Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx

Through an isoform-specific real-time PCR assay, the constitutive expression of two alternatively spliced ACMSD transcripts ACMSD I and II has been examined in human brain, liver and kidn

of human 2-amino 3-carboxymuconate 6-semialdehyde

decarboxylase, a key enzyme in tryptophan catabolism

Lisa Pucci*, Silvia Perozzi*, Flavio Cimadamore, Giuseppe Orsomando and Nadia Raffaelli

Istituto di Biotecnologie Biochimiche, Universita` Politecnica delle Marche, Ancona, Italy

In mammals, tryptophan exceeding basal requirement

for protein and serotonin synthesis, is oxidized via

indole-ring cleavage through the kynurenine pathway,

consisting of several enzymatic reactions leading to

2-amino 3-carboxymuconate 6-semialdehyde (ACMS)

(Fig 1) [1,2] ACMS can be decarboxylated to

2-aminomuconate 6-semialdehyde (AMS) by the

enzyme ACMS decarboxylase (ACMSD, EC 4.1.1.45),

or it can undergo spontaneous pyridine ring closure to

form quinolinate, an essential precursor for de novo

NAD synthesis AMS can be routed to the citric

acid cycle via the glutarate pathway, or converted nonenzymatically to picolinate By catalyzing ACMS decarboxylation, ACMSD thus diverts ACMS from NAD synthesis, channeling tryptophan towards complete oxidation or conversion to picolinate

By determining picolinate and quinolinate forma-tion, ACMSD directly participates in the cellular pro-cesses regulated by these molecules Quinolinate is a neurotoxic tryptophan metabolite, whose action has been ascribed to N-methyl-D-aspartate receptors activation and to its ability to generate free radicals

Keywords

ACMSD; NAD biosynthesis; picolinate;

quinolinate; tryptophan catabolism

Correspondence

N Raffaelli, Istituto di Biotecnologie

Biochimiche, Universita` Politecnica delle

Marche, Via Ranieri, 60131 Ancona, Italy

Fax: +39 712204677

Tel: +39 712204682

E-mail: n.raffaelli@univpm.it

*These authors contributed equally to this

paper

(Received 16 November 2006, accepted

6 December 2006)

doi:10.1111/j.1742-4658.2007.05635.x

2-Amino 3-carboxymuconate 6-semialdehyde decarboxylase (ACMSD, EC 4.1.1.45) plays a key role in tryptophan catabolism By diverting 2-amino 3-carboxymuconate semialdehyde from quinolinate production, the enzyme regulates NAD biosynthesis from the amino acid, directly affecting quinoli-nate and picoliquinoli-nate formation ACMSD is therefore an attractive therapeu-tic target for treating disorders associated with increased levels of tryptophan metabolites Through an isoform-specific real-time PCR assay, the constitutive expression of two alternatively spliced ACMSD transcripts (ACMSD I and II) has been examined in human brain, liver and kidney Both transcripts are present in kidney and liver, with highest expression occurring in kidney In brain, no ACMSD II expression is detected, and ACMSD Iis present at very low levels Cloning of the two cDNAs in yeast expression vectors and production of the recombinant proteins, revealed that only ACMSD I is endowed with enzymatic activity After purification

to homogeneity, this enzyme was found to be a monomer, with a broad

pH optimum ranging from 6.5 to 8.0, a Kmof 6.5 lm, and a kcatof 1.0 s)1 ACMSD I is inhibited by quinolinic acid, picolinic acid and kynurenic acid, and it is activated slightly by Fe2+ and Co2+ Site-directed mutagen-esis experiments confirmed the catalytic role of residues, conserved in all ACMSDs so far characterized, which in the bacterial enzyme participate directly in the metallocofactor binding Even so, the properties of the human enzyme differ significantly from those reported for the bacterial counterpart, suggesting that the metallocofactor is buried deep within the protein and not as accessible as it is in bacterial ACMSD

Abbreviations

ACMS, 2-amino 3-carboxymuconate 6-semialdehyde; ACMSD, ACMS decarboxylase; AMS, 2-aminomuconate 6-semialdehyde.

[3,4] This neurotoxicity might play an important role

in the pathogenesis of major neurodegenerative and

convulsive disorders In particular, many of the

distinct neuropathological features of Huntington’s

disease are duplicated in experimental animals by

intrastriatal quinolinate injection [5,6] In addition, a

significant elevation of quinolinate levels has been

observed in low-grade Huntington’s disease brains,

suggesting that the molecule might participate in the

initial phases of the neurodegenerative process [7]

Moreover, a role of quinolinate in the pathogenesis

of AIDS–dementia complex, as well as Alzheimer’s

disease, has been very recently proposed [8,9] In turn,

picolinate exhibits important immunomodulatory

properties, involving activation of macrophage

tumori-cidal, microbicidal and proinflammatory functions [10– 12] This metabolite also stimulates apoptosis in var-ious transformed cell lines, and efficiently interrupts the progress of human HIV-1 in vitro [13,14] Although the physiological relevance of picolinate formation

in vivo is not known, it has been detected in human milk, pancreatic juice, intestine and in the serum of patients with degenerative liver diseases [15–17] In addition, high levels have been measured in the cerebrospinal fluid of children with cerebral malaria and in the brain of a murine model of the syndrome [18,19] Interestingly, picolinate is reportedly able to prevent the neurotoxic effects of quinolinate in the rat central nervous system, suggesting that a highly regula-ted production of these metabolites is required for

Fig 1 Schematic overview of tryptophan catabolism through the kynurenine pathway.

normal neuronal function [20] Such considerations

indicate that ACMS decarboxylation is a key

meta-bolic control step and that the enzyme catalyzing this

reaction is likely to be a drug target [21]

Mammalian ACMSD has been purified and

charac-terized from cat, hog and rat [22–24], where it is

present only in kidney, brain and liver Several studies

have demonstrated that in rats, nutritional factors and

hormones affect both gene expression and enzymatic

activity In particular, the enzyme is down-regulated

by dietary polyunsaturated fatty acids, phthalate esters

and peroxisome proliferators, like clofibrate, whereas it

is up-regulated in rats fed a high protein diet [25–28]

mRNA expression and enzymatic activity are elevated

in the liver of streptozotocin-induced diabetic rats, and

insulin injection suppresses such elevation [29] These

studies clearly demonstrated that changes in ACMSD

activity are readily reflected by serum and tissue

quino-linate levels and in the rate of tryptophan-to-NAD

conversion Rat liver ACMSD gene expression is

regu-lated by the two transcriptional factors: hepatocyte

nuclear factor 4a (HNF4a) and peroxisome

prolifera-tor-activated receptor a (PPRa); the former activates

ACMSD expression directly by site-specific binding

to the promoter, and the latter represses ACMSD

expression indirectly through suppression of HNF4a

expression [30]

The presence of ACMSD has been recently

demon-strated in bacteria species that fully catabolize

trypto-phan or 2-nitrobenzoic acid [31,32] The biochemical

and structural characterization of Pseudomonas

fluores-cens ACMSD revealed that the enzyme is

metal-dependent and catalyzes a novel type of nonoxidative

decarboxylation [21,33–35]

The human gene has been identified upon expression

in COS7 cells of a cDNA from a brain library,

enco-ding the human homologue of the rat protein [36]

Recently, a cDNA sequence from a liver library,

deri-ving from alternative splicing of the gene, has been

deposited in GenBank In this study, we have

demon-strated the constitutive expression in human organs of

the two alternatively spliced ACMSD transcripts The

corresponding cDNAs have been cloned in yeast

expression vectors, allowing for the first time the

puri-fication and biochemical characterization of human

ACMSD

Results

Cloning of ACMSD transcripts

The complete coding sequence of human ACMSD

was obtained from reverse-transcribed human kidney

RNA, by using the primers pair 1fw⁄ 11rev, encompas-sing the ACMSD open reading frame (GenBank acces-sion number Q8TDX5-1) (Fig 2A; Table 1) Agarose gel electrophoresis of the PCR product indicated the presence of two distinct bands between 1000 and

1100 bp of roughly the same extent (not shown) Clo-ning and nucleotide sequencing of these two products indicated that the lower band (1011 bp) corresponded

to the expected cDNA (here named ACMSD I), while the higher band (1068 bp) corresponded to the cDNA currently in GenBank under accession number AAH16018 (here named ACMSD II) ACMSD II cod-ing sequence was obtained by uscod-ing the primers pair 4fw⁄ 11 rev (Fig 2A) Again, two distinct PCR prod-ucts were obtained, the longer (887 bp) corresponding

to part of the ACMSD I cDNA, the shorter (837 bp) representing ACMSD II open reading frame (not shown) The two transcripts are produced by alternat-ive splicing of exons 2 and 5 of the ACMSD gene (Fig 2A); the presence of exon 2 in ACMSD II causes

a shift in the open reading frame, resulting in the occurrence of the first available start codon in exon 4 This, together with the absence of exon 5, gives rise to

a ACMSD II protein, which differs from ACMSD I at the N-terminus (Fig 2B)

Expression of ACMSD variants in Escherichia coli and Pichia pastoris

ACMSD Iand II cDNAs were subcloned into pET15b and pET32b E coli expression vectors, providing the recombinant proteins with a N-terminal His6-tag, and

a thioredoxin-tag, respectively In both cases, proteins were expressed as inclusion bodies (not shown) Any effort to obtain soluble recombinant proteins, inclu-ding lower growth temperatures (18C) and isopropyl b-D-1-thiogalactopyranoside concentrations (down to 0.1 mm), as well as inclusion of various metal ions in the growth medium during induction, were unsuccess-ful Expression in the methylotrophic yeast P pastoris was performed both via secretion and intracellularly,

as described in Experimental procedures Both isoforms were secreted by yeast cells transformed with the pPIC9 recombinant plasmids (Fig 3); however, when ACMSD activity was assayed in the culture media, the enzymatic activity was only detected in media containing isoform I Both isoforms were also expressed intracellularly, as evidenced by the appearance of protein bands of the expected size upon SDS⁄ PAGE analysis of the crude extracts prepared after 3 days methanol induction (not shown) Again, only isoform I was endowed with enzymatic activity

In light of the recent findings that P fluorescens

ACMSD requires a metal-ion cofactor and is able to

take up the metal from the expressing host during

protein synthesis [21,33], we investigated whether the

production of the human recombinant isoforms might

be enhanced by the presence of metal ions in the growth medium We found that addition of 200 lm to

1 mm CoCl2 during methanol induction did not result

in a significant increase of ACMSD I specific activity, and no activity was detected in the extracts prepared from cells expressing the other isoform

A

B

Fig 2 Alternative splicing of human ACMSD gene (A, upper panel) Genomic structure of the ACMSD gene with the alternative splicing pat-terns Exons are indicated by boxes and introns by connecting lines The approximate locations of the oligonucleotide primers used in the preparation of the cDNAs are shown by bold arrows (see Table 1 for sequences) (A, lower panel) Representation of full length ACMSD I and ACMSD II mRNAs Open reading frames are underlined and the localization of the primers pairs and probes used for real-time PCR assays is also showed (see Table 1 for sequences) (B) Alignment of the not conserved N-terminal regions of the two isoforms Alignment was carried out using the CLUSTALW program Fully conserved and similar residues are indicated by asterisks and colon, respectively.

Table 1 Oligonucleotide primer sequences fw, forward; rev,

reverse.

Sequence ACMSD cloning: primer

GTCAT

CTCTCAAG

GGT ACMSD real-time PCR: primer and probe

TaqMan probe T1 ACACCACAGCAAGGGAGAAGCAAAG

TaqMan probe 18S TGGACCGGCGCAAGACGGAC

Fig 3 ACMSD I and ACMSD II extracellular expression Tricine SDS ⁄ PAGE of the culture filtrates of the best expressing clones obtained by transformation of P pastoris GS115 cells with pPIC9-ACMSD I (A) and pPIC9-pPIC9-ACMSD II (B) Culture filtrates were ana-lyzed after 104 h (lane a) and 128 h (lane b) methanol induction Arrows indicate the recombinant isoforms Lane M, molecular mass standards.

Quantitation of ACMSD variants in liver, kidney

and brain

An isoform-specific real-time PCR assay was performed

to analyze the expression pattern of the two transcripts

in brain, kidney and liver A hybridization probe

over-lapping exon 3 and exon 4 was designed (T1), which is

able to anneal to both variants (Fig 2A) Specific

ampli-fication was achieved by using the same reverse primer

(10rev), located in exon 10, with 1⁄ 3fw primer, spanning

the boundaries of exons 1 and 3, for ACMSD I, and

2fw, located in exon 2, for ACMSD II To assess the

specificity of the assay, linearized pGEM plasmids

har-boring the two cDNAs were used as templates in control

real-time PCR experiments Each isoform was subjected

to amplification with the specific primer⁄ probe set in the

presence of increasing molar amounts of the other

iso-form (1 : 1, 1 : 1000 and 1 : 10 000) Detection of

ACMSD Iwas not influenced by the presence of up to

10 000-fold molar excess of ACMSD II and the same result was obtained when detection of ACMSD II was performed in the presence of ACMSD I The expression levels of ACMSD alternative transcripts in the organs

we have examined are reported in Fig 4 ACMSD I transcript was present in all tested organs, with an expression ratio of 1300 : 30 : 1 in kidney, liver and brain, respectively Interestingly, ACMSD II was not detected in brain, while no significant difference in the relative expression of the two isoforms within kidney and liver was observed

ACMSD I purification and characterization Recombinant human ACMSD I was purified to homo-geneity from P pastoris cells transformed with the pHIL-D2-ACMSD I plasmid, by the purification proce-dure described in Experimental proceproce-dures and sum-marized in Table 2 The final preparation was stable for several weeks when stored at 4C, whereas the purified protein was sensitive to freezing at both )20 C and )80 C SDS ⁄ PAGE of the pure protein revealed a molecular mass of about 40 kDa, as expected for the recombinant enzyme (Fig 5) Gel filtration experiments showed a native molecular mass of about 50 kDa, indi-cating that the enzyme might exist as a monomer in solution (not shown) ACMSD I had an optimum pH ranging from 6.5 to 8.0 (Fig 6) The activity was signifi-cantly affected by the concentrations of the buffers used

at pH values below 6.5, being markedly lower in the presence of 50 mm buffers, rather than 5 mm at the same pH values (Fig 6) As shown in Table 3, the pure enzyme was fully active in the absence of metal ions, being slightly activated by Co2+ and Fe2+, whereas

Zn2+, Cd2+Cr3+and Fe3+strongly reduced the enzy-matic activity Human ACMSD I exhibited a linear kin-etic behavior, with Km for ACMS of 6.5 lm, Vmax of 0.105 mm s)1and kcatof 1.0 s)1(Fig 7)

To identify possible enzyme modulators, we exam-ined the effect of several NAD biosynthetic pathway intermediates on the human enzyme activity We found that NAD, nicotinate adenine dinucleotide,

nicotina-Fig 4 Quantitation of ACMSD variants by real-time PCR Tissues

RNA was reverse-transcribed and ACMSD variants were

quantita-ted as described in Experimental procedures, using the

prim-ers⁄ probe sets reported in Table 1 Data are the mean of three

independent experiments and are presented as copies of the target

variant per 10 9 copies of 18S RNA.

Table 2 Purification of recombinant human ACMSD I.

Step

Total protein a

(mg)

Total activity b

(units)

Specific activity (unitsÆmg)1)

Yield (%)

Purification (-fold)

a Starting from 400 mL yeast culture b The enzymatic activity was assayed spectrophotometrically, as reported in the Experimental proce-dures.

mide, nicotinic acid, nicotinamide mononucleotide,

nicotinate mononucleotide, tryptophan (present at

1 mm concentration in the reaction mixture), and

l-kynurenine and 3-hydroxykynurenine (present at

0.1 mm concentration) were without effect On the

other hand, a significant inhibition was exerted by

quinolinic acid, picolinic acid and kynurenic acid, as

shown in Table 4

Bacterial and human ACMSD share a high sequence

identity, particularly with respect to the residues (i.e

His9, His11, His177 and Asp294) known to be

involved in metal binding in P fluorescens ACMSD

(Fig 8) To confirm that these residues are essential

for the human enzyme activity, we performed

site-directed mutagenesis experiments on human ACMSD I

to replace His6 and His8 individually with alanine Mutated proteins were expressed in P pastoris cells at

a level comparable with that of the wild-type enzyme

Fig 5 Purification of recombinant human ACMSD I Tricine

SDS ⁄ PAGE of fractions throughout the purification procedure:

crude extract (lane a), hydroxyhapatite (lane b), MonoQ (lane c).

Lane M, molecular mass standards.

Fig 6 Effect of pH on ACMSD I activity The enzymatic activity

was measured at different pH values in 50 m M (h) and 5 m M (j)

sodium succinate, 50 m M (s) and 5 m M (d) Mes, 50 m M

4-morph-olinepropanesulfonic acid (m), 50 m M Hepes (r) and 50 m M

Tris ⁄ HCl (e) buffers Activity was determined as described in

Experimental procedures.

Table 3 Influence of metal ions on human ACMSD I activity.

Metal ion

Concentration (m M )

Relative activity (%)

Fig 7 Lineweaver )Burk analysis of ACMSD I The reciprocal of the initial velocities was plotted against the reciprocal of ACMS concentrations Data are the means of three independent determi-nations.

Table 4 Influence of tryptophan catabolites on human ACMSD I activity.

Compound

Concentration (m M )

Relative activity (%)

(not shown) and, as expected, exhibited a significantly

lower catalytic activity In particular, the activity

decreased by about 82% and 50% for His6Ala and

His8Ala, respectively, indicating that the mutated

resi-dues are critical for catalysis The human enzyme is

active in the absence of added metal-ions in the

reac-tion mixture, suggesting that it might be able to take

up the metal from the expressing host during protein

synthesis This property was previously demonstrated

for bacterial ACMSD, however, while the bacterial

enzyme can be obtained in the inactive, metal-free

form upon incubation with 5 mm EDTA for 12 h at

4C [21,33], human ACMSD retained full activity in the same conditions Incubations at EDTA concentra-tions higher than 10 mm (i.e 20 mm and 50 mm) only resulted in 50% loss of the decarboxylase activity Moreover, unlike the P fluorescens ACMSD apopro-tein, which can be successfully reconstituted [21,33], catalytic activity of the human enzyme was not regained upon removal of EDTA and addition of metal-ions

Figure 9 shows the hydrophobicity profiles of human and P fluorescens ACMSD, performed accord-ing to Kyte and Doolittle [37] By comparaccord-ing the mean

Fig 8 Alignment between human (Hs) and

P fluorescens (Psf) ACMSD Residues

involved in metal binding in the bacterial

enzyme are highlighted in shaded boxes.

Residues subjected to mutational analysis in

the human enzyme are indicated by #.

A

B

Fig 9 Hydrophobicity profiles of human (A)

and P fluorescens (B) ACMSD The profiles

were computed according to Kyte and

Doo-little [37], using a window size of 7, suitable

for discriminating between buried and

sur-face exposed regions Residues involved in

catalysis in the bacterial enzyme and the

corresponding amino acids in the human

protein are pointed with arrows The mean

hydrophobicity values of residues within the

window centered on the pointed amino

acids are reported in brackets.

hydrophobic index of the residues within the window

centered on amino acids involved in metal binding, it

can be noticed that regions around His6 and His8 in

the human protein are predicted to be more

hydropho-bic than the corresponding regions in the bacterial

enzyme Likewise Arg47, whose corresponding residue

in P fluorescens ACMSD (Arg51) is essential for

cata-lysis and it has been hypothesized to directly

partici-pate in substrate binding [34], is located in a more

hydrophobic region in human ACMSD

Pseudomonas fluorescens ACMSD crystallographic structures have been used as the templates for the pre-diction of the human enzyme structure based on homology modeling As shown in Fig 10, the overall architecture of the human enzyme model is very sim-ilar to that of its bacterial counterpart In particular, the root-mean-squared deviations values calculated between the superimposed backbones of the human enzyme model and the crystallographic templates are all below 1 A˚ The residues that directly coordinate to

A

B

C

Fig 10 Homology modeling of human ACMSD I Prediction of the human enzyme structure (right) was made on the base of the crystal structure analysis of P fluorescens ACMSD (left), as described in Experimental procedures (A) Ribbon diagram of the two structures The arginine residue probably involved in substrate binding is marked by an asterisk, and the residues ligated to the metal ion cofactor (orange sphere) are shown in ball-and-stick representation (B) metal coordination centers (C) Molecular surface models Hydrophobic and polar resi-dues are colored in blue and gray, respectively.

the metal cofactor in the bacterial protein are

con-served in the human model (Fig 10B) The molecular

surface model of both proteins, shown in Fig 10C,

confirm the higher hydrophobicity in human ACMSD

of the region surrounding the metal active site and the

Arg47 likely involved in substrate binding

Discussion

In this study, the expression of the human ACMSD

transcript coding for the active enzyme has been

exam-ined in kidney, liver and brain The tissue distribution

of the transcript closely resembles that of mouse

ACMSDmRNA [36] The highest expression has been

observed in kidney, suggesting that the

tryptophan-NAD pathway might not be the preferred route of

tryptophan utilization in this organ Indeed, in kidney

the kynurenine pathway is mostly used to convert

tryptophan catabolites, including kynurenine and

hydroxykinurenine taken up from the blood, to a

series of metabolites which are then excreted [38] The

presence of ACMSD suggests that tryptophan

catabo-lites might also be channeled into the glutarate

path-way towards complete oxidation High levels of the

enzyme might prevent excessive formation and

accu-mulation of quinolinate Indeed experiments performed

on patients with renal insufficiency, as well as on rats

with induced renal failure, showed a decrease of

kidney ACMSD activity and significant elevation of

quinolinate in serum, urine, cerebrospinal fluid and

peripheral tissues [38–41] On the other hand, we

found significantly lower levels of human ACMSD

expression in liver and in brain than that observed in

kidney, suggesting that in the former organs the

tryp-tophan–NAD conversion might represent a relevant

pathway Indeed, most of the intracellular NAD in

liver is synthesized from the amino acid rather than

from dietary niacin and the formed dinucleotide is the

main vitamin source for extrahepatic tissues [42]

Like-wise, maintenance of brain NAD levels is of extreme

importance, because NAD depletion is linked to

neur-onal damage Recent reports have demonstrated that

reversal of NAD depletion can profoundly decrease

is-chemic brain damage and stimulation of NAD

biosyn-thetic pathways prevents or delays axonal degeneration

[43,44] The observed low levels of liver and brain

ACMSD would allow tryptophan to be channeled

towards NAD formation, thus guaranteeing adequate

NAD supply

Our work defines a reliable procedure for the

expres-sion and purification of the active recombinant

ACMSD in good yield The purification method

differs from that reported for other mammalian

ACMSDs, due to the rapid inactivation of the human enzyme both in the absence of salts and in the presence

of high ionic strength (i.e NaCl or sulfate ammonium concentrations higher than 0.3 and 0.4 m, respectively) The subunit and native molecular weight values are comparable with those reported for all ACMSDs so far characterized, including the bacterial protein [23,24,34], and are consistent with the lack of a quater-nary structure In contrast with the rat enzyme, which

is mostly active at pH 6.0 [24], human ACMSD displays a broad pH optimum, ranging from

pH 6.5–8.0 Like all ACMSDs [22–24,34], the human enzyme exhibits a very low micromolar-range Km for ACMS However, it shows a specific activity six times lower than that reported for the rat enzyme and a kcat value that is about 6.5 times lower than that calculated for the bacterial counterpart [24,34] The enzymatic activity is not significantly affected by the intermedi-ates of the NAD biosynthetic pathways Given that the high concentrations required for inhibition by quinolinic acid, picolinic acid and kynurenic acid are far from the physiopathological levels of the trypto-phan metabolites [8], these effects are unlikely to be of physiological significance However, it may be worth noting that the three inhibitory compounds share a COOH group on the C-2 of the pyridine ring This feature seems to be essential for ACMSD inhibition, since nicotinic acid, which differs from picolinic acid only in the position of the COOH group, was ineffective

Very recently, the structural characterization of

P fluorescens ACMSD has demonstrated that the bacterial enzyme requires a transition metal ion as co-factor (i.e Zn2+), thus representing a novel member

of the metal-dependent amidohydrolase superfamily [21,34] Members of this superfamily employ a great variety of divalent metal ligands for catalysis and share a conserved metal binding site, suggesting com-mon aspects in their catalytic mechanism [21] From the sequence alignment of human and bacterial AC-MSD and the comparison of their three-dimensional structures, the presence of the metallocofactor in the human enzyme can be reliably predicted Indeed, in the present work, the essentiality in the human enzyme-catalyzed reaction of residues involved in metal binding in P fluorescens ACMSD has been confirmed by site-directed mutagenesis As expected, replacement of His6 and His8 with alanine in human ACMSD I resulted in a significant reduction of the decarboxylase activity Accordingly, ACMSD II iso-form, which differs from ACMSD I in the first 24 residues at the N-terminus and lacks the two mutated histidines, is enzymatically inactive In contrast to

what observed for the bacterial enzyme, however,

human recombinant ACMSD specific activity was not

increased by the presence of divalent metal ions in

the growth medium, during protein expression In

addition, EDTA concentrations higher than those

used for the preparation of the bacterial apoprotein

were required to obtain a significant inactivation of

the human enzyme, and we were not able to

recon-stitute the activity by using the treatment that

suc-cessfully restored the bacterial protein [21,33]

Interestingly, the same difficulty in stripping off the

metallocofactor from the protein has been described

for murine adenosine deaminase, a member of the

amidohydrolase superfamily, which uses Zn2+ as

co-factor and shares with ACMSD the same metal

cen-ter configuration [34,45] The metal was inaccessible

to chelators, and was not exchanged with solvent to

any appreciable extent at neutral pH [45] Authors

also reported a competitive inhibition by Zn2+ with

respect to the substrate (Ki 7 lm), suggesting that the

cation might bind elsewhere within the enzyme active

site and block adenosine binding [45] Accordingly,

we found that 0.1 mm Zn2+ exerts a strong inhibitory

effect on human ACMSD The presence of the

metal-locofactor in human ACMSD might also be inferred

by our study on the enzyme pH dependence, showing

that the increase of the concentrations of succinate

and 4-morpholineethanesulfonic acid buffers at pH

values below 6.5 significantly reduced the activity It

can be hypothesized that these salts might chelate the

metal and efficiently remove it from the protein at

acidic pH

Both the different sensitivity to EDTA, and the

lower kcat value exhibited by the human protein with

respect to the bacterial counterpart suggest that the

active site is very well buried within the human

pro-tein, not so easily accessible as it is in the bacterial

enzyme This conclusion is validated by the

compar-ison of both the hydrophobicity profiles and the

three-dimensional structures of human and bacterial

ACMSD, demonstrating that the region surrounding

residues involved in catalysis is more hydrophobic in

the human, rather than in the bacterial protein

Finally, this study demonstrated the expression in

kidney and liver of an alternatively spliced ACMSD

transcript coding for a protein which differs from the

other variant in the N-terminal region and carries an

incomplete metal binding domain In particular, in

this variant only two out of four residues which are

directly involved in the metal cofactor binding are

present Consistent with this structural deficiency is

our finding that ACMSD II is catalytically inactive

when overexpressed as recombinant protein

Inspec-tion of the residues which in ACMSD I mark the boundary of the predicted substrate-binding pocket, reveals that some of them are conserved in the inac-tive isoform (i.e Trp191 and Phe294) Even though the precise role of these active site residues has not been established, the possibility that ACMSD II might still be able to bind the substrate cannot be definitively ruled out If this would be the case, the metabolic relevance of the inactive isoform would be related to its capability of binding and sequestering a reactive intermediate like ACMS

The results we have presented represent the first bio-chemical report on human ACMSD They may be instrumental in promoting the structural analysis of the protein, particularly with respect to developing therapeutic leads for treating disorders associated with increased levels of quinolinate and⁄ or picolinate

Experimental procedures

PCR amplification and cloning of ACMSD isoforms

Human brain, liver and kidney total RNA (Clontech Laboratories, Inc., Mountain View, CA, USA) was reverse transcribed in the presence of random primers, by using the First Strand cDNA Synthesis kit (Biotech Department Bio Basic Inc., Markham, Ontario, Canada) Transcripts enco-ding for the two splice variants were amplified by polym-erase chain reaction (PCR) using specific primers, and kidney cDNA as the template PCR conditions were as fol-lows: 1 min at 94C; 30 s at 94 C, 30 s at 55 C, 1 min at

72C for 30 cycles; 10 min at 72 C The reaction was per-formed in the presence of 0.5 pmolÆlL)1 of each primer,

200 lm dNTPs, 1 mm MgCl2 and 0.025 unitsÆlL)1 Taq polymerase (Finnzymes, Espoo, Finland) The amplified PCR products were separated on a 2% agarose gel, bands were excised and purified by using the High Pure PCR Product Purification kit (Roche, Basel, Switzerland) Purified DNA was subcloned into pGEM T easy vector (Promega, Madison, WI, USA) following manufacturer’s instructions and recombinant plasmids were sequenced

Real-time PCR Real-time PCR was performed on a Corbett (Sidney, Aus-tralia) Rotor Gene RG 3000 TaqMan probe and primers were designed using the primer3 program Optimized amplification reactions contained 300 nm each primer,

400 nm probe, 5 mm MgCl2, 200 lm dNTPs, 1.25 Units JumpStart Taq DNA polymerase (Sigma-Aldrich Corp., St Louis, MO, USA) and 1· of the provided buffer All PCR reactions were performed with one cycle of 94C for 60 s, followed by 45 cycles of 15 s at 94C and 60 s at 60 C