a c and d viruses

... giác ABCD AB = CD , AD = BC Tứ giác ABCD là hình bình hành 1 2 1 2 giải: Xét  ABD và  CDB có: AB = CD, AD = BC (gt), cạnh DB chung  ABD =  CDB (c.c.c)  B1 = D1 , D2 = B2  AD // BC, DC ... ABCD AB//CD , AD//BC, AC cắt BD tại O a)AB = CD, AD = BC b) A = C, B = D c)OA = OC, OB = OD Bài Làm a) Xét  ABD =  CDB (g.c.g) Vì có: B1 = D1 , D2 = B2 (so le trong) và cạnh BD chung AB = CD, ... Trang 2KIểM Tra Bài cũ Bài tập: Cho hình vẽ sau, trong đó AB // CD, AD // BC, AC cắt BD tại O chứng minh: a)AB = CD, AD = BC b) A = C, B = D c)OA = OC, OB = OD GT KL Tứ giác ABCD AB//CD , AD//BC,

Ngày tải lên: 16/04/2021, 11:05

... D A B C A B C D m (2) GT Tứ giác ABCD có KL Tứ giác ABCD nội tiếp 0 B + D = 180 Hai điểm A và C chia đường tròn thành hai cung ABC và AmC, trong đó chứa góc dựng trên đoạn thẳng AC AmC ... sao c¸c tø gi¸c d íi ®©y lµ tø gi¸c néi tiÕp x B C D H2 A D C H3 O B A C D H4 ABCD NỘI TIẾP DAC=DBC xAB C       OA = AB = OC = OD Trang 134- Dấu hiệu nhận biết tứ giác nội tiếp1 Tứ giác có ... ) A B C D Trang 8C B D O Qua mục 2) ta được : Điều ngược lại: Tứ giác ABCD nội tiếp (O) => =1800. Ta sang mục 3 của bài A C  Tứ giác ABCD có =1800 thì có nội tiếp được không ? A C

Ngày tải lên: 18/04/2021, 23:43

... TGG GTG CAT CTG-3′ VEGF-C 5 ′-ACC TGC CCC ACC AAT TAC A-3′ 5 ′-GCC TCT TGT AAA GAC TGG TT-3′ VEGF-D 5 ′-GCT GTT GCA ATG AAG AGA GAPDH 5 ′-ACA GAG CCT CGC CTT TGC C-3′ 5 ′-CAT GTC GTC CCA GTT GGT ... ′-GAC AGC TAC AAG TAC GAG Table 1 Lymphangiogenic signaling-related and lymphaticspecific markers (Continued) D2-40 5 ′-GGT GCC GAA GAT GAT GTG-3′ 5 ′-CGA TGC GAA TGC CTG TTA-3 GAPDH 5 ′-GCA CCA ... ofstaining of the cells Table 1 Lymphangiogenic signaling-related and lymphatic specific markers HCACCs and the co-culture system in vitro VEGF-A 5 ′-CAC CGC CTC GGC TTG TCA CAT-3′ 5 ′-CTG CTG TCT

Ngày tải lên: 28/09/2020, 10:03

... a cysteine-rich domain at the N-terminus, a collagen-like domain, a coiled neck domain and a C-type lectin domain that is also called a carbohydrate recognition domain (CRD) Recognition of pathogens ... SP-B and SP-C Trang 8are involved in helping the spreading of surfactant across the alveolar lining and are also involved in surfactant metabolism and recycling SP-A and SP-D, on the other hand are ... O-polysaccharides and demonstrate a "smooth" phenotype Enteric bacteria that lack O-specific polysaccharides are usually nonpathogenic and rapidly cleared However, many non- Trang 22enteric

Ngày tải lên: 26/07/2023, 07:40

... objectives (Scherl et al., 2004) 3.1.3 Protected areas IUCN defines protected areas as an area of land or sea especially dedicated to the protection and maintenance of biological diversity, and ... of earth surface area For instance, the tropical and semi-waterless areas in Africa have about 30,000 species of flora; and similar to Madagascar (8,200 species), Asia tropical region including ... Habitat/Species Management Area managed mainly for conservation through management intervention; (5) Trang 19Protected Landscape or Seascape managed mainly for landscape or seascape conservation

Ngày tải lên: 02/03/2024, 14:21

... [69] Bacillussp KC201 BacKC Q59239 [71] Bacillus circulans8 Bacci8 P30920 [73] Bacillus circulans251 Bacci251 P43379 [39] Bacillus circulansA11 BacciA Q9F5W3 Unpublished Bacillus clarkii Baccl AB082929* ... transferase (Actsp), archaeal CGTase (Thcsp) and the maltogenic a-amylase (Bacst) due to its longer branch separating it from the Trang 7compact cluster of Bacillus and ThermoanaerobacterCGTases ... starch-binding domain (SBD): a-amylase, maltotetraohydrolase, maltopentaohydrolase, maltogenic a-amylase, acarviose transferase, and cyclodextrin glu-canotransferase (CGTase) Such enzymes are multidomain

Ngày tải lên: 08/03/2014, 08:20

... routines, data in a class can also be divided into characteristic interface data which should be visible, and implementation data which should be hidden Interface data are anycharacteristics which might ... bounds; and a class oftype checks that are discussed in the section onRTTI and type casts The current ideal is to have the detectable andreal inconsistency domains exactly coincide, with asfew checks ... The hardware of many machines cater for such basic data types as character and integer, and it is probable that a compiler will generate code that is optimal for any target hardware architecture

Ngày tải lên: 08/03/2014, 23:20

... 5¢-AGGAGCCTTTGGTGAGTTCAATT-AT-3¢; OGG1 forward, 5¢-CGCTATGTATGTGCCA GTGCTAAA-3¢; OGG1 reverse, 5¢-CCTTAGTCTGCGAT GTCTTAGGCT-3v; GAPDH forward, 5¢-GACAACTTTG GTATCGTGGAAGG-3¢; and GAPDH reverse, 5¢-CCAGT AGAGGCAGGGATGATGT-3¢ ... (GAPDH)] were as fol-lows: TFAM forward, 5¢-TTGCAGCCATGTGGAGGG-3¢; TFMA reverse, 5¢-TGCTTTCTTCTTTAGGCGTTT-3¢; Pol-c forward, 5¢-CACTGCAGATCACCAATCTCCTG-3¢; Pol-c reverse, 5¢-AGGAGCCTTTGGTGAGTTCAATT-AT-3¢; ... trans-criptase kit (Toyobo Co Ltd Osaka, Japan) The RNA and cDNA of each sample were assayed with the gene quant pro dna⁄ rna calculator to assess concentrations and purification cDNA samples were stored

Ngày tải lên: 14/03/2014, 23:20

... b-aryl ether cleavage activity was measured as described above Localization of b-aryl ether cleavage activity A 14-day-old culture (4 mL) of 2BW-1 cells was separated into supernatant and residue ... prepared a hyphae fraction (HP), an extracel-lular fraction (EC), a cytoplasmic fraction (CY) and a membrane fraction (M) from cultures of 2BW-1 (see Materials and methods) Enzymatic activity was ... (Nippon Sanso Co., Kawasaki, Japan) or18O-labeled water (94%18O atom; Nippon Sanso Co., Kawasaki, Japan) and incubated for 12 h at 28C After the incubation, the mixture was analysed as described above

Ngày tải lên: 17/03/2014, 03:20

... addresses cause-and-effect in cheating and performance: David J Palazzo, Young-Jin Lee, Rasil Warnakulasooriya, and David E Pritchard, Patterns, Correlates, and Reduction of Home-work Copying, ... next to a (and at a higher address) Next comes c, then d We will discuss why the addressesare the particular values that they are later Each cell is annotated with itsassociated variable and the ... Rather than taking an abstract and rule-based perspec-tive, this chapter covers the program stack and the function call protocol,which naturally give rise to these concepts A mechanistic understanding

Ngày tải lên: 19/03/2014, 14:05

... Measuring Accuracy and Dispute Impacts, assesses the accuracy and quality of data collected and maintained by the three major nationwide Consumer Reporting Agencies (CRAs): Equifax, Experian, ... towards consolidation and increased standardization of fields, formats, reporting and media increased credit report data accuracy Competition in the credit reporting sector has also been a likely ... participating nationwide CRAs Instead, the anonymized information was exchanged and matched using random transaction codes provided by Synovate to the participants The final results and data are

Ngày tải lên: 22/03/2014, 20:20

... and primers BU (5¢-CCGATATCATACTCTTCC-3¢) and BL (5¢-CC GATATCAGACCAAGTTTAC-3¢) In the same way, the zeogene was amplified from plasmid pHook (Invitrogen) using primers Z1 (5-CCGATATCGTGTTGACAATT ... was amplified by PCR from piVX plasmid (ATCC) using primers H-sup1 (5¢-GAGAAGCTTAACGTTGCCCGG ATCCGGTC-3¢) and P-sup2 (5¢-GAGCTGCAGTAGTC CTGTCGGGTTTCGCC-3¢) containing HindIII and PstI restriction ... (5-CCGATATCGTGTTGACAATT AATC-3¢) and Z2 (5¢-CCGATATCCAGACATGATAA GATAC-3¢) All primers contain an EcoRV restriction site and resulting PCR products, pBSK+D2 and zeo gene, were digested by the EcoRV restriction

Ngày tải lên: 23/03/2014, 15:21

... adult border. 6 Like Giving Candy to a Baby It’s the incentives, stupid! A girl, a bag of candy, and a toilet What financial incentives can and can’t do The giant milk necklace Cash ... average Wine Spectator rating was a paltry 71 One vintage, according to Wine Spectator, “smells barnyardy and tastes decayed.” Another had “just too much paint thinner and nail varnish character.” ... bury the idea that there’s a right way and awrong way, a smart way and a foolish way, a red way and a blue way The modern world demandsthat we all think a bit more productively, more creatively,

Ngày tải lên: 05/06/2014, 05:28

... At what time shall we this morning? Trang 23b that they saidc what they said d both a and b are correct 14 She was carrying a bag a black small plastic b small and black plastic c small black ... work d I shan’t work  a 47 "What should we do about this problem? " It is advisable a that to adopt a drastic measure b that a drastic measure is adopted c that a drastic measure be adopted ... nations c Only a little nations d Only a few nations  d 15 “How ?” “Nobody knows.” a happened the accident b did happen the accident c did the accident happen d All of them are wrong  c Trang

Ngày tải lên: 18/06/2014, 17:20

... Time Host Death Viral Latency A B C D E Zone of Stable Replication Zone of Stable Replication 3A 3B Trang 5result from inadequate viral replication causing increasedclearance and reduced host-to-host ... – when administered as live attenuated vaccines [71], adjuvant enhanced pro-tein vaccine [83], or as recombinant Env propro-teins in cell culture [64] – dramatically alter viral load, and both ... Trang 1Open AccessHypothesis Replicative Homeostasis: A fundamental mechanism mediating selective viral replication and escape mutation Richard Sallie* Address: Suite 35, 95 Monash Avenue, Nedlands,

Ngày tải lên: 18/06/2014, 22:20

... non coding sequence a CCCCUCC(UCA) UUGUCUCAA(UCA) UGACUUUAAUUUUCUCCAGGAAUGUUG(CUA) a in bold: conserved sequences; in parentheses, start and stop codons; in italic, poly U. b underlined, variation ... 5'-ACCGTCTTTCATTGCCATACG-3'; and CAT probe 5'(FAM)-TATTCACATTCTTGCCCGCCTGATGAA-(TAMRA)3' Primers and probe sequences were deter-mined with the PrimerExpress software (version 1.5; Applied Biosystem) ... of the CAT specific primers 6 s and 5 as (300 nM each) and of a CAT specific fluorogenic probe (100 nM) labeled with 6-car-boxyfluorescein (FAM) and 6-carboxytetramethylrhod-amine (TAMRA) at the

Ngày tải lên: 20/06/2014, 01:20

... programs that ad- dress business train- ing and technical assistance, and pro- vide access to credit and capital, federal contracts, and inter- Trang 20national trade tunitiesoppor-American Society ... topics such ad-as sales and ing, technical, busi- ness financing, and tips on shopping for business products and services CareerBuilder www.careerbuilder.com Offers a database of market-national ... and role of CFO, 299 and SBA programs, 263–264, 271–279 from venture capital, 248–250 CFO, see chief financial officer character licensing, see merchandise and character li-censing Chicken Delight,

Ngày tải lên: 20/06/2014, 18:20

... boundary conditions cover, among others, the periodic and the Dirichlet conditions, and have been introduced for ordinary differential equa-tions by Adje in [1] Assuming the existence of a lower and ... initial conditions or periodic boundary conditions The mono-tone iterative technique was employed in [14] for antiperiodic and nonlinear boundary conditions Lower and upper solutions and periodic ... sudden major influences, for example, an insect population sprayed with an insecticide or a financial market affected by a major terrorist attack For our purposes, we letT be a time scale (a closed

Ngày tải lên: 23/06/2014, 00:20

... according to δ13C and δ15N, (A) natural stand, all sporophores, (B) natural stand, mean and standard deviation for each genus: Ama.= Amanita, Bol = Boletus, Cant = Cantharellus, Cor = Cortinarius, ... and standard deviation for each genus: Ama = Amanita, Bol = Boletus, Cant = Cantharellus, Chal = Chalciporus, Clav = Clavulina, Cor = Cortinarius, Gom = Gomphidus, Lac = Laccaria, Lact = Lactarius, ... sporophores collected in the natural stand and in the Norway spruce plantation according to (A) total C and total N, and (B)δ13C andδ15N, Breuil forest, (all sporophores, mean and stan-dard deviation

Ngày tải lên: 07/08/2014, 16:21

... jelly-roll domain and a C- terminal b-trefoil domain The rmsd values were ˚ ˚ 2.5 A for HCR ⁄ D- SA and HCR ⁄ D and 0.5 A for HCR ⁄ D- SA and HCR ⁄ C The greater rmsd values for HCR ⁄ D- SA and HCR ⁄ D were ... solvent, and HCR ⁄ B has a loop that is more structurally analogous to those of HCR ⁄ C and HCR ⁄ D, but lacking a Trp Fig GBLs of HCR ⁄ C, HCR ⁄ D and HCR ⁄ D- SA overlaid with HCR ⁄ A and HCR ⁄ B HCR ... domains in direct contact with each other [8] Retention of function by the three individual domains (LC, HCT, and HCR) has facilitated the structure–function characterization of BoNT and tetanus...

Ngày tải lên: 22/03/2014, 15:21