluated using a chi-square test No adjustments formultiple comparisons were made Data were analyzed using SAS®(Version

Ngày tải lên: 11/08/2014, 16:23

10 528 0
báo cáo khoa học: " Ontology-oriented retrieval of putative microRNAs in Vitis vinifera via GrapeMiRNA: a web database of de novo predicted grape microRNAs" ppt

báo cáo khoa học: " Ontology-oriented retrieval of putative microRNAs in Vitis vinifera via GrapeMiRNA: a web database of de novo predicted grape microRNAs" ppt

... web database: the text search interface Considering the large amount of data stored in the GrapeMiRNA database, a web interface was prepared to provide free access to all information Our intention ... Segrate (MI), Italy and 4 Institute of Agricultural Biology and Biotechnology (CNR), via Bassini 15, 20133 Milan, Italy Email: Barbara Lazzari* - barbara.lazzari@tecnoparco.org; Andrea Caprera ... selected_predictions table Selected predictions are available at the GrapeMiRNA web site. Trang 10Based on data contained in the Gene Ontology Annota-tion (GOA) Database [32] and in the Gene Ontology Database

Ngày tải lên: 12/08/2014, 03:20

13 158 0
Báo cáo khoa học: "limits for blood delivery via femoral vein access and a potential alternative in an experimental setting in anesthetized pigs" pps

Báo cáo khoa học: "limits for blood delivery via femoral vein access and a potential alternative in an experimental setting in anesthetized pigs" pps

... 5(AccuImage Diagnostics Corporation, South San Francisco,CA, USA) Statistical analysis Data were analyzed using Sigma STAT 3.1 and Sigma Plot 8.0 for Windows (Systat Software GmbH, Erkrath, Germany) ... resulting in a scan speed of approximately 11 seconds for a 30-cm scan length in the z-axis Image analysis was performed using Advantage Windows 4.2 (GE Medical Systems) and AccuLite Trang 5(AccuImage ... correlation between the achievable Qb (achievable Qa) via the arterial line of a dual-lumen catheter placed in the femoral vein and the underlying hemodynamics (that is, car-diac output [CO] and

Ngày tải lên: 13/08/2014, 03:20

11 265 0
Access 2003 In Pictures phần 2 ppt

Access 2003 In Pictures phần 2 ppt

... table should have a key field For example, if a hospital keeps a database, each patient can have a unique ID number in the key field That way, if it has more than one patient named John Baker, ... from the database Essentially, it’s a question You use queries to ask the database things like, “Who are my customers in Montana?”, or “How many pipe fittings have I sold this month?” Trang 222 ... the Menu Bar, click File, then Close to return to the database window Trang 21Create queries 1 In the Objects list, click Queries What’s a query? A query is a way to get specific information from

Ngày tải lên: 14/08/2014, 09:21

22 110 0
Access 2003 In Pictures phần 3 ppt

Access 2003 In Pictures phần 3 ppt

... the database window Trang 6DATABASE BASICS 47Create reports 1 In the Objects list, click Reports 2 Double-click Create report by using wizard Trang 73 When the Report Wizard window appears, ... browser and go to: www.inpics.net/books/acc2003 2 Right-click the FoodStore1.mdb link When the menu appears, click Save Target As 3 When the Save As window appears, open the Practice Access ... your hard drive Then click the button Trang 20WORKING WITH TABLES 614 Wait for the database to download completely, then close the web browser Trang 21Open an existing database 1 Start Microsoft

Ngày tải lên: 14/08/2014, 09:21

22 245 0
Access 2003 In Pictures phần 4 pps

Access 2003 In Pictures phần 4 pps

... to save changes Trang 15WORKING WITH TABLES 78 Create new tables 1 Double-click Create table in Design view Trang 16WORKING WITH TABLES 79A blank table will open in Design View: Trang 17WORKING ... Trang 1WORKING WITH TABLES 64 4 When the database opens, click the button in its window The FoodStore1 database window should now look like this: Trang 2WORKING WITH TABLES 65Employ an input ... the Save As window appears, type: Orders in the Table Name box 5 Click the button 6 When the alert window appears, click the button Tip: You’ll assign a Primary Key later Trang 19WORKING

Ngày tải lên: 14/08/2014, 09:21

22 196 0
Access 2003 In Pictures phần 5 pdf

Access 2003 In Pictures phần 5 pdf

... heading for Chris Happ’s record 2 In the menu that appears, click Delete Record Trang 183 When the alert window appears, click the button Tip: Once a record has been deleted from the database, ... to the FoodStore1 database window Trang 15WORKING WITH TABLES 100 Edit records 1 Open the Customers table Make sure it’s displayed in Datasheet View 2 Click inside the Address 1 field for ... cannot be recovered There is no Undo feature in Access Trang 19WORKING WITH TABLES 104 Find records Navigate records 1 In the Customers table window, click the button The last record in

Ngày tải lên: 14/08/2014, 09:21

22 145 0

Bạn có muốn tìm thêm với từ khóa:

w