a key ingredient in cosmetic and toiletry formulations

... PDIL2-1-F: CACACAAAGC CCTTGGCGAGAAAT, PDIL2-1-R: AATCCCTGCCACC GTCATAATCGT, clathrin adaptor (AT5G46630); CLAT-F: GAAACATGGTGGATGCAT; and CLAT-R: CTCAACAC CAAATTTGAATC Additional files Additional file ... biotic and abiotic stress in Arabidopsis thaliana Francisca Blanco-Herrera1, Adrián A Moreno1,2, Rodrigo Tapia1, Francisca Reyes1,2, Macarena Araya1, Cecilia D ’Alessio3,4 , Armando Parodi3and Ariel ... soybean agglutinin (SBA, a glycoprotein that contains mainly Man9GlcNAc2 oligosaccharides) as substrates, we found that ER-enriched fractions from Arabidopsis thaliana increased the in-corporation

Ngày tải lên: 26/05/2020, 21:22

... touches upon an analysis of one folk song using a music visualizer and natural language processing aiming at building an automate folk music pattern processor within a digital library archive system ... analysis and annotation‖ (Cannam and Queen Mary 2015), and similarly by Praat, ―a computer program with which you can analyze, synthesize, and manipulate speech, and create high-quality pictures‖ ... non-metrical By analyzing voices and instruments, a group of community organizers attempt to set up an initial guide for understanding and teaching Vietnamese folk music This involves searching for

Ngày tải lên: 18/03/2021, 08:10

... of actin isoforms In γ-actin siRNA-treated HMEC-1 cells, qualitative data revealed that the dense cortical actin mesh-work was partially depleted in γ-actin and the remaining γ-actin was mostly ... Alexander Macmillan3 and Maria Kavallaris1,4* Abstract Background: Angiogenesis plays a crucial role in development, wound healing as well as tumour growth and metastasis Although the general implication ... Trang 1R E S E A R C H Open Accessγ-Actin plays a key role in endothelial cell motility and neovessel maintenance Eddy Pasquier1,2, Maria-Pia Tuset1, Snega Sinnappan1,5, Michael Carnell3, Alexander

Ngày tải lên: 02/11/2022, 08:46

... simulating different residual variances in F and F Four situations were investigated, combining all combinations of non-normality in F and increased variance in F (table I) In general, 500 F and ... proposed when pure line and backcross data as well as F and Fdata are available, and when parental lines are homozygous for all loci (Elston and Stewart, 1973; Elston, 1984) Statistical properties ... contained 20 sires with 5 dams each and 10 offspring per dam; each situation was repeated 100 times Estimated parameters and resulting power are in table V Parameter estimates for t and d, and

Ngày tải lên: 14/08/2014, 20:20

... general and that of ICT product advertisements in particular Leech (1966) examines standard advertising language in his research “English in Advertising: A Linguistic Study of Advertising in ... categorized as coinage, anagrammatic spelling, and loanwords． Coinage New words or phrases created by means of imitation are not rarely seen in English ads Such newly-coined words and phrases may suggest ... beverage 1.2.2.2 Syntactical features As a special branch of language, advertising language should be concise and attractive simultaneously with certain syntactical characteristics This part

Ngày tải lên: 02/03/2015, 14:32

... family, and particularly the mother, in this relationship In addition, Kaminsky and Dewey (2001) found that the autism-sibling relationship is characterized by less intimacy and pro-social behavior ... original study!) as a result of this literature review. Trang 12Drafting: Pitfalls to Avoid Unprofessional language: Avoid the appearance of cheekiness or emotional appeal Don’t plagiarize! ... encounter research studies especially qualitative research studies that attempt to show causality. Trang 7Organizing & Outlining Organization is key to the construction of an effective literature

Ngày tải lên: 01/12/2016, 22:44

... consider training, education and development as crucial to their overall career growth and goal attainment and will be motivated to remain and build a career path in an organization that offers them ... from increasing commitment across all career stages Increasing commitment in the early career stage is important for decreasing turnover and in the mid- and late-career stages for reducing absenteeism ... fit), remuneration and rewards Training and career develop, challenging work and opportunities and organization commitment such as leadership, team work, organizational culture and policies,

Ngày tải lên: 01/04/2017, 17:09

... an ASAP article Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that ... molecular weight Aβ1-40 aggregates gives 88% of random coil and turn, 12% of β-strand and 0% of α-helix at pH 7.5, 295 K, and day 038 Trang 14another preparation of Aβ1-40 aggregates gives a β-strand ... than Aβ1-42 and their self-assembly rates have the same order of magnitude Taken together, both in silico and in vitro experiments have ascertained the importance of Ala42 in structures and aggregation

Ngày tải lên: 12/12/2017, 10:09

... designed to aim at pointing out the way to make invitations to a housewarming party and how to write a card, a letter of invitation to a housewarming party in English as a foreign language in Nam Duyen ... invitation cards and letters to a housewarming party in English and Vietnamese Data collection: the study was dealt with invitation cards and letters to a housewarming party in English and Vietnamese ... Chapter 3: SYNTACTIC, SEMANTIC AND CULTURAL FEATURES OF AN INVITATION CARD AND LETTER TO A HOUSEWARMING PARTY IN ENGLISH AND VIETNAMESE ……… 32 3.1 Syntactic, semantic and cultural features of invitation

Ngày tải lên: 14/01/2019, 00:10

... with some standard examples (a) Familiar from linear algebra and vector calculus is a parametrized line: Given points P and Trang 4(c) Now, if a, b > 0 and we apply the linear mapT : R2→ R2, ... if f and its partial derivatives ∂f ∂u and ∂f ∂v are all continuous We will ordinarily use(u, v) as coordinates in our parameter space, and (x, y, z) as coordinates in R3 Similarly, for any k≥ ... at a constant slope or pitch If the cylinder has radius a and the slope is b/a, we can imaginedrawing a line of that slope on a piece of paper 2πa units long, and then rolling the paper up into

Ngày tải lên: 08/03/2019, 13:08

... planktonic foraminifera including Marginotruncana coronata, Marginotrunca pseudolinneiana; Marginotruncana schneegansi, Muricohedbergella fl andrini; Dicarinella cf hangi-primitiva, Dicarinella ... Devonian-Cretaceous Santonian-ampanian Campanian Late Santonian Early T basement rocks Aptian - Albian Turonian Santonian -Campanian Campanian Köseli Section Late Coniacian - Early Campanian ... Dicarinella asymetrica, Dicarinella concavata, Globotruncanita stuartiformis, Muricohedbergella fl andrini, Globotruncanita cf elevata and radiolarians have been found indicating a Late Santonian

Ngày tải lên: 13/01/2020, 16:24

... designed to aim at pointing out the way to make invitations to a housewarming party and how to write a card, a letter of invitation to a housewarming party in English as a foreign language in Nam Duyen ... invitation cards and letters to a housewarming party in English and Vietnamese Data collection: the study was dealt with invitation cards and letters to a housewarming party in English and Vietnamese ... Chapter 3: SYNTACTIC, SEMANTIC AND CULTURAL FEATURES OF AN INVITATION CARD AND LETTER TO A HOUSEWARMING PARTY IN ENGLISH AND VIETNAMESE ……… 32 3.1 Syntactic, semantic and cultural features of invitation

Ngày tải lên: 25/04/2020, 09:22

... formation of traumatic resin ducts…) ([15,16] in Picea; [17] in Picea and Larix; [18,19] in Picea, Abies and Larix; [20,21] in Pinus pinaster; [22] in Pseudotsuga, Larix and Pinus ponderosa) Very ... no-ticeable increase in the formation of axial parenchyma and resin ducts in tangential rows in the healing tissues and sur-rounding the wound (appreciable in Figures 4 and 5), espe-cially above ... regener-ation capacity, such as those adapted to volcanic envi-ronments [28] In this work we analyze the anatomical healing in Pinus canariensis This pine, with a compara-tively abundant xylem parenchyma,

Ngày tải lên: 26/05/2020, 23:54

... Metro Paediatric inpatient ward Zealand Regional Mixed adult/ paediatric ED Zealand Regional Paediatric inpatient ward New Zealand n = 14 ward paediatric ED 4 Australia Regional Paediatric inpatient ... departments and paediatric inpatient areas across Australia and New Zealand exploring current practice, and factors that influence this, based on the Theoretical Domains Framework Interview transcripts ... therapies and management processes are ineffective and associated with harm, variation in practice continues In Australia and New Zealand, data from over 3000 presentations to seven hospitals

Ngày tải lên: 29/05/2020, 18:57

... De Angelis3, Chiara Panato2, Carlotta Buzzoni4,5, Riccardo Capocaccia6, Silvia Francisci3, Anna Gigli7, Manuel Zorzi1, Giovanna Tagliabue8, Diego Serraino2, Fabio Falcini9, Claudia Casella10, Antonio ... Mazzoleni21, Fabio Pannozzo22, Rosario Tumino23, Mario Fusco24, Paolo Ricci25, Gemma Gola26, Adriano Giacomin27ˆ, Francesco Tisano28 , Giuseppa Candela29, Anna Clara Fanetti30, Filomena Pala31, ... Antonio Giampiero Russo11, Fabrizio Stracci12, Bianca Caruso13, Maria Michiara14, Anna Luisa Caiazzo15, Marine Castaing16, Stefano Ferretti17, Lucia Mangone18, Giuseppa Rudisi19, Flavio Sensi20,

Ngày tải lên: 23/07/2020, 02:31

... experiments in the laboratory, in a pilot plant and in mills Many properties of wood and fibers are being measured at several levels of detail The arsenal of measurement techniques available today for ... Wood disc and the total widths and latewood band widths of all annual rings in two directions In this case, limits for juvenile, young mature and mature wood have been set at rings 15 and 30 respectively ... definitely not lead to an increase in this proportion NATURAL VARIABILITY The natural variability has to be established as a basis for judging whether or not new trees are better than existing...

Ngày tải lên: 08/08/2014, 14:20

... primer and probe ⁄ 3fw TGGCCAGATCTAAAAAAGAGGT 2fw ATCCCAGGAAACACCAGTAGA 10rev ATTGTTTTCTCTCAAGACCCAA TaqMan probe T1 ACACCACAGCAAGGGAGAAGCAAAG 18Sfw CGCCGCTAGAGGTGAAATTC 18Srev TCTTGGCAAATGCTTTCGCT ... using the QuickChange kit (Stratagene, La Jolla, CA, USA) Mutagenic primers were: 5¢-CGCTCGAGA TGAAAATTGACATCGCTAGTCATATTCTACC-3¢ and its complement for His6Ala; 5¢-GACATCCATAGTGCT ATTCTACCAAAAGAATGGCC-3¢ ... fw, forward; rev, reverse A B Sequence ACMSD cloning: primer 1fw CGCTCGAGATGAAAATTGACATCCATA GTCAT 11rev AAAGCTGAGCTCCATTCAAATTGTTTT CTCTCAAG 4fw TTCTCGAGATGGGAAAGTCTTCAGAGT GGT ACMSD real-time...

Ngày tải lên: 19/02/2014, 02:20

... the Soret and 498 nm bands and the shift of the band at 630 nm to the longer-wavelength direction At the same time, a broad band with the maximum at approximately 690 nm appears and increases with ... SpeI and SacI; Oligo IV and Oligo V, between SacI and AvrII; Oligo VI, between AvrII and ClaI; Oligo VII and VIII, between ClaI and MluI; Oligo IX, between MluI and HindIII Escherichia coli strain ... Soret band at 410 nm and to the increases of broad band spreading 600–700 nm The latter band was confirmed to belong to biliverdin IXa by the HPLC analysis (data not shown) Discussion Overall structure...

Ngày tải lên: 23/03/2014, 20:22

... to sing Key words or phrases for main and secondary ideas from Kusa-Hibari main secondary paragraph paragraph paragraph paragraph paragraph Below you will find sample key words and phrases from ... Outlining On page 109 is a Mind Map summarising a three-day Brain Training and Mind Mapping Course The Mind Map was made by a father who was also a company director He used the same Mind Map to ... other, that these are presented in lines and that we therefore write and note in lines, such linear presentation is not necessary for understanding, and in many instances is a disadvantage The mind...

Ngày tải lên: 09/08/2013, 11:51

... relationship between semantics and pragmatics and covers some of the basic techniques and key concepts involved in studying and analyzing pragmatic meaning narrowest interpretation of pragmatics ... English as an international language in this century, there are a great number of the Vietnamese people who learn and speak English In fact, in learning English as a foreign language, the Vietnamese ... plan, saying sorry, attending summer holiday situations Meanwhile, VNS used greater number of strategies in interview preparation and familiar situations than in the familiar situations whereas...

Ngày tải lên: 26/11/2013, 13:31