... high-performance car manufacturers and solar cars Another advantage of composites is their particular visual appearance as an engineered textile, and many cars today have unpainted carbon fibre decorative ... Australian outback as well as being judged as a practical car Trang 19Research Approach Solar Electric vehicles Solar cars are often seen by the general public as “science experiments” and not a viable ... such as increased grip and stability as well as improved braking capacity Larger wheels create a more aggressive and visually arresting stance, a reason perhaps as to why concept cars often have
Ngày tải lên: 11/03/2023, 11:46
Masters thesis of design mission impossible design manufacture of a solar car that appeals to the general public
... process, achieving a CdA target of 0.16 was crucial to avoid delays in the ATN Solar Car Schedule CFD analysis and collaboration with the ATN team at RMIT led to Concept 5.6.4.2, which reached a CdA ... The aggressive styling features an angular front with sharp headlights and a prominent air passage that channels airflow beneath the car Rounded front wheelhouses seamlessly integrate into broad ... streamlined shapes that maintain balance from all angles to achieve efficiency Even small details, such as car size, ventilation openings, or minor creases, can significantly influence computational
Ngày tải lên: 27/05/2023, 09:26
... delta-lactoferrin (GGCACTGTAC-S1Skp1, located at ) 1067 bp, and TAGAAGTCAA-S2Skp1, at ) 646 bp) Both gel shift and chromatin immunoprecipitation assays demonstrated that delta-lactoferrin interacts ... residues leads to a 55% decrease in DLf transcriptional activation, whereas mutation of the RR residues leads to a larger decrease in DLf trans-criptional activation of about 65% The fact that DLfdel.KK432 ... GGCACTCTCAAC ) 104 to ) 93 TGGAAGTCCC ) 213 to ) 204 NM_001007608 Pan troglodytes Skp1 GGCACTGTAC ) 393 to ) 384 TAGAAGTCAAT + 29 to + 37 NW_107077B GACACTGTAAC GGAACTTGC ) 3137 to ) 3129 GGAACTTGC
Ngày tải lên: 30/03/2014, 08:20
Báo cáo khoa học: Glycolipids with nonreducing end a-mannosyl residues that have the potential to activate invariant Va19 NKT cells pptx
... Trang 1that have the potential to activate invariant Va19NKT cells Michio Shimamura1, Yi-Ying Huang1, Naoki Okamoto1, Yutaka Watanabe2, Yoshiko Murakami3, Taroh Kinoshita3, Yoshio Hirabayashi4, ... here As well as a-ManCer [14] and its derivatives [18], 2,6-di-a-mannosyl phosphatidylinositol (a-Man)2-PtdIns, a partial structure of bacterial lipoarabinomannan (LAM) [21]) and a-mannosyl 1–4a-glucosamine-1–6-phosphatidylinositol ... glycolipids Abbreviations a-GalCer, a-galactosyl ceramide; a-ManCer, a-mannosyl ceramide; a-ManCer(Phe), N-[1-(a-mannosyloxymethyl)-3-(4-octylphenyl)propyl] hexadecanamide; a-Man-GlcNH2-PtdIns, a-mannosyl-4a-glucosamine-6-phosphatidylinositol;
Ngày tải lên: 30/03/2014, 08:20
Báo cáo khoa học: Identification of the epitope of a monoclonal antibody that disrupts binding of human transferrin to the human transferrin receptor pptx
... to amplify regions of the N- and C-lobes of hTF and clone into the pGEX 4T3 plasmid. AAAGCGGCCGCTTAGCATGTGCCTTCCCGTAG AAAGAATTCATTAAGGTCTACGGAAAGTGCAGG AAAGAATTCTTACAGGTGAGGTCAGAAGCTGATT AAAGAATTCTTAACCTGAAAGCGCCTGTGTAG ... AAAGAATTCTTAACCTGAAAGCGCCTGTGTAG AAAGAATTCTTAGGTGCTGCTGTTGACGTAATAT AAAGAATTCTTAGGCAGCCCTACCTCTGAGATTTT GGCGATGCAGTCTTCGGTGTTCTCTGCTGATACAC GGTGGTCTCTGCTGATTCACACTCTATTTTCCC a Restriction sites are ... sub-strate system was from Kirkegaard and Perry Laboratories (Gaithersburg, MD) All other chemicals and reagents were of analytical grade Milli-Q water was used to prepare all solutions The F11 and
Ngày tải lên: 30/03/2014, 11:20
simple technical indicators that really work coursebook - larson 2007
... Technical Indicators That Really Work Chapter 1 Technical Indicators 101 One thing I’ve always believed is that technical indicators are more important than fundamentals Time and ... move above the 30-day moving average, it’s said that the stock has greater upside potential; and, as the price drops down below the 30-day moving average it’s said that the stock has greater... ... stock over the last 7 days was $56.27—because that s the parameter I was using 12 Stay focused on the fact that a moving average represents the price of a stock within a certain period... 20–,
Ngày tải lên: 03/05/2014, 13:42
Báo cáo hóa học: " Dipolar cortico-muscular electrical stimulation: a novel method that enhances motor function in both - normal and spinal cord injured mice" pdf
... processing A power lab data acquisition system and LabChart 7 software (ADIn-struments, Inc, CO, USA) were used to acquire and ana-lyze the data Once a single motoneuron was isolated at the left and ... In addition, direct current passed through a neuronal path-way can modulate the excitability of that pathpath-way depending on the current polarity and neuronal geome-try [21,22] In that, anodal ... panels) and after (lower panel) dCMS are shown We also examined cortically-elicited spinal responses (measured as peak - to - peak), which was also substantially increased Examples of contralateral
Ngày tải lên: 19/06/2014, 08:20
Báo cáo toán học: "A Determinant Identity that Implies Rogers-Ramanujan" docx
... ) = a3(1)a3(2)a2(4)a1(5)a1(6)a2(7)x2 and wt(µ 0 ) = a3(2)a3(4)a1(5)a3(7)a1(8)x2 Trang 8of multiple orthogonal polynomials have given rise to simialr polynomials with recurrencesof arbitrary length ... It is apparent that we may apply the involution unless we cannot find a y-coordinate where all paths have an edge and where at least two paths begin a new edge Not being able to find such a y-coordinate ... Trang 1A Determinant Identity that ImpliesRogers-Ramanujan Kristina C Garrett Department of Mathematics and Computer Science Carleton College, Minnesota, USA kgarrett@carleton.edu Submitted:
Ngày tải lên: 07/08/2014, 13:21
báo cáo khoa học: " Proteomic identification of OsCYP2, a rice cyclophilin that confers salt tolerance in rice (Oryza sativa L.) seedlings when overexpressed" pptx
... oxida-tive damage In the early period, rice can rapidly per-ceive a salt stress signal via plasma membrane receptors in root cells and can rapidly initiate an intracellular signal that modulates ... the salt treated samples was calculated in relation to non-treated Data represent the average of four treatments (mean ± S.E.) Identical letters above a pair of bars indicate that the values are ... compartments maintain a balance between the rate of formation and removal of signaling Ionic stresses occur at a later stage, which then leads to senescence of mature leaves The main transpiration
Ngày tải lên: 11/08/2014, 11:21
Báo cáo khoa học: "Development of a RVFV ELISA that can distinguish infected from vaccinated animals" pps
... 127:21-28 Madani TA, Al-Mazrou YY, Al-Jeffri MH, Mishkhas AA, Al-Rabeah AM, Turkistani AM, Al-Sayed MO, Abodahish AA, Khan AS, Ksiazek TG, Shobokshi O: Rift Valley fever epidemic in Saudi Arabia: epidemiological,... ... with anti-human HRP. Samples 1 and 2 are from naturally infected humans. Sample 3 is from a human that was vaccinated with inac- tivated WT RVFV, and sample N is a negative control human sera. ... The assay was carried out as described in Methods. Endpoint titers against each antigen from a human case that was naturally infected (P) and from a human that was vaccinated (V) are shown.
Ngày tải lên: 12/08/2014, 04:21
Báo cáo khoa học: " Development of a RVFV ELISA that can distinguish infected from vaccinated animals" doc
... 127:21-28 Madani TA, Al-Mazrou YY, Al-Jeffri MH, Mishkhas AA, Al-Rabeah AM, Turkistani AM, Al-Sayed MO, Abodahish AA, Khan AS, Ksiazek TG, Shobokshi O: Rift Valley fever epidemic in Saudi Arabia: epidemiological,... ... with anti-human HRP. Samples 1 and 2 are from naturally infected humans. Sample 3 is from a human that was vaccinated with inac- tivated WT RVFV, and sample N is a negative control human sera. ... The assay was carried out as described in Methods. Endpoint titers against each antigen from a human case that was naturally infected (P) and from a human that was vaccinated (V) are shown.
Ngày tải lên: 12/08/2014, 04:22
Báo cáo y học: "Natural antisense transcripts with coding capacity in Arabidopsis may have a regulatory role that is not linked to double-stranded RNA degradation" ppt
... regulatory role of natural antisense transcripts in Arabidopsis<p>Transcription data analysis of overlapping gene pairs in <it>Arabidopsis thaliana </it>argues against a predominant ... the associated genes. A comparison of the arrangements of overlapping gene pairs in Arabidopsis thalianaFigure 1 A comparison of the arrangements of overlapping gene pairs in Arabidopsis thaliana. ... this pathway for endogenous gene regulation remains unclear. Results: We have examined transcription data for overlapping gene pairs in Arabidopsis thaliana. On the basis of an analysis of transcripts
Ngày tải lên: 14/08/2014, 14:21
memoirs of a banking-house
... 1744, as appears by an entry in his journal, declaring that their partnership had terminated that day, and that he was thenceforward... education in Holland, he had of a Dutchman and ; all Having ... Scots money, and very neatly and distinctly appears to have been a general merchant, whose transactions... ill qualified, and as an arbitrator in mer- afterwards accepted the rather ungracious office ... Bus,Ad» [...]... ill-used, and I have seen his eyes, Avhich Avere black and piercing, flash as Avith lightning, if any attempt Avas made to overreach him in a bargain But his passion Avas
Ngày tải lên: 05/11/2014, 09:07
How to Plan a Home Office that Works
... a room separate from the family room Apart from a computer, scanner and printer, your work office may need a filing cabinet with a lockable drawer, along with a phone line or two and a fax machine ... to visualize what you will use each area for You haves your workspace which is usually occupied by a computer and chair and you have storage space that is close to the workspace You can use ... or suffer a power failure before you've had time to save You can also get Shadow Copy software that will restore accidentally deleted files You can have an automatic robot installed that will remember...
Ngày tải lên: 22/10/2013, 19:15
building a parenting agreement that works 6th (2007)
... behavior can be dramatic Lawsuits often take on a life of their own and can be much harder to stop than to start This kind of battle can lead to escalating costs, a dramatically reduced standard ... only on parenting issues, you may find that many of the | building a parenting agreement that works fi nancial issues are easier to tackle and resolve when you start with an agreement that serves ... The American Academy of Child and Adoles cent Psychiatry (AACAP) recommends that parents step back and consider how their divorce may impact their children—and find ways to talk to children that...
Ngày tải lên: 18/04/2014, 14:03
Knock Knock: Seth Godin’s Incomplete Guide to Building a Web Site that Works
... me start with what’s good about this page The best thing is that it’s authentic It appears homemade and it largely is It talks with an honest voice and it makes it clear that you are dealing ... over from an ad or brochure or recommendation And that person is looking for more information on camps that meet her family’s needs So offer that information And it with a vernacular and a tone ... hate your ad and don’t click on it If your ad is really bad, Google will send you a note and fire you Imagine that a media company firing an advertiser for running ineffective ads There’s an art...
Ngày tải lên: 27/05/2014, 12:52
How to setup a Linux system that can boot directly from a software RAID
... disks already contains data, make a backup if needed (all existing data of partitions involved in the process will be lost), and delete or resize existing partitions to create space for the software ... boot loader: Once the configuration installation options are provides, the installation of the system starts: Notice that while the system is installing, the software RAID transparently initializes ... Minor RaidDevice State removed active sync /dev/hda1 Replacing the failed disk When a new disk to replace the failed one is available it can be installed into the system, partitioned to have the...
Ngày tải lên: 18/09/2012, 10:11
Power generation from wind turbines in a solar chimney
... some means such as electric heaters appropriately placed or by placing solar panels near the ground (it creates a solar chimney configuration) The effect of increasing ∆T on increasing the upward ... 0.92 In Table 5, it should be noted that the available wind power in this case is less compared to that in Tables and because the wind turbine diameter in this case is Da = ft compared to that in ... is evaluated by numerical simulation An analytical/computational study is performed to evaluate this potential by employing the well known commercial Computational Fluid Dynamics (CFD) software...
Ngày tải lên: 05/09/2013, 14:59
Tài liệu Module 7: Building and Consuming a Web Service That Uses ADO.NET ppt
... your class ! What are some other ways that you could fill the local DataSet with data other than by using a DataAdapter? ! What is the purpose of creating an empty, local instance of a DataSet? ... a data source Define the structure of a Typed DataSet (by using an xsd file) Create an empty instance of the Typed DataSet Run a query or perform calculations, and fill the DataSet; a DataAdapter ... accidentally swapped the DataSet and DataAdapter, giving a compile error; for example, ds.Fill(da.tablename) is wrong Solution Swap the DataSet and DataAdapter references ! Problem A new employee started...
Ngày tải lên: 10/12/2013, 16:15