Báo cáo khoa học: Identification of the epitope of a monoclonal antibody that disrupts binding of human transferrin to the human transferrin receptor pptx

Although these forms lack the two disulfide linkages, strong noncovalent Keywords transferrin C-lobe; transferrin–transferrin receptor interaction; epitope mapping; monoclonal antibody Co

that disrupts binding of human transferrin to the human transferrin receptor

Evelyn M Teh1, Jeff Hewitt1, Karen C Ung1, Tanya A M Griffiths1, Vinh Nguyen1, Sara K Briggs2, Anne B Mason2and Ross T A MacGillivray1

1 Department of Biochemistry and Molecular Biology and Centre for Blood Research, University of British Columbia, Vancouver, Canada

2 Department of Biochemistry, University of Vermont, College of Medicine, Burlington, Vermont, USA

The transferrins (TF) are a group of metal-binding

pro-teins that are involved in iron homeostasis [1]

Struc-tural studies have revealed that the TFs consist of a

single polypeptide chain of Mr 80000 that folds into

two halves called the N- and C-lobes, each of

approxi-mately 330 amino acids In human transferrin (hTF),

the lobes are connected by a short peptide of seven

resi-dues Each lobe itself can be further subdivided into

two domains separated by a deep cleft that forms the

iron-binding site [2–4] The N1 domain (residues 1–93

and 247–315), C1 domain (residues 340–424 and 583–

679), N2 domain (residues 94–246) and C2 domain

(res-idues 425–582) are composed of a similar a⁄ b fold in

which a number of helices are packed against a central

mixed b-sheet [5] These domains are connected by two

extended b-strands running antiparallel to each other

forming a ‘hinge’ that allows the domains to open and close upon metal binding and release [6] Iron is bound

in a distorted octahedral coordination involving four amino acid ligands and two oxygen atoms from a synergistically bound carbonate ion

The iron–TF complex enters the cell by binding with high affinity (Kd 1–10 nm) to a specific TF receptor (TFR), a type-II membrane protein consisting of two identical Mr95000 subunits covalently linked by two disulfide bonds [7] The N-terminal region of the recep-tor projects into the cytoplasm of the cell and is joined via the transmembrane region to a 671-residue extra-cellular domain that binds TF A soluble form of the receptor can be released by trypsin [8] or produced by recombinant techniques [9,10] Although these forms lack the two disulfide linkages, strong noncovalent

Keywords

transferrin C-lobe; transferrin–transferrin

receptor interaction; epitope mapping;

monoclonal antibody

Correspondence

R.T.A MacGillivray, Department of

Biochemistry and Molecular Biology and

Centre for Blood Research, University of

British Columbia, Vancouver, BC, V6T 1Z3,

Canada

Tel: +1 604 822 3027

Fax: +1 604 822 4364

E-mail: macg@interchange.ubc.ca

(Received 9 July 2005, revised 7 October

2005, accepted 19 October 2005)

doi:10.1111/j.1742-4658.2005.05028.x

The molecular basis of the transferrin (TF)–transferrin receptor (TFR) interaction is not known The C-lobe of TF is required to facilitate binding

to the TFR and both the N- and C-lobes are necessary for maximal bind-ing Several mAb have been raised against human transferrin (hTF) One

of these, designated F11, is specific to the C-lobe of hTF and does not recognize mouse or pig TF Furthermore, mAb F11 inhibits the binding of

TF to TFR on HeLa cells To map the epitope for mAb F11, constructs spanning various regions of hTF were expressed as glutathione S-trans-ferase (GST) fusion proteins in Escherichia coli The recombinant fusion proteins were analysed in an iterative fashion by immunoblotting using mAb F11 as the probe This process resulted in the localization of the F11 epitope to the C1 domain (residues 365–401) of hTF Subsequent computer modelling suggested that the epitope is probably restricted to a surface patch of hTF consisting of residues 365–385 Mutagenesis of the F11 epitope of hTF to the sequence of either mouse or pig TF confirmed the identity of the epitope as immunoreactivity was diminished or lost In agreement with other studies, these epitope mapping studies support a role for residues in the C1 domain of hTF in receptor binding

Abbreviations

TF, transferrin; TFR, transferrin receptor; GST, glutathione S-transferase; hTF(R), human transferrin (receptor).

interactions still result in dimer formation The crystal

structure for the recombinant form of the soluble TFR

has been determined [9], and a higher resolution

struc-ture of the soluble TFR in a complex with the

hemo-chromatosis gene product HFE has also been described

[11] These structures reveal that the TFR ectodomain

consists of three subdomains: a helical domain

respon-sible for dimerization, a protease-like domain and an

apical domain Studies with chimeric receptors made

from regions of both the human and chicken TFR

sug-gest that TF binds to the helical domain of the TFR

[12] with at least part of the hTF binding site localized

specifically to residues 646–648 in the TFR [13,14]

These studies are based on the long-standing

observa-tion that hTF does not bind to chicken TFR and,

recip-rocally, ovotransferrin (oTF) does not bind to the

hTFR The observation that the HFE protein and hTF

bind to the same or closely overlapping sites [14] adds

further support for the role of the helical domain of the

TFR in binding to TF since most of the residues that

bind to HFE reside in this domain

Identification of the specific regions of TF that

inter-act with the TFR has remained more elusive and

con-troversial Although there is some disagreement in the

literature regarding the exact region(s) of TF involved

in TFR binding, it is generally accepted that both lobes

of TF are required for maximal binding [15–17] A

par-ticularly intriguing aspect of the interaction of TF with

the TFR is its pH dependence At pH 7.4, diferric TF

preferentially binds to TFR At pH 5.6 (a value within

the putative pH range of endosomes), iron free or

apo-TF preferentially binds to apo-TFR Since a substantial and

well-documented conformational change (60
opening

and twisting [18]), accompanies the release of iron from

TF, a compensating change in the TFR conformation

might also be expected In fact, the TFR has been

shown to play a role in iron release from TF in a pH

sensitive manner [19–21] A structure of the hTF–hTFR

complex was recently determined with cryo-electron

microscopy [22] In this model, the transferrin N-lobe is

situated between the membrane and the TFR

ectodo-main while the C-lobe binds to the TFR helical doectodo-main

through side chain contacts of the C1 domain More

detailed information about the molecular interactions

between the C-lobe and the TFR was obtained by

hydroxyl radical-mediated protein footprinting and

mass spectrometry [23] In these experiments, specific

C-lobe sequences (residues 381–401, 415–433 and

457–470) were protected against oxidation and thus

proposed to be involved in receptor binding

Another approach to determine the regions of TF

that are critical to receptor binding is the production

of specific monoclonal antibodies (mAb) that can be

tested for their ability to block such binding Mason and Woodworth characterized seven high affinity anti-bodies that recognized at least four different epitopes

in hTF [24] Three of the mAbs recognized unique epi-topes in the N-lobe and two (designated E8 and F11) recognized the same or a closely overlapping epitope

in the C-lobe Interestingly, the C-lobe mAbs bound with high affinity to hTF but did not recognize six other mammalian TFs Further studies clearly demon-strated that the C-lobe mAbs recognized both the reduced and nonreduced forms of hTF indicating that the epitope is mainly sequential rather than conforma-tional [24] It was also noted, however, that the inter-action was sensitive to the presence or absence of iron with a two-fold higher affinity for iron loaded TF compared to apo-TF This observation suggested that the epitope may also have a conformational compo-nent as binding of iron by either lobe of TF is accom-panied by a significant conformational change

The current study describes the localization of the mAb F11 epitope to the C-lobe of hTF, specifically to residues 365–401 that are located in the C1 domain In particular, these results implicate this region in the binding of hTF to TFR

Results

TFR binding studies The results of a study designed to determine the ability

of selected mAbs to block binding of a subsaturating amount of radioiodinated hTF to TFR on HeLa cells are presented in Fig 1 The three mAbs specific to the N-lobe demonstrated variable degrees of blocking

Fig 1 mAb mediated inhibition of hTF binding to TFR on HeLa cells. 125I-labelled hTF was incubated with HeLa cells in the pres-ence of increasing amounts of mAb and the resultant binding expressed as the percentage of the binding in the absence of mAb The mAbs used were: aHT + N 1, aHT + N 2, HTF.14, F11 and E8 [24].

Two of the antibodies (aHT + N1 and aHT + N2)

partially blocked binding whereas the third antibody

(HTF.14) blocked virtually all binding to TFR The

antibodies to the C-lobe (F11 and E8, which share the

same or a very similar epitope [24]) inhibited virtually

all binding of hTF to TFR Also, treatment of hTF

with biotin resulted in a preparation of biotinylated

hTF that was not recognized by the mAb F11 (data

not shown) As biotin binds to lysyl residues, this

result suggests that a lysyl residue may be involved in

antibody–epitope recognition

Analysis of IPTG-induced fusion protein expression

To identify the epitope for mAb F11, several fusion

plasmids comprised of GST and various regions of TF

were constructed (Fig 2, see Experimental procedures)

These constructs were expressed in Escherichia coli and

the immunoreactivity of the recombinant fusion

pro-teins to mAb F11 in the uninduced and IPTG-induced

states was analysed by Western blot An anti-GST

serum was used to verify the production of the GST

fusion proteins Figure 3A and Fig 4A are

immuno-blots of the bacterial lysates of various GST–hTF

fusions visualized with the anti-GST serum The

pres-ence of a 29-kDa band in the uninduced lanes of pGEX

4T3 (Fig 3A, lane 1; Fig 4A, lane 4) is probably due

to low levels of constitutive expression from the pGEX promoter Nevertheless, induction leads to a substantial increase in expression (Fig 3A, lane 2; Fig 4A, lane 5) Based on the intensity of the bands from equal amounts

of cell lysate, both the N- and C-lobe GST fusion pro-teins were expressed at similar levels (Fig 3A, lanes 4 and 6) As expected, full-length hTF is not recognized

by the anti-GST serum (Fig 4A, lane 1) The other constructs (hTF-5 to hTF-8 and hTF-5A to hTF-5F) were also successfully expressed and migrated at a mass

Fig 2 GST–TF fusion proteins used for western blot analysis The

fusion proteins consisted of GST (white bar) joined to regions of

the hTF N-lobe (grey bar) and C-lobe (black bar) The encompassing

residues of hTF in each of the GST fusion proteins are labelled

above the bars.

A

B

Fig 3 Western blot analysis of GST–hTF fusion proteins (A) West-ern blot analysis using an anti-GST serum before (–) and after (+) induction of the fusion protein The following expression plasmids were used: (lanes 1–2) pGEX4T3; (lanes 3–4) hTF N-lobe; (lanes 5–6) hTF C-lobe; (lanes 7–8) hTF-5; (lanes 9–10) hTF-6; (lanes 11–12) hTF-7; (lanes 13–14) hTF-8 (B) Western blot analysis using the mAb F11 after induction of the fusion protein The following expression plasmids were used: (lane 1) pGEX4T3; (lane 2) hTF; (lane 3) hTF N-lobe; (lane 4) hTF C-lobe; (lane 5) hTF-5; (lane 6) hTF-6; (lane 7) hTF-7; (Lane 8) hTF-8.

consistent with their predicted fusion protein

composi-tions (Fig 3A, lanes 8, 10, 12 and 14; Fig 4A, lanes 7,

9, 11, 13, 15 and 17)

Epitope mapping for mAb F11

Western blot analysis of the different C-lobe fragments

with the mAb F11 allowed the determination of the

specific region of the C-lobe containing the epitope

(Fig 3B) Full-length hTF was used as a positive

con-trol and a bacterial lysate from E coli transformed with

pGEX 4T3 was used as a negative control In agreement

with previous studies, only full-length hTF (lane 2) and

the hTF C-lobe (lane 4) fusion protein showed reactivity

with the antibody [24] Following division of the C-lobe

into four fragments of approximately 100 residues each,

only the hTF-5 fusion protein (lane 5) was positive This

fragment encompasses residues 342–440 of hTF and

maps to the amino terminus of the C-lobe contained

lar-gely within the C1 domain

To further delineate the region recognized by the mAb F11, additional pGEX 4T3 constructs were made containing deletions from the carboxy-terminal region

of the hTF-5 fragment These constructs (designated hTF-5A to 5F) encompassed residues 342–420 As shown in Fig 4B, a positive signal was observed with constructs hTF-5B, 5C and 5D (lanes 8, 10, and 12) blotted with the mAb F11 while construct 5A (lane 6) gave only a weak signal Even at higher concentrations

of the hTF-5A bacterial lysates, the intensity of the immunoreactive band did not increase relative to con-structs 5B, 5C and 5D (data not shown) These results suggest that hTF-5A may contain only part of the F11 epitope The absence of reactivity with the 5E and 5F constructs indicates that these constructs did not con-tain the epitope for the mAb F11 Based on these results, the epitope for the mAb F11 was localized to a region within residues 365–401

A nonspecific band at 66 kDa was observed in all the lanes for the mAb F11 Western blots (Fig 4B),

A

B

Fig 4 Western blot analysis of GST–hTF-5 fusion proteins (A) Western blot analysis using an anti-GST serum before (–) and after (+) induc-tion of the fusion protein The following expression plasmids were used: (lane 1) hTF; (lanes 2–3) hTF C-lobe; (lanes 4–5) pGEX4T3; (lanes 6–7) hTF-5 A; (lanes 8–9) hTF-5B; (lanes 10–11) hTF-5C; (lanes 12–13) hTF-5D; (lanes 14–15) hTF-5E; (lanes 16–17) hTF-5F (B) Western blot analysis using the mAb F11 before (–) and after (+) induction of the fusion protein The following expression plasmids were used: (lanes 1–2) pGEX4T3; (lanes 3–4) hTF C-lobe; (lanes 5–6) hTF-5 A; (lanes 7–8) hTF-5B; (lanes 9–10) hTF-5C; (lanes 11–12) hTF-5D; (lanes 13–14) hTF-5E; (lanes 15–16) hTF-5F.

including the pGEX 4T3 control Furthermore, the

hTF C-lobe, hTF-5C and hTF-5D (lanes 4, 10 and 12)

samples had additional bands at lower molecular

weights not seen in the pGEX 4T3 control (lane 2)

The intensities of these bands corresponded to the

pos-itive reactivity of the target protein and may therefore

have been degradation products of the truncated

pro-tein The sensitivity of the anti-GST serum to detect

lower concentrations of the target protein is not as

great as that of the mAb F11; therefore, it is not

sur-prising that the corresponding bands are not seen in

the anti-GST blots As hTF-5E and 5F fusion proteins

are short, 23 and 17 amino acid residues, respectively,

it could be argued that the absence of positive signal

be attributed to protein degradation However, the

GST moiety was detected with the anti-GST serum

(Fig 4A, lanes 15 and 17) and showed the

appropri-ate, slight increase in molecular mass corresponding

to the theoretical GST C-lobe fusion product, so this

possibility seems unlikely

Studies with synthetic peptide

To investigate the identity of the F11 epitope further,

a synthetic peptide having a short sequence

KIECVSAETTEDCI (amino acid residues 365–378 of

the C-lobe of hTF) from the positive fusion protein

hTF-5B (Fig 4B, lane 8) was synthesized for use in a

competitive immunoassay Unfortunately, the peptide

was insoluble in both reducing and nonreducing

aque-ous solutions and this precluded its use in further

studies An alternative approach was used to verify the

localized epitope

Crossreactivity of the mAb F11

In previous studies by Mason and Woodworth [24],

mAb F11 did not recognize six other mammalian TFs

nor oTF A protein sequence alignment was performed

and upon comparison of the amino acid sequences in a

region of the putative F11 epitope (residues 365–378,

hTF numbering), it was determined that all TFs ana-lyzed had at least one amino acid difference (Table 1)

To confirm the mAb F11 epitope, the hTF-5D con-struct, which showed the greatest reactivity with the mAb F11, was mutated at two different residues to mimic the sequence of either pig (T373N) or mouse (V369E) TF Figure 5A shows expression of the con-structs as detected by the anti-GST serum Both the hTF-5D T373N (lane 3) and hTF-5D V369E (lane 5) constructs were expressed at a similar level to hTF-5D (lane 1) Neither the hTF-5D T373N (Fig 5B, lane 4),

Table 1 Sequence alignment of TF family members The alignments were made with BLOSUM 62 score tables with default settings; amino acid numbering is for hTF Residues that are identical to hTF at the equivalent position are shown by ’ ’.

A

B

Fig 5 Western blot analysis of the modified hTF-5D GST fusion proteins (A) Anti-GST blot of the hTF-5D and the modified con-structs before (–) and after (+) induction with IPTG The following expression plasmids were used: (lane 1–2) 5D; (lane 3–4) hTF-5D T373N; (lane 5–6) hTF-hTF-5D V369E (B) The F11 blot of hTF-hTF-5D and the modified hTF-5D constructs before (–) and after (+) induc-tion of the fusion protein The following expression plasmids were used: (lane 1–2) hTF-5D; (lane 3–4) hTF-5D T373N; (lane 5–6) hTF-5D V369E The arrow denotes the position of the GST-5D constructs.

which resembles the pig TF sequence, nor the hTF-5D

V369E (Fig 5B, lane 6) representing the mouse

sequence in the putative epitope region, had a positive

immunoreaction with mAb F11 (compare to hTF-5D,

Fig 5B, lane 2) This result is consistent with the

earlier mapping of the mAb F11 to a sequence in the

C-lobe of human TF while showing no cross-reactivity

with pig and mouse TF [24]

Discussion

The present study establishes that the epitope of the

F11 antibody is in the C-lobe of hTF, specifically

within residues 365–401 of the C1 domain

Further-more, binding of the F11 antibody to hTF inhibits

binding to TFR (Fig 1) The residues of TF that are

involved in receptor binding have remained elusive,

but it has been documented that the C-lobe binds to

TFR with a much higher affinity than the N-lobe and

mixing of both lobes increases the binding further [15]

Thus, it has been suggested that specific C-lobe

resi-dues are critical for establishing contacts with TFR

while the N-lobe residues are required for maximal

binding [22] Our goal was to use an epitope mapping

study with an antibody known to inhibit binding of

hTF to TFR to delineate the residues that comprise

the antibody binding site and thus, by extension, the

TFR binding site

The E coli pGEX expression system allows for the

production of GST fusion proteins and was used to

express the C-lobe of hTF and partial fragments of the

C-lobe Earlier studies have shown that glycosylation

of hTF is not important for protein expression [25]

and the expression of functional forms of recombinant

full-length, N-lobe and C-lobe of human transferrin in

E coli has been demonstrated [26–28] Thus, a

pro-karyotic host was chosen for this study as it provided

a simple and cost effective method for analysis with

the denaturing conditions used Although expression

of the hTF C-lobe has been shown in various systems,

levels are consistently lower than those of the

recom-binant N-lobe in eukaryotic cells [1,25,27,28] It

remains unclear why expression of the isolated C-lobe

yields low protein production but the large number of

disulfide bonds (11 in total) present in the C-lobe is

certainly a factor [17] Another approach for obtaining

the C-lobe was recently reported in which a factor Xa

cleavage site was introduced into the connecting bridge

region of the higher expressing full-length TF [17] The

two lobes were subsequently separated after treatment

of the full-length TF with factor Xa In the current

study, we have also obtained expression of the C-lobe

of TF although we have not determined whether it

assumes a native conformation It is possible that the 29-kDa GST moiety in this system provides some sta-bilization

Immunoscreening of the GST-hTF C-lobe fragments

by Western blot analysis was used to identify the mAb F11 epitope, which was localized to residues 365–401

in the amino-terminal region of the hTF C-lobe Con-firmation for the identification of this particular region

as the mAb F11 epitope came from two observations First, we have shown that a single amino acid substitu-tion in either one of two residues between posisubstitu-tions

365 and 378 abolished the immunoreactivity to mAb F11 (Fig 5B) The two mutations in this region corres-pond to the amino acid sequences of either mouse (V369E) or pig (T373N) TF, neither of which is recog-nized by the mAb F11 Substitution of a negatively charged glutamyl residue for the hydrophobic valyl residue observed in the mouse sequence abolished all reactivity to the F11 antibody Furthermore, the fairly conservative T373N substitution observed in the pig

TF sequence also resulted in loss of immunoreactivity

An M382V substitution in mouse and pig TF could also contribute to the lack of cross reactivity between species Antibodies can be exquisitely sensitive to such small changes in sequence [29] These results provide strong support that the epitope is located within resi-dues 365–401 Second, treatment of hTF with biotin resulted in a preparation of biotinylated hTF that was not recognized by the mAb F11 Biotin binds to lysyl residues and there are lysyl residues at positions 365,

380, and 401 According to the crystal structure of hTF [30], K365 and K380 are located on the surface

of the C-lobe and may be attractive targets for the immune system The crystal structure of hTF also shows that residues 386–401 are buried in the interior

of the protein with K401 actually appearing on the opposite face of the protein from the majority of resi-dues in the F11 epitope [30] Assuming that the F11 antibody is binding to surface residues, it is likely that the epitope is restricted to residues 365–385 of the hTF C-lobe

The mAb F11 blocked binding of hTF to the TFR; this suggests the antibody epitope contains residues that are located in the vicinity of the ligand–receptor interaction The ability of the F11 antibody to block such binding is likely caused by steric interference Examination of the recently published pig TF structure shows that the residues in the pig TF sequence equival-ent to 365–372 make up a b-strand [31] and Asn373 of pig TF (Table 1, Thr373 in hTF) lies in a loop follow-ing this strand As shown in Fig 6, the putative F11 epitope described in this work maps to a surface on the C1 domain of hTF A peptide footprinting study

by Liu and colleagues [23] also predicted the amino

acids that comprise part of the F11 epitope to be

involved in TFR binding In their study, oxidative

modification of various peptides in the C-lobe of hTF

was monitored Peptides that were oxidized while the

C-lobe was isolated but were protected from oxidative

modification after the C-lobe had associated with the

TFR were suggested to be involved in hTF–TFR

association A region of hTF we have proposed to be

involved in TFR binding was shown to be protected

from oxidative modification and was thus proposed to

undergo a conformational change upon hTF–TFR

binding An elegant study by Cheng et al [22]

des-cribes the structure of hTF complexed with hTFR as

determined by cryo-electron microscopy The authors

proposed that a positively charged patch of TFR

con-taining many basic residues interacts with a

comple-mentary negative patch of hTF containing acidic

residues The F11 epitope described in this study

con-tains seven acidic residues, two of which were

pro-posed to interact with the TFR (Glu367 and Glu372)

[22] It is possible that the F11 epitope is not within

the binding site of TF for the receptor but that binding

of the antibody leads to steric hindrance or

conforma-tional changes that alter the binding site However, the

agreement of the F11 epitope with the studies of

Cheng [22] and Liu [23] argues against this idea

It has been proposed from modelling studies that

both the C1 and N1 domains anchor hTF to the TFR

[9] In contrast, the C2 and N2 domains are thought

to be the main source of movement about the hinge in

response to iron release [9] Unfortunately, there is

no structure available for the iron free form of any

mammalian serum TF that would allow assessment of

conformational change in this region in response

to iron release One other interesting and potentially relevant observation is that human, mouse, rat and rabbit serum TFs all have an extra disulfide bond com-prised of residues 137 and 331 (human numbering) which restricts access to the hinge region and could have an impact on the stability of the N1 and C1 regions Bovine, pig and horse TF lack this extra disul-fide bond possibly giving them greater flexibility Addi-tionally, it may be significant that the epitope is located on the opposite face from the glycosylation site, which has been shown to have no role in receptor binding [25]

Human, pig, rabbit and horse TF bind to human TFR, whereas bovine TF binds very poorly and chicken oTF does not bind at all This either means that the antibody is more discriminating than the receptor in recognition and⁄ or there are multiple receptor binding sites that contribute to the overall binding Until a crystal structure of the TF–TFR com-plex resolves these issues, the current studies highlight

an area of hTF that is a strong candidate for partici-pation in the interaction with the receptor

Experimental procedures

Materials

E coli strain DH5aF¢ and pBluescript SK–

were from Stratagene (La Jolla, CA) E coli strain BL21 (DE3) was from Novagen (San Diego, CA) The vector pGEX 4T3 used for the expression of the GST fusion proteins, the GST Detection Module (including anti-GST serum) and the chemiluminescence detection kit were from GE Health-care (Piscataway, NJ) Isopropyl-b-D-thiogalactopyranoside (IPTG) and BSA were from the Sigma Chemical Company (Oakville, ON) as were horseradish peroxidase-conjugated immunoglobulins Human transferrin was from Roche Applied Science (Laval, QC) Immunopure NHS-LC-Biotin and Immunopure avidin-horseradish peroxidase were from Pierce (Rockford, IL) The TMB Microwell peroxidase sub-strate system was from Kirkegaard and Perry Laboratories (Gaithersburg, MD) All other chemicals and reagents were

of analytical grade Milli-Q water was used to prepare all solutions The F11 and E8 antibodies were a generous gift from Dr James D Cook and coworkers at the University

of Kansas Medical Center in Kansas City, KS

TFR binding studies

To examine the ability of various monoclonal antibodies

to block binding of hTF to the hTFR on HeLa cells, a limiting amount of125I-labelled diferric hTF (20 pmol) was

Fig 6 Location of the mAb F11 epitope in hTF The C1 and N1

domains are highlighted in light grey; C2 and N2 domains are

col-oured dark grey The F11 epitope (residues 365–401), which is in

close proximity to the labelled bridge region, is shown in red The

two views are rotated 90
to each other The coordinates of the

monoferric hTF crystal structure were provided by Dr H Zuccola

[30].

preincubated with increasing amounts of each antibody

(0–80 pmol) at room temperature for 30 min in a total

volume of 100 lL At this time, 300 lL of HeLa cells

(1.4 · 106

cells) that had been incubated at 37
C for

20 min with 10 mm NH4Cl to inhibit iron removal from

the hTF in the subsequent incubations was added to

Omni-vials containing the radioiodinated TF and the mAbs After

incubation at 37
C for 30 min with gentle shaking,

por-tions of the cell suspension (three porpor-tions, 80 lL each)

were washed and assayed as described in detail [15,25] The

results are expressed as the percentage of binding of

radio-iodinated hTF to HeLa cells in the absence of added

anti-body

Cloning of hTF fragments

The hTF cDNA cloned into pUC18 was used as a template

for the generation of the hTF N-lobe, hTF C-lobe and four

subfragments of the hTF C-lobe designated 5, 6, 7 and 8

Primers used in the PCR amplifications are listed in

Table 2 PCR amplifications were performed with VENT

polymerase (New England Biolabs, Beverly, MA) in a

Per-kin Elmer Cetus DNA Thermal Cycler 480 and consisted

of 30 cycles of denaturation at 94
C for 1 min, annealing

at 54
C for 1 min and extension at 72
C for 1 min

fol-lowed by a 10-min final extension at 72
C Using specific

flanking restriction sites listed in Table 2, the PCR products

were cloned into pBluescript SK– vector and transformed into E coli DH5aF¢ To confirm the expected sequences of the constructs and to ensure the absence of mutations introduced during the PCR steps, DNA sequence analysis

of positive clones was performed using an ABI Prism Model 310 Genetic Analysis DNA Sequencer (Dr Ivan Sadowski, University of British Columbia, BC)

Cloning of hTF fragments into the pGEX 4T3 vector

The hTF fragments were subcloned into the pGEX 4T3 vector for the expression of GST fusion proteins Briefly, the pBluescript–hTF clones were digested with either XhoI and NotI (hTF N-lobe) or BamHI and EcoRI (hTF C-lobe), purified and ligated into the 3¢ end of the GST sequence in the pGEX 4T3 expression vector The pGEX 4T3 constructs were transformed into E coli strain BL21 (DE3) (Novagen, Madison, WI) and positive clones were selected by PCR screening and verified by both multiple restriction digests and DNA sequence analysis

Additional pGEX 4T3-hTF-5 based recombinant plas-mids were constructed that contained subfragments of

hTF-5 designated hTF-5A to hTF-5F These subclones were obtained by PCR amplification using the pGEX 4T3 hTF-5 as a tem-plate, the hTF-5 forward primer and a new reverse primer (Table 2) PCR conditions were 30 cycles of denaturation

Table 2 Oligonucleotide primers used to generate the GST–hTF fusion proteins Synthetic oligonucleotide primers were used to amplify regions of the N- and C-lobes of hTF and clone into the pGEX 4T3 plasmid.

AAAGCGGCCGCTTAGCATGTGCCTTCCCGTAG

AAAGAATTCATTAAGGTCTACGGAAAGTGCAGG

AAAGAATTCTTACAGGTGAGGTCAGAAGCTGATT

AAAGAATTCTTAACCTGAAAGCGCCTGTGTAG

AAAGAATTCTTAGGTGCTGCTGTTGACGTAATAT

AAAGAATTCTTAGGCAGCCCTACCTCTGAGATTTT

GGCGATGCAGTCTTCGGTGTTCTCTGCTGATACAC

GGTGGTCTCTGCTGATTCACACTCTATTTTCCC

a Restriction sites are underlined b The forward primer used with the c reverse primers of the hTf5A-5F for PCR amplification d The muta-genic nucleotides are in bold-type.

at 94
C for 30 s, annealing at 54
C for 30 s and extension

at 72
C for 30 s followed by a final extension at 72
C for

10 min Positive clones were selected by PCR screening and

sequenced to ensure that no mutations were introduced

during the PCR reaction

The QuikChangeTM site-directed mutagenesis kit

(Strata-gene) was used to introduce the V369E and T373N

muta-tion into the hTF-5D construct to resemble mouse and pig

transferrin, respectively, in the region of the putative

epi-tope (amino acid numbering according to NCBI Accession

P02787 with the 19 amino acid hTF signal peptide cleaved

so amino acid 1 is the valyl residue of the sequence

VPDK) The two sets of complimentary mutagenic primers

used are listed in Table 2 The mutagenic reactions were

subjected to an initial temperature of 95
C for 30 s,

fol-lowed by 16 cycles of denaturation at 95
C for 30 s,

annealing at 55.8
C for 1 min and extension at 68
C for

11 min The DNA sequences of all clones were determined

before the expression studies were performed

IPTG induction of GST-hTF fusion proteins

A single colony containing a pGEX 4T3 GST⁄ hTF

recom-binant plasmid was inoculated into Luria broth (LB)

con-taining 100 lgÆmL )1 ampicillin and grown overnight at

37
C A 100-lL aliquot of the overnight culture was then

used to inoculate 1 mL of LB⁄ ampicillin medium at 37
C

for 3 h To induce the expression of the GST–hTF fusion

proteins, IPTG was added to a final concentration of 1 mm

and the cultures were incubated for an additional 3 h at

37
C After 3 h, the bacteria were harvested by

centrifuga-tion and 200 lL of 3· SDS sample buffer was added to

the cell pellets The mixture was then boiled at 95
C for

5 min to lyse the cells

Gel electrophoresis and western blotting

SDS/PAGE was performed using a mini gel apparatus

Equal volumes of the whole cell lysates were resolved on

a 12.5% acrylamide separating gel (1 : 29 bis:acrylamide)

with a 5% acrylamide stacking gel Gels were stained with

Coomassie Blue to visualize the protein bands

For western blot analysis, the proteins were transferred

to a poly(vinylidene difluoride) membrane (Bio-Rad) at

400 mA for 1 h Following transfer, the membrane was

blocked overnight at 4
C in phosphate buffered saline and

0.02% Tween 20 (NaCl⁄ Pi-T) with 4% BSA The

mem-branes were washed in NaCl⁄ Pi-T and incubated with the

monoclonal antibody antihuman F11 (1 : 20000) or goat

anti-GST (1 : 1000) for 1 h at room temperature

Immuno-reactive proteins were visualized using a horseradish

per-oxidase-conjugated goat antimouse or donkey antigoat

antibody (1 : 20000 for 1 h at room temperature) together

with chemiluminescent detection and exposure to Kodak

X-Omat XLS Blue film for 30 s

Peptide construction and immunoassay The 14-mer synthetic peptide, KIECVSAETTEDCI, was synthesized by PeptidoGenic Research & Co Inc (Liver-more, CA) The lyophilized peptide was insoluble in both reducing and nonreducing aqueous solutions and was not used in further studies

Molecular mapping The coordinates of the monoferric hTF crystal structure were kindly provided by Dr H Zuccola [30] The model of hTF showing the F11 epitope was displayed using the pro-gram Swiss-Pdb Viewer, version 3.7 (available online at http://www.expasy.org/spdbv/)

Acknowledgements

These studies were supported in part by grants from the Canadian Blood Services – Canadian Institutes of Health Research (CBS-CIHR) Research Program in Blood Utilization and Conservation (to R.T.A.M) and the U.S Public Health Services, National Institutes of Health (NIDDK Grant R01 21739 to A.B.M) E.M.T was supported by a Postdoctoral Fellowship from CBS-CIHR; T.A.M.G was supported by a Graduate Fellowship from the Strategic Training Program in Transfusion Science supported by the CIHR and the Heart and Stroke Foundation of Canada

References

1 MacGillivray RTA & Mason AB (2002) Transferrins In Molecular and Cellular Iron Transport(Templeton, DM, ed.), pp 41–69 Marcel Dekker Inc., New York, NY

2 Anderson BF, Baker HM, Dodson EJ, Norris GE, Rumball SV, Waters JM & Baker EN (1987) Structure

of human lactoferrin at 3.2-A resolution Proc Natl Acad Sci USA 84, 1769–1773

3 Anderson BF, Baker HM, Norris GE, Rumball SV & Baker EN (1990) Apolactoferrin structure demonstrates ligand-induced conformational change in transferrins Nature 344, 784–787

4 Bailey S, Evans RW, Garratt RC, Gorinsky B, Hasnain

S, Horsburgh C, Jhoti H, Lindley PF, Mydin A, Sarra

R & Watson JL (1988) Molecular structure of serum transferrin at 3.3-A resolution Biochemistry 27, 5804– 5812

5 Baker EN & Lindley PF (1992) New perspectives on the structure and function of transferrins J Inorg Biochem

47, 147–160

6 Aisen P, Enns C & Wessling-Resnick M (2001) Chemis-try and biology of eukaryotic iron metabolism Int J Biochem Cell Biol 33, 940–959

7 Enns CA (2002) The transferrin receptor In Molecular

and Cellular Iron Transport(Templeton, DM, ed.), pp

71–94 Marcel and Dekker Inc., New York, NY

8 Turkewitz AP, Amatruda JF, Borhani D, Harrison SC

& Schwartz AL (1988) A high yield purification of the

human transferrin receptor and properties of its major

extracellular fragment J Biol Chem 263, 8318–8325

9 Lawrence CM, Ray S, Babyonyshev M, Galluser R,

Borhani DW & Harrison SC (1999) Crystal structure of

the ectodomain of human transferrin receptor Science

286, 779–782

10 Lebron JA, Bennett MJ, Vaughn DE, Chirino AJ, Snow

PM, Mintier GA, Feder JN & Bjorkman PJ (1998)

Crystal structure of the hemochromatosis protein HFE

and characterization of its interaction with transferrin

receptor Cell 93, 111–123

11 Bennett MJ, Lebron JA & Bjorkman PJ (2000) Crystal

structure of the hereditary haemochromatosis protein

HFE complexed with transferrin receptor Nature 403,

46–53

12 Buchegger F, Trowbridge IS, Liu LF, White S &

Col-lawn JF (1996) Functional analysis of human⁄ chicken

transferrin receptor chimeras indicates that the

carboxy-terminal region is important for ligand binding Eur J

Biochem 235, 9–17

13 Dubljevic V, Sali A & Goding JW (1999) A conserved

RGD (Arg-Gly-Asp) motif in the transferrin receptor

is required for binding to transferrin Biochem J 341,

11–14

14 West AP Jr, Bennett MJ, Sellers VM, Andrews NC,

Enns CA & Bjorkman PJ (2000) Comparison of the

interactions of transferrin receptor and transferrin

receptor 2 with transferrin and the hereditary

hemo-chromatosis protein HFE J Biol Chem 275, 38135–

38138

15 Mason AB, Tam BM, Woodworth RC, Oliver RW,

Green BN, Lin LN, Brandts JF, Savage KJ, Lineback

JA & MacGillivray RT (1997) Receptor recognition

sites reside in both lobes of human serum transferrin

Biochem J 326, 77–85

16 Zak O, Trinder D & Aisen P (1994) Primary

receptor-recognition site of human transferrin is in the

C-term-inal lobe J Biol Chem 269, 7110–7114

17 Zak O & Aisen P (2002) A new method for obtaining

human transferrin C-lobe in the native conformation:

preparation and properties Biochemistry 41, 1647–1653

18 Jeffrey PD, Bewley MC, MacGillivray RT, Mason AB,

Woodworth RC & Baker EN (1998) Ligand-induced

conformational change in transferrins: crystal structure

of the open form of the N-terminal half-molecule of

human transferrin Biochemistry 37, 13978–13986

19 Bali PK & Aisen P (1991) Receptor-modulated iron release from transferrin: differential effects on N- and C-terminal sites Biochemistry 30, 9947–9952

20 Bali PK, Zak O & Aisen P (1991) A new role for the transferrin receptor in the release of iron from transfer-rin Biochemistry 30, 324–328

21 Sipe DM & Murphy RF (1991) Binding to cellular receptors results in increased iron release from transfer-rin at mildly acidic pH J Biol Chem 266, 8002–8007

22 Cheng Y, Zak O, Aisen P, Harrison SC & Walz T (2004) Structure of the human transferrin receptor-transferrin complex Cell 116, 565–576

23 Liu R, Guan JQ, Zak O, Aisen P & Chance MR (2003) Structural reorganization of the transferrin C-lobe and transferrin receptor upon complex formation: the C-lobe binds to the receptor helical domain Biochemistry 42, 12447–12454

24 Mason AB & Woodworth RC (1991) Monoclonal anti-bodies to the amino- and carboxyl-terminal domains of human transferrin Hybridoma 10, 611–623

25 Mason AB, Miller MK, Funk WD, Banfield DK, Sav-age KJ, Oliver RW, Green BN, MacGillivray RT & Woodworth RC (1993) Expression of glycosylated and nonglycosylated human transferrin in mammalian cells Characterization of the recombinant proteins with com-parison to three commercially available transferrins Biochemistry 32, 5472–5479

26 Ikeda RA, Bowman BH, Yang F & Lokey LK (1992) Production of human serum transferrin in Escherichia coli Gene 117, 265–269

27 Steinlein LM & Ikeda RA (1993) Production of N-term-inal and C-termN-term-inal human serum transferrin in Escheri-chia coli Enzyme Microb Technol 15, 193–199

28 Hoefkens P, de Smit MH, de Jeu-Jaspars NM, Huijs-kes-Heins MI, de Jong G & van Eijk HG (1996) Isola-tion, renaturation and partial characterization of recombinant human transferrin and its half molecules from Escherichia coli Int J Biochem Cell Biol 28, 975–982

29 Prasad L, Sharma S, Vandonselaar M, Quail JW, Lee

JS, Waygood EB, Wilson KS, Dauter Z & Delbaere LT (1993) Evaluation of mutagenesis for epitope mapping Structure of an antibody-protein antigen complex

J Biol Chem 268, 10705–10708

30 Zuccola HJ (1993) PhD Thesis, Georgia Institute of Technology, Atlanta

31 Hall DR, Hadden JM, Leonard GA, Bailey S, Neu M, Winn M & Lindley PF (2002) The crystal and molecular structures of diferric porcine and rabbit serum transfer-rins at resolutions of 2.15 and 2.60 A, respectively Acta Crystallogr D Biol Crystallogr 58, 70–80