a key to understand the pathogen adaptation mechanism

Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

... was generated using primer CP-pyk (5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pyk-back (5¢-CTCTACATGCATTTCAACAATAGGGCCTG ... (5¢-TGGTACTCGAG CAATTTCTGAAGGTATCGAAG-3¢) and pyk2 (5¢-GG AAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) and downstream to pyk using primer pyk3 (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4 (5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) ... equal amounts of formate and acetyl-CoA and the resulting acetyl-CoA is then metabolized into equal amount of ethanol and acetate to maintain the redox balance Discussion In this study we quantified...

Ngày tải lên: 19/02/2014, 17:20

12 620 0
Báo cáo khoa học: "Veterinary decision making in relation to metritis - a qualitative approach to understand the background for variation and bias in veterinary medical records"

Báo cáo khoa học: "Veterinary decision making in relation to metritis - a qualitative approach to understand the background for variation and bias in veterinary medical records"

... scores as a 'diag-nostic tool' related to each individual treatment decision rather than being part of a collaborative data collection For example, they could add rectal temperature and other parameters ... motivated to collect valid data at the herd level They perceive the collection of the data in and of itself as the basis for taking relevant action at the farm They may skip the process of systematic ... that specific situa-tion?' Data Analysis The qualitative analysis is based on a phenomenographic approach; that is a qualitative method to use empiric data (e.g., interview) to describe the variation...

Ngày tải lên: 25/10/2012, 10:45

10 589 0
Tài liệu Streetsmart Guide to Valuing A Stock: The Savvy Investors Key to Beating the Market docx

Tài liệu Streetsmart Guide to Valuing A Stock: The Savvy Investors Key to Beating the Market docx

... reflect able information and are based on an accurate evaluation of all avail-able information avail-A random walk is a path that a variable takes, such as the observed price of a stock, where the ... risk.ap-Beta—( ␤ i) is a measure of the systematic risk of an asset The totalstock market as measured by the S&P 500 Index has a beta of 1.0 Thebeta of a stock with the same price movement as ... percent The standard deviation measures the spread of the observationsaround the average of the returns A high standard deviation means a big spread of returns and a high risk that the actual return...

Ngày tải lên: 21/12/2013, 01:19

289 615 1
A Strategy to Engage the Private Sector in Climate Change Adaptation in Bangladesh docx

A Strategy to Engage the Private Sector in Climate Change Adaptation in Bangladesh docx

... of the UNFCCC database and the NAPAs Like the latter, most cases are from sub-Saharan Africa, followed by South and Central Asia and Latin America, but in addition it shows that the vast majority ... Climate Change in Bangladesh The IFC clearly have the potential to play an important catalytic role in the objective of engaging the private sector in Climate Change Adaptation by both managing a ... ongoing adaptation projects and initiatives at the local and national levels which can inform an assessment of adaptation needs The UNFCCC secretariat, for example, hosts an adaptation practices...

Ngày tải lên: 16/03/2014, 14:21

49 559 0
báo cáo khoa học: " The transcription factor PHR1 plays a key role in the regulation of sulfate shoot-to-root flux upon phosphate starvation in Arabidopsis" potx

báo cáo khoa học: " The transcription factor PHR1 plays a key role in the regulation of sulfate shoot-to-root flux upon phosphate starvation in Arabidopsis" potx

... content and modified proteome suggesting metabolic adaptations to altered sulphate compartmentalization BMC Plant Biol 2010, 10:78. 18 Tomatsu H, Takano J, Takahashi H, Watanabe-Takahashi A, Shibagaki ... Kataoka T, Watanabe-Takahashi A, Hayashi N, Ohnishi M, Mimura T, Buchner P, Hawkesford MJ, Yamaya T, Takahashi H: Vacuolar sulfate transporters are essential determinants controlling internal distribution ... thaliana Plant J 2000, 23:171-182. 14 Kataoka T, Hayashi N, Yamaya T, Takahashi H: Root-to-shoot transport of sulfate in Arabidopsis Evidence for the role of SULTR3;5 as a component of low-affinity...

Ngày tải lên: 11/08/2014, 11:21

10 430 0
A systems biology approach to elucidating the frequency decoding mechanism governing differential mammalian gonadotropin subunit gene expression

A systems biology approach to elucidating the frequency decoding mechanism governing differential mammalian gonadotropin subunit gene expression

... notable consequences of calcium release into the cytoplasm and the activation of PKCs is the firing of the three major MAPK cascades, culminating in the activation of extracellular-signal regulated ... 1.1.1 The hypothalamic control of pituitary action The pituitary gland and the hypothalamus are both located within the cranial region ure 1.1) The pituitary gland is sometimes known as the ‘master ... crucial to gain a clear understanding of the molecular events that happen upon receptor activation,before a mechanism for GnRH frequency decoding can be purported 1.2.2.1 The GnRH receptor The mammalian...

Ngày tải lên: 11/09/2015, 09:11

233 260 0
The demographics of innovation why demographics is a key to the innovation race

The demographics of innovation why demographics is a key to the innovation race

... Policy Strategies of Small Countries Language Barrier and the English Advantage The Aging of the Japanese Economy The Lost Decades The Aging of Japanese Firms The Aging of Japanese Society Chapter ... Library of Congress Cataloging-in-Publication Data Names: Liang, James Jianzhang, author. Title: The demographics of innovation : why demographics is a key to the innovation race / James Jianzhang ... In addition to aging, the size of the population and the geographical concentration of the population also have a fundamental impact on innovation Large countries and cities, with easy access to...

Ngày tải lên: 17/01/2020, 13:52

259 82 0
The demographics of innovation why demographics is a key to the innovation race

The demographics of innovation why demographics is a key to the innovation race

... Policy Strategies of Small Countries Language Barrier and the English Advantage The Aging of the Japanese Economy The Lost Decades The Aging of Japanese Firms The Aging of Japanese Society Chapter ... Library of Congress Cataloging-in-Publication Data Names: Liang, James Jianzhang, author. Title: The demographics of innovation : why demographics is a key to the innovation race / James Jianzhang ... In addition to aging, the size of the population and the geographical concentration of the population also have a fundamental impact on innovation Large countries and cities, with easy access to...

Ngày tải lên: 20/01/2020, 13:58

259 49 0
The demographics of innovation why demographics is a key to the innovation race

The demographics of innovation why demographics is a key to the innovation race

... Policy Strategies of Small Countries Language Barrier and the English Advantage The Aging of the Japanese Economy The Lost Decades The Aging of Japanese Firms The Aging of Japanese Society Chapter ... Library of Congress Cataloging-in-Publication Data Names: Liang, James Jianzhang, author. Title: The demographics of innovation : why demographics is a key to the innovation race / James Jianzhang ... In addition to aging, the size of the population and the geographical concentration of the population also have a fundamental impact on innovation Large countries and cities, with easy access to...

Ngày tải lên: 02/03/2020, 15:29

259 102 0
u6 lesson plan english 7 week 11 unit 6 after school date period 32 lesson 1 a 1 1 objectives by the end of the lesson ss will be able to understand the details of the dialogue and tell what they do

u6 lesson plan english 7 week 11 unit 6 after school date period 32 lesson 1 a 1 1 objectives by the end of the lesson ss will be able to understand the details of the dialogue and tell what they do

... (a-d) groupwork( discuss & find the answers) Key: a Nga’s theater group is rehearsing a play for the school anniversary celebration. b Ba’s American friend, Liz, gives him a lot of American ... listen to music at Lan’s house Listen and answer True/ False 1 T 2 F 3 T 4 F 5 T _ T asks Ss to answer the questions in the textbook Key: a Nam wants to go to the movies. b Because there aren’t any ... Mai Trang 5Period 34 Lesson 3 A 3 – A 41 Objectives : By the end of the lesson, Ss will be able to understand the details of the text and talk about popular after-school activities 2 Language...

Ngày tải lên: 12/04/2021, 22:47

17 37 0
unit 6 nguyen manh nguyen lesson plans in grade 8 unit 6 lesson 1 a1 3 p 20 22 aim country vocabulary objectives reading a text about where thuy lives to understand the details and practise cout

unit 6 nguyen manh nguyen lesson plans in grade 8 unit 6 lesson 1 a1 3 p 20 22 aim country vocabulary objectives reading a text about where thuy lives to understand the details and practise cout

... Phong, Ba, Thu and ask some questions - Ask ss to answer - Who are they? - They are Phong and Ba -They are Thu and Phong - They are Ba and his parents - Ask ss to listen to the tape and order the ... - Ask some pairs to ask and answer 3 Post - reading: * Practice A2 on p 63 - Ask ss to look at the picture of A1 Ex: What are those? They are trees What' s that? It' s a rice paddy - Ask ss to ... doing? They' re waiting for a bus - Ask a pair to read the example - Ask ss to work in pairs - Ask some pairs to ask and answer 4 - Noughts and crosses: your mother/ cook the meal you/ sing a song...

Ngày tải lên: 19/04/2021, 23:14

21 15 0
A key to the species of keetia rubiaceae

A key to the species of keetia rubiaceae

... Madagascar (Stirton & Du Puy1992) Further coastal sand habitats in Africa with unique species are the sand forests of KwaZulu Natal (including Warneckea parvifolia R D Stone & Ntetha ... wind-blown sand Sand carried and deposited by the sea over aeons has formed almost continuous sandbars along the coast, resulting in narrow coastal lagoons between the linear sandbars and the more ragged ... leaf-blade, asymmetric base, abaxial surface; C domatia, abaxial surface; D adaxial surface of C; E node from reflexed spur shoot in A, showing stipule and axillary inflorescence buds; F post-anthetic...

Ngày tải lên: 02/01/2023, 11:49

15 3 0
Understanding Tuberculosis – Global Experiences and Innovative Approaches to the Diagnosis Edited by Pere-Joan Cardona potx

Understanding Tuberculosis – Global Experiences and Innovative Approaches to the Diagnosis Edited by Pere-Joan Cardona potx

... and Florence Masaisa Chapter Immunologic Diagnosis of Neurotuberculosis 147 Iacob Simona Alexandra, Banica Dorina, Iacob Diana Gabriela, Panaitescu Eugenia, Radu Irina and Cojocaru Manole Chapter ... Biosystems, Carlsbad, CA), which resulted in standardization of the assay across laboratories The MicroSeq 16S rDNA bacterial identification assay analyzes a larger portion of the 16S rDNA than the one ... Global Experiences and Innovative Approaches to the Diagnosis catalase activity at 22-25°C but not at 68°C (ie., heat-labile catalase) In addition to determining catalase activity at 68°C, the...

Ngày tải lên: 31/03/2014, 00:20

562 508 0
A study on cultural obstacles to the teaching and learning of speaking skills in the classroom of grade 10 at nguyen tat thanh high school

A study on cultural obstacles to the teaching and learning of speaking skills in the classroom of grade 10 at nguyen tat thanh high school

... culture Therefore, teaching culture has been integrated into language teaching programs and teaching materials in one way or another Many educators have applied these programs into real classroom activities ... teaching language is to prepare learners to be able to use the language They must be aware that speech maintains a higher position than other skills Martin Bygate (1987) says that speaking “is a medium ... learning is to be able to communicate in the language and use the language properly The capacity of making oneself understandable is thus taken into consideration Cultural knowledge offers a range...

Ngày tải lên: 07/09/2013, 13:00

38 1,2K 0
Tài liệu Material Usage and Condition of Existing Bridges in the U.S pptx

Tài liệu Material Usage and Condition of Existing Bridges in the U.S pptx

... Bridges Total State Alabama Alaska Arizona Arkansas California Colorado Connecticut Delaware Florida Georgia Hawaii Idaho Illinois Indiana Iowa Kansas Kentucky Louisiana Maine Maryland Massachusetts ... Total State Alabama Alaska Arizona Arkansas California Colorado Connecticut Delaware District Of Columbia Florida Georgia Hawaii Idaho Illinois Indiana Iowa Kansas Kentucky Louisiana Maine Maryland ... State Alabama Alaska Arizona Arkansas California Colorado Connecticut Delaware District Of Columbia Florida Georgia Hawaii Idaho Illinois Indiana Iowa Kansas Kentucky Louisiana Maine Maryland...

Ngày tải lên: 20/12/2013, 20:15

29 661 0
Tài liệu CONSUMER PREFERENCE AND CONSUMPTION OF ORGANIC PRODUCTS IN THE EASTERN CAPE PROVINCE OF SOUTH AFRICA docx

Tài liệu CONSUMER PREFERENCE AND CONSUMPTION OF ORGANIC PRODUCTS IN THE EASTERN CAPE PROVINCE OF SOUTH AFRICA docx

... are safe to consume/not contaminated They are affordable I had more income They are more accessible to the market They are good for the management of illness They are environmentally friendly There ... less than 5% of the consumers across the various study sites identifying some of the traditional food taboos On a comparative basis many food taboos seem to make no sense at all, as to what may be ... 2002) Traditional food taboos are a hindrance to choice variation and lifestyle choices available to consumers who subscribe to these taboos Traditional Food taboos identified in the Eastern Cape...

Ngày tải lên: 14/02/2014, 03:20

28 587 0
The impacts of introductions and stocking of exotic species in the Mekong Basin and policies for their control

The impacts of introductions and stocking of exotic species in the Mekong Basin and policies for their control

... systems the natural river fauna is unable to adapt to the new situation and fails to colonize the new waterbody In others, the original fauna may maintain itself by ascending inflowing tributaries to ... barrier, leading to a greater naturalization rate On the other hand, large species such as Clarias gariepinus and Labeo rohita should be equally vulnerable to the tendency to eliminate the larger ... countries of the basin for aquaculture and ornament from 1988 onwards Pomacea gigas b) Introduced into Thailand and has established in the wild Apple snails have a major impact on aquatic habitats, including...

Ngày tải lên: 14/03/2014, 08:48

60 465 0
Environmental Injustice and Human Rights Abuse: The States, MNCs, and Repression of Minority Groups in the World System pptx

Environmental Injustice and Human Rights Abuse: The States, MNCs, and Repression of Minority Groups in the World System pptx

... of Waste Generated (1000 tons) Africa Pacific East Asia South East Asia South Asia Middle East Latin America Total Australia Austria Belgium Canada Denmark Finland France Germany Italy Japan Luxembourg ... northern Saskatchewan, to tropical rain forests of the Amazon, to the remote state of Borneo in Malaysia, to sub-Saharan Africa and Southeast Asia, reveals that the exploitation of natural resources, ... Gaps 1995 Argentina Bangladesh Belize Brazil Colombia Costa Rica Dominican Republic EquatorialGuinea 23 10 51 34 Guatemala Indonesia Jamaica Mexico Morocco Namibia Nicaragua Nigeria Panama Papua...

Ngày tải lên: 15/03/2014, 23:20

21 689 0
Báo cáo khoa học: Separation and characterization of caveolae subclasses in the plasma membrane of primary adipocytes; segregation of specific proteins and functions docx

Báo cáo khoa học: Separation and characterization of caveolae subclasses in the plasma membrane of primary adipocytes; segregation of specific proteins and functions docx

... distinct classes of caveolae at the plasma membrane ) canonical caveolae that are open to the extracellular space and caveolae lacking access from the cell surface Closed caveolae have restricted access ... with the same relation to caveolin-1 as in the HD-caveolae and LD-caveolae; (c) the VHD-caveolae contained almost a third of the plasma membrane caveolin, and the majority of cellular caveolin ... 410–411 28 Tagawa A, Mezzacasa, a Hayer A, Longatti A, Pelkmans L & Helenius A (2005) Assembly and trafficking of caveolar domains in the cell: caveolae as stable, cargo-triggered vesicular transporters...

Ngày tải lên: 16/03/2014, 13:20

12 461 0
Báo cáo khoa học: Identification and characterization of important residues in the catalytic mechanism of CMP-Neu5Ac synthetase from Neisseria meningitidis potx

Báo cáo khoa học: Identification and characterization of important residues in the catalytic mechanism of CMP-Neu5Ac synthetase from Neisseria meningitidis potx

... the initial rate, Vmax is the maximal rate of the reaction at saturating substrate concentration and Km is the apparent Km for the variable substrate Effect of dithiothreitol addition The activity ... concentration were always linear The Q104E mutation caused the apparent Km for Neu5Ac to increase by twofold, but the other mutations caused at least a 100-fold increase Maintaining the length and hydrogen-bonding ... in saturating the enzyme with Neu5Ac and we resorted to measuring the apparent values of the kinetic parameters at fixed concentrations of the other substrate (Table 2; see above) Maintaining the...

Ngày tải lên: 22/03/2014, 21:21

12 464 0
w