arrays with a class base type

... the class HT of factors M having HT Cartan subalgebras A ⊂ M , i.e., maximal abelian ∗ -subalgebras A ⊂ M such that M has the property H relative to A and A contains a subalgebra A0 ⊂ A with A0 ... always a 2-cocycle, ∀R), there exists a type II1 factor with a Cartan subalgebra (A ⊂ M ) associated with it, via a groupmeasure space construction “` la” Murray-von Neumann The association a (A ... Neumann algebras with property H We also prove that if a type II1 factor N has property H relative to a maximal abelian ∗-subalgebra B then B is necessarily a Cartan subalgebra of N Finally,...

Ngày tải lên: 06/03/2014, 08:21

... Inequalities & c c c Applications, vol 8, no 1, pp 28–51, 2005 11 B Yang, “On the norm of a Hilbert’s type linear operator and applications,” Journal of Mathematical Analysis and Applications, vol 325, ... −1 p am kλ r a p,φ < ∞ 2.4 Journal of Inequalities and Applications For am ≥ 0, a {am }∞ m satisfying c {cn }∞ , n p p p ∈ lφ , define a Hilbert -type operator T : lφ → lψ 1−p as T a ∞ T a n : ... Journal of Inequalities in Pure and Applied Mathematics, vol 6, no 3, article 81, pp 1–15, 2005 10 M Krni´ and J Peˇ ari´ , “General Hilbert’s and Hardy’s inequalities,” Mathematical Inequalities...

Ngày tải lên: 22/06/2014, 02:20

... that combined a rapid data acquisition system with an ESR spectrometer (RE-1X, JEOL, Tokyo, Japan) and a stopped-flow system (Ohtsuka Electric Co Ltd., Osaka, Japan) The OH radicals trapped with ... radical generation 1.5-fold that of phenol itself Power law type rate equations are usually adopted to correlate the experimental data in laboratory-scale and pilot-plant scale reactors, and even ... REFERENCES Andreozzi R., Caprio V., Insola A and Marotta R (1999) Advanced oxidation processes (AOP) for water purification and recovery Catal Today, 52, 51-59 Bader H and Hoigne J (1981) Determination...

Ngày tải lên: 05/09/2013, 09:38

... the aluminum surface and the alumina surface at the edge of the anodized regions was measured with a mechanical profiler, and the overall thickness of the alumina was measured in an optical microscope ... expansion factor can be changed quite dramatically from about 0.8 up to 1.7 by varying the experimental anodization parameters The volume expansion factors for optimal oxidation parameters, leading ... 120 ␮m arrangements of porous alumina.10 Pores of virtually tubular shape with semispherical bottoms and a more or less hexagonal outside alumina cell are a logical consequence of expanding circles,...

Ngày tải lên: 19/03/2014, 16:48

... Harjani, J, Lopez, B, Sadarangani, K: A fixed point theorem for mappings satisfying a contractive condition of rational type of partially ordered metric space Abstr Appl Anal 2010, (2010) (Article ... 0 a (1 − α1 ) > − α1 and ® A ∪ A with >a ≥ 0, β1 = a0 a ≥ a1 ≥ a − A1 ∪ A2 a β1 = > It is noted that the condition (3.1) is not guarana0 − α1 teed to be contractive for any point of A1 It is also ... equality defining a circle Aa1 for a fixed a1 = a1 (x0, y0) ≤ a- a’ is defined below together with available point-dependent lower and upperbounds: De la Sen and Agarwal Fixed Point Theory and Applications...

Ngày tải lên: 20/06/2014, 22:20

... for Rational Mechanics and Analysis, vol 31, no 4, pp 283–328, 1986 A Ambrosetti, V Felli, and A Malchiodi, “Ground states of nonlinear Schrodinger equations with ¨ potentials vanishing at infinity,” ... “Nonlinear homogeneous eigenvalue problem in RN : nonstandard variational approach,” Commentationes Mathematicae Universitatis Carolinae, vol 38, no 3, pp 421–431, 1997 12 G Rozenblum and M Solomyak, ... Communications in Contemporary Mathematics, vol 3, no 4, pp 549–569, 2001 A Ambrosetti and Z Q Wang, “Nonlinear Schrodinger equations with vanishing and decaying ¨ potentials,” Differential and Integral...

Ngày tải lên: 21/06/2014, 20:20

... eigenvalue is repeated according to its multiplicity If A commutes with B, that is, AB BA, then A B is a diagonalization matrix and μ1 λ1 ≤ μ2 λ2 ≤ · · · ≤ μn λn are the eigenvalues of A B Proof ... this paper to achieve their research References S A Tersian, A minimax theorem and applications to nonresonance problems for semilinear equations,” Nonlinear Analysis: Theory, Methods & Applications, ... 1199–1214, 2005 H Wenhua, “Minimax theorems and applications to the existence and uniqueness of solutions of some differential equations,” Journal of Mathematical Analysis and Applications, vol 322,...

Ngày tải lên: 21/06/2014, 20:20

... phương pháp tiếp cận SVM đến class imbalance SVM Classifier Binary with symm.margin Binary with asymm.margin One -class with RBF kernel One -class with conformal kernel Accuracy 89.6% 74.4% 74.6% 75.6% ... N.Japkowicz The class imbalance problem : A systematic study Intelligent Data Analysis Journal, 6(5), 2002 15 M.Kubat and S.Matwin Addressing the curse of imbalanced data sets : One-sides sampling ... Asymmetrical margin approach to surveillance of nosocomial infections using support vector classification In Intelligent Data Analysis in Medicine and Pharmacology, 2003 C.Cortes and V.Vapnik Support...

Ngày tải lên: 26/11/2013, 17:11

... 1¢ 2⁄4 3¢ 4¢ 4¢ 5¢ A 105 75 50 35 + - + + Weak Weak > 54 aa aa T C C T G Weak Weak Adequate Weak Adequate aa 58 aa 13 aa 33 aa 31 aa Adequate Adequate aa 24 aa ATG ATG ATG ATG ATG C B αHu-K4 + ... Two putative polyadenylation signals (AATAAG and AATAAC) are present about 20 nucleotides in front of the poly (A) tail (Fig 3A) Both are not identical to the most often used signal AAT AAA which ... membrane or with the membranes of intracellular organelles although they lack a transmembrane domain They are attached to the cytoplasmic face of the membranes via palmitoyl anchors [15] as is...

Ngày tải lên: 19/02/2014, 17:20

... CGCTGGTTCTTGCCAGTCTCAGTGCCGTGGTTGCTAGGGAT TTTAGCACCACGAGCCTGGTCACCGCAACGCTGAGC CGCAGAAGCCGTACTTACCACAGCACAGGCAGTTCG GACTGGCAAGAACCAGCGCCACAGTAAGCGTCACCA GCTAGGATCCCTAGCAACCACGGCAC Table Antifungal activity ... Escherichia coli and assays of recombinant WAMP 1a activity against diverse plant pathogens, such as chitin-containing and chitin-free fungi, and Grampositive and Gram-negative bacteria The amino acid ... activity of peptides was assayed against several Gram-positive and Gram-negative bacteria using radial diffusion assay Petri dishes with Luria–Bertani agar were seeded with test bacteria The peptide...

Ngày tải lên: 07/03/2014, 02:20

... acid capsule is a virulence factor for mucoid group A streptococci Proc Natl Acad Sci USA 88, 8317–8321 49 Kawabata S, Kuwata H, Nakagawa I, Morimatsu S, Sano K & Hamada S (1999) Capsular hyaluronic ... deionized water (pH 9.0) containing 5% methanol as separation buffer A voltage of 20 kV was typically applied during CE separation, and +5 kV was used as electrospray voltage Mass spectra were acquired ... we have characterized the complete CPS structure for the HS:19 serostrain and have shown that these labile groups are an a- l-sorbofuranose branch attached at C2 of b-d-GlcA and a MeOPN modification...

Ngày tải lên: 16/03/2014, 13:20

... and make us a little less tolerant If they are people we can't get away from, then it requires a little skill to deal with them and come out unscathed Here are a few types that may be familiar ... it clear, that you understand his concerns and answer him with a clear and short explanation And finally, let the Intimidator know you are open to speaking with him, when and only, he can talk ... is always going to feel threatened When you relax and act appropriately, they may calm down a bit You should think of similar people you have dealt with, and find an approach that worked with...

Ngày tải lên: 20/03/2014, 19:20

... Functional Model and the Data Language Daplex,’’ ACM-TODS, March, 1981 Smith, J and Smith, D., ‘‘Database Abstractions: Aggregation and Generalization,’’ ACM TODS, June 1977 Sordi, J., ‘‘IBM Database ... paper has suggested that data base procedures are a natural way to model complex objects and to allow data base oriented algorithms and precompiled queries in the data base Moreover, they appear ... ,QUEL-coln.field’’ 1) F can appear wherever a field of a relation can appear in QUEL 2) The construct ‘‘tuple-variable.F can appear whenever a tuple variable or a relation name can appear in QUEL 3) Clauses of...

Ngày tải lên: 28/04/2014, 13:31

... 78363-8202, USA *Corresponding author: manuel.delasen@ehu.es Email address: RPA: Agarwal@tamuk.edu Abstract This article discusses three weak φ-contractive conditions of rational type for a class of ... manuscript References [1] Harjani, J, Lopez, B, Sadarangani, B: A fixed point theorem for mappings satisfying a contractive condition of rational type of partially ordered metric space Abstr Appl ... equally and significantly in writing this paper All authors read and approved the final manuscript Acknowledgments The authors are grateful to the Spanish Ministry of Education for its partial...

Ngày tải lên: 18/06/2014, 22:20

... boundary value problem for second dynamic equations on time scales J Math Anal Appl 296, 97–109 (2004) [5] Jiang, LQ, Zhou, Z: Lyapunov inequality for linear Hamiltonian systems J Math Anal Appl ... type inequalities for second-order half-linear differential equations J Math Anal Appl 382, 792–801 (2011) 10 [12] Yang, X, Kim, Y, Lo, K: Lyapunov -type inequalities for a class of quasilinear systems ... [8] Pachpatte, BG: On Lyapunov -type inequalities for certain higher order differential equations J Math Anal Appl 195, 527–536 (1995) [9] Tang, XH, Zhang, M: Lyapunov inequalities and stability...

Ngày tải lên: 20/06/2014, 21:20

... (1991) Matsuyama, T, Ikerata, R: On global solutions and energy decay for the wave equations of Kirchhoff type with nonlinear damping terms J Math Anal Appl 204, 729–753 (1996) doi:10.1006/jmaa.1996.0464 ... nonlinear wave equations of Kirchhoff type with some dissipation Nonlinear Anal TMA 65, 243–264 (2006) doi:10.1016/j.na.2004.11.023 13 Yamada, Y: On some quasilinear wave equations with dissipative ... 15 Cavalcanti, MM, Guesmia, A: General decay rates of solutions to a nonlinear wave equation with boundary condition of memory type Differential Integral Equations 18, 583–600 (2005) 16 Messaoudi,...

Ngày tải lên: 20/06/2014, 21:20

... this article as: Şen and Bayramov: On calculation of eigenvalues and eigenfunctions of a Sturm-Liouville type problem with retarded argument which contains a spectral parameter in the boundary ... to AB (advisor) ES obtained the asymptotic formulas for eigenvalues and eigenfunctions All authors read and approved the final manuscript Competing interests The authors declare that they have ... retardation obtained Şen and Bayramov Journal of Inequalities and Applications 2011, 2011:113 http://www.journalofinequalitiesandapplications.com/content/2011/1/113 Authors’ contributions Establishment...

Ngày tải lên: 20/06/2014, 22:20

... integral inequality and discrete analogue J Math Anal Appl 194, 569–577 (1995) doi:10.1006/jmaa.1995.1318 13 Pachpatte, BG: On some fundamental integral inequalities and their discrete analogues ... differential equations J Math Anal Appl 251, 736–751 (2000) doi:10.1006/jmaa.2000.7044 Cheung, WS, Ma, QH, Pečarić, J: Some discrete nonlinear inequalities and applications to difference equations Acta ... 27 March 2011 Accepted: 30 August 2011 Published: 30 August 2011 References Pachpatte, BG: On a Certain Retarded Integral Inequality And Its Applications J Inequal Pure Appl Math 5, (2004) Article...

Ngày tải lên: 21/06/2014, 00:20