... Trang 2ABSTRACT Terpenoids are a structurally diverse group of natural products All terpenoids are synthesized from C5–units isopentenyl diphosphate (IPP) and dimethylallyl diphosphate (DMAPP) ... (DMAPP) A head-to-tail addition of IPP units to DMAPP by various prenyltransferases yields prenyldiphosphates with longer hydrocarbon chains such as geranyl diphosphate (GPP, C10), farnesyl ... with a plasmid that overexpresses a suitable cis-prenyltransferase Introduction of CPT1 into the E.coli cells led to the production of a functional neryl diphosphate synthase, which catalyzes
Ngày tải lên: 23/01/2021, 11:07
... strata: context, semantics, lexico-grammar and phonology (Halliday 1994, Halliday 1978, Halliday 1985, Hasan 1993, Hasan 1995, Hasan 1996) Here, SFL claims that the relation between these strata ... lexico-grammar to establish the framework for analysis At the stratum context, SFL postulates that language has three contextual categories: field, mode and tenor (Halliday & Hasan 1989, Hasan, ... views grammar of a clause as representation and is realized by the systems of transitivity Meanwhile, interpersonal metafunction considers grammar of a clause as exchange and is realized by
Ngày tải lên: 07/12/2017, 10:25
Study of the functional design of a floating offshore breakwater
... 34representation of a mat floating breakwater is shown in figure 2.8 Figure 2.8: Mat floating breakwater A-frame floating breakwaters An A-frame is a combination of vertical walls that reflect the wave energy ... windmills have a capacity of 5 megawatt each, and are currently active The other 55windmills are under construction, and will each have a capacity of 6,15 megawatt Thorntonbank offshore wind farm will ... way themaintenance ships can stay in position, and maintenance operations are not interrupted, whileother ships take care of the transportation of goods (Zee-Creating an artificial island, that
Ngày tải lên: 27/03/2019, 08:57
Functional analysis of a nonsyndromic hearing loss-associated mutation in the transmembrane II domain of the GJC3 gene
... wavelength of 490 nm with a microplate reader (Bio-Rad 680, Bio-Rad, USA) Trang 4Statistical analysis All data were calculated and presented as mean±standard error (mean±SE) in the present study By GraphPad ... for DNA fragmentation assay (A) and analysis of MTT (B) (A) DNA was prepared for agarose gel electrophoresis as described in the Materials and Methods (B) The results showed that when the HeLa cells ... mechanism is a longer-term adaptation that increases the capacity of the ER to handle unfolded proteins by transcriptional activation of UPR target genes, including those that function as part of
Ngày tải lên: 15/01/2020, 22:05
In vivo functional analysis of a nuclear restorer PPR protein
... individual domains and residues in a PPR protein This approach takes advantage of the relatively facile, although cultivar dependent, capacity for Agrobacterium-mediated trans-formation of B napus and ... four amino acid deletion found in PPR-A and PPR-C and a non-restoring radish allele of Rfo leads to a partial loss of restoration function that correlates with a partial loss of the capacity ... four amino acids of domain 4 that are deleted in PPR-A and the non-restoring rfo allele, led to only a partial loss of restoration capacity, as measured by several different criteria The degree of
Ngày tải lên: 27/05/2020, 00:27
Isolation and functional characterization of a high affinity urea transporter from roots of Zea mays
... Trang 1R E S E A R C H A R T I C L E Open AccessIsolation and functional characterization of a high affinity urea transporter from roots of Zea mays Laura Zanin1*, Nicola Tomasi1, Corina Wirdnam2, ... Saccharo-myces cerevisiaeand Arabidopsis thaliana mutants Results Urea acquisition in maize plants To evaluate the capacity of maize roots to take up urea, a concentration dependent net-influx analysis ... physiological characterization of urea uptake in roots of intact maize plants Results indicated that at micromolar urea concentrations (up to 300μM urea), maize roots are able to take up this
Ngày tải lên: 27/05/2020, 01:07
Identification and functional characterization of a flax UDP-glycosyltransferase glucosylating secoisolariciresinol (SECO) into secoisolariciresinol monoglucoside (SMG) and diglucoside (SDG)
... followed a bell curve pattern with peak expression at 16 days after anthesis (DAA) (Figure 4A) UGT94H1 expression peaked at 8 DAA, declined at 16 DAA, and maintained a relatively stable expression afterwards ... UGT74T1 and UGT712B1 in flax seeds at 0 and 16 DAA, in leaves and in stems; H, expression of PLR at the same stages as G flax seed at two developmental stages (0 and 16 DAA) and in flax leaf and ... information was available on UGT genes that may play a role in flax SDG biosynthesis Here we report on the identification, structural and functional characterization of 5 putative UGTs potentially
Ngày tải lên: 27/05/2020, 01:35
identification and functional characterization of a novel arginine ornithine transporter a member of a cationic amino acid transporter subfamily in the trypanosoma cruzi genome
... Henriques1,5,6*, Megan P Miller3, Marcos Catanho4, Técia Maria Ulisses de Carvalho5, Marco Aurélio Krieger8, Christian M Probst8, Wanderley de Souza5,6,7, Wim Degrave4and Susan Gaye Amara2,3 Abstract Background: ... Trang 1R E S E A R C H Open AccessIdentification and functional characterization of a novel arginine/ornithine transporter, a member of a cationic amino acid transporter Cristina Henriques1,5,6*, ... trans-stimulation property of TcCAT1.1 was examined in Xenopus laevis oocytes, and the kinetic parameters of transport were analyzed in a Saccharomyces cerevisiae null mutant lacking cationic amino
Ngày tải lên: 02/11/2022, 11:34
Effects of functional decoupling of a leg in a model of stick insect walking incorporating three ipsilateral legs
... Trang 1Effects of functional decoupling of a leg in a model of stick insect walking incorporating three ipsilateral legs Tibor I Toth1& Silvia Daun1,2 1 Department of Animal Physiology, ... displays the three main antagonistic muscle pairs of a leg of the stick Figure 1 (A) Schematic illustration of a (middle) leg of the stick insect showing three antagonistic muscle pairs that are ... adult animals: M Grabowska and E God-lewska, personal communication; in 1st and 2nd instar animals: D Wetzel and J Egert, personal communica-tion) They kept them instead in a stretched, retracted
Ngày tải lên: 24/11/2022, 17:51
functional characterization of a gibberellin receptor and its application in alfalfa biomass improvement
... -GCTCTAGAATGACTGGAAGTAATGAAGTCAACC-3′ (XbaI site underlined), GoGID1121-R, 5′ -CGGGATCCACAGTTAGGGTGCACAAAG-3′ (BamHI site underlined) The PCR product was digested by XbaI/BamHI and ligated into ... phenotypic data and the mutant complementation analysis suggested that GoGID1 can act as a functional GA receptor in plants and has the same conserved function as AtGID Expression of GoGID1 in transgenic ... treated with 10 μ M GA4 for 12 h and for perform qRT-PCR analysis The data are shown as the means ± SD of biological triplicates Trang 8Figure 7 Phenotypic appearance of transgenic alfalfa and
Ngày tải lên: 04/12/2022, 10:34
assignment 2 empirical evaluation of a new website design
... this category.Data Analysis and InsightsQuantitative Data AnalysisFor an in-depth understanding of the user interactions and performances with our AI Cooking Assistant, refer to Table 10in Appendix ... typical user interactions with the AI system Each task evaluates a different functionality of the Cookery AI Chatbot, such as its ability to suggest recipes based on user preferences, manage dietary ... interaction, participants are encouraged to think aloud and express their thoughts, feelings, and questions. 3 Observation and Data Tracking:During the interaction, the Data Tracker keeps a careful
Ngày tải lên: 19/08/2024, 15:44
Functional analysis of the nuage, a unique germline organelle, in drosophila melanogaster 2
... sequences can be found in Table IV 2.1.10 Poly(A) tail test (PAT) 2.1.10.1 Rapid Amplification of cDNA Ends-PAT (RACE-PAT) 1-3 µg of DNase-treated ovarian total RNA was reverse-transcribed using ... was heat-inactivated by adding EDTA pH 8.0 to a final concentration of 2.5 mM and incubating the samples at 65°C for 10 min 2.1.8 Reverse transcription (RT) 1 µg of DNase-treated total RNA was ... Total RNA was extracted from the ovaries in accordance to the manufacturer’s instructions Extracted total RNA was reconstituted to a final concentration of approximately 2-3 μg/μl and stored at
Ngày tải lên: 14/09/2015, 08:25
Group 2 allergens from dust mite epitope mapping and functional characterization of der p 2, and identification of a paralogue of der f 2
... Special thanks goes out to Sai Mun and Souvik for always giving me timely assistance and advice in so many areas of research Also to Shruthi, who has been of great assistance for databasing, and analysis ... Tan CL, Reginald K, Chew FT (2006) Genomic organization and characterization of group allergen paralogs from Dermatophagoides farinae In: The 63th American Academy of Allergy and Immunology Annual ... from B tropicalis cDNA using primers Blo t LIC F: 5'- GACGACGACAAGATCATGTTCAAGTTTATCTGTCTC-3’ and Blot LIC R: 5'-GAGGAGAAGCCCGGTTTAATCGACAACCTCGG-3' with highly thermostable pfu polymerase The PCR...
Ngày tải lên: 15/09/2015, 17:09
Tài liệu Báo cáo Y học: Functional analysis of a small heat shock/a-crystallin protein from Artemia franciscana docx
... CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGCCCTTCCGGAGAAGA CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGTCCTTGAGGGACACA CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT ... CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTATGGAGTTGAACTAGCTGT GCGCGGATCCACCATGTCCTTGAGGGACACA CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT Length (bp/amino acids) 576/192 468/156 ... standards (Amersham-Pharmacia Biotech or BioÁRad) DNA fragments of appropriate length were ligated into the T /A vector, pCRII (Invitrogen, San Diego, CA, USA), using T4 DNA ligase overnight at...
Ngày tải lên: 22/02/2014, 04:20
Báo cáo khoa học: Functional analysis of a murine monoclonal antibody against the repetitive region of the fibronectin-binding adhesins fibronectin-binding protein A and fibronectin-binding protein B from Staphylococcus aureus pot
... FITC was measured in the FL1 channel (510–535 nm bandpass filter) Data were recorded and analyzed with flowmax software from Partec Statistical analysis of ELISA experiments Each experiment was repeated ... aureus, one of the most important Gram-positive pathogens of humans and animals, is a highly versatile bacterium capable of causing a wide spectrum of diseases, ranging from superficial skin infections ... Monoclonal antibodies against FnBRs of FnBPB A panel of mouse mAbs was produced against the recombinant repetitive region of FnBPB Analysis of mAbs binding to the recombinant FnBR indicated the...
Ngày tải lên: 06/03/2014, 22:21
Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx
... (Forward) TAAGCTACTACGTAAAGAATATATC (Reverse) GATAAGGTACCTGCACTGACACGGATGAAAGC (Forward) CATATATTCTTTACGTAGTAGCTTA (Reverse) FEBS Journal 272 (2005) 4091–4102 ª 2005 FEBS 4099 Molecular characterization ... Molecular characterization of ANKHD1 splice variant studies blast searches of VBARP revealed that this protein has homology to human ankyrin repeat and KH domain containing 1(ANKHD1) variants, and ... 5¢-CTAGACTCGAGCCTAAT TTATATTTGCTCCTTGTGC-3¢ b-Actin primers were designed as follows: forward 5¢-CTACAATGAGCTGCG TGT-3¢ and reverse 5¢-AAGGAAGGCTGGAAGAGT-3¢ Cell survival and apoptosis analysis In vivo interaction...
Ngày tải lên: 07/03/2014, 21:20
Báo cáo khoa học: Identification and functional expression of a second human b-galactoside a2,6-sialyltransferase, ST6Gal II docx
... glycoprotein a1 -Acid glycoprotein Fetuin Galb1-4GlcNAc-Ra NeuAca2-6Galb1-4GlcNAc-R NeuAca2-3Galb1-3GalNAca1-O-Ser/Thrc NeuAca2-3Galb1-3[Neu5Aca2-6]GalNAca1-O-Ser/Thrc NeuAca2-6(3)Galb1-4GlcNAc-Rc Galb1-3GalNAca1-O-Ser/Thr ... two specific primers For 6I 5¢-CGATGAATTC GTTAACGCTCATCACCATCACCATCACGGGAAA TTGGCCATGGGGT-3¢ containing a HpaI site and Back 6I 5¢-CGATGGTACCGTACTTGTTCATGCTTAGG-3¢ and subcloned into pUC19 for further ... Galb1-3GalNAca1-O-Ser/Thr Galb1-4GlcNAc-R Gala1-O-pNp GalNAca1-O-pNp GlcNAca1-O-pNp Galb1-4GlcNAcb-O-octyl Galb1-3GlcNAcb-O-octyl Galb1-3GalNAca1-O-bn Galb1-4GlcNAc Galb1-3GlcNAc LNnT: Galb1-4GlcNAcb1-3Galb1-4Glc...
Ngày tải lên: 08/03/2014, 08:20
Báo cáo khoa học: Identification and functional characterization of a novel barnacle cement protein pptx
... TSVSAGDGAFGNLAAALTLVEDTEDGLGVKTKNGGKGFSEGTAAISQTAGANGGATVKKA VSASAANGFFKNLGKATTEVKTTKDGTKVKTKTAGKGKTGGTATTIQIADANGGVSEKSL AAAAAGNGVFKNLVTALTNISTTDDITKVQTQTIGSGGTGGAATILQLADANGGAALKEV Mrcp19k Bacp19k Bicp19k 130 140 ... gold and alkylated gold, and from a quantitative amino acid analysis for glass and the formaldehyde resin (see details in supplementary Fig S3) Surface area per molecule was calculated by a assuming ... chemicals used were of the highest grade available, with most being purchased from Wako Pure Chemical Industries (Osaka, Japan) and Takara Shuzo Co (Otsu, Japan) Twofold-concentrated ASW was prepared...
Ngày tải lên: 16/03/2014, 05:20
Báo cáo khoa học: Functional importance of a conserved sequence motif in FhaC, a prototypic member of the TpsB/Omp85 superfamily ppt
... used as a template with the following primers : R450AUp (5¢-GACGAGTACACGGT GGCCGGATACAACCTCAGGA-3¢) and R450ALo (5¢-TC CTGAGGTTGTATCCGGCCACCGTGTACTCGTC-3¢); Y452AUp (5¢-ACACGGTGCGCGGAGCCAACCTCAAG ... Data Bank database under the accession number 3NJT Overlay assay Channel analysis Fha30 is a 30-kDa, secreted FHA truncate encompassing the TPS domain and first three repeats It was used as bait ... (5¢-ACACGGTGCGCGGAGCCAACCTCAAG ACGTC-3¢) and Y452ALo (5¢-GACGTCCTGAGGTTGG CTCCGGCCACCGTGT-3¢); RA+YAUp (5¢-ACACGGT GGCCGGAGCCAACCTCAGGACGTC-3¢) and RA+YA Lo (5¢-GACGTCCTGAGGTTGGCTCCGGCCACCGTG T-3¢) After mutagenesis and...
Ngày tải lên: 23/03/2014, 03:20
Báo cáo khoa học: Functional dissection of a small anaerobically induced bZIP transcription factor from tomato pdf
... TACTCGAGATGTCACCTTTAAGGCAGAG-3¢ and 5¢-ATATCCATGGAAAATTTAAACAATCCTGATG-3¢ Abz1(1–44): 5¢-TATACTCGAGATGTCACCTTTAAG GCAGAG-3¢ and 5¢-ATATCCATGGGCTTCTTCATC CTCGATCGC-3¢ Abz1(1–24): 5¢-TATACTCGAGAT ... 5¢-TATACTCGAGAT GTCACCTTTAAGGCAGAG-3¢ and 5¢-ATATCCATG GTCTCATCCATTCCTGCATAC-3¢ Abz1(45–138): 5¢TATACTCGAGATGCAGAAGCTTCTGCAAGATTT GAC-3¢ and 5¢-ATATCCATGGAAAATTTAAACAA TCCTGATG-3¢ The XhoI and NcoI sites ... N-terminal deletion, ABZ1(47–138): 5¢-TATGGATCCATGC TTCTGCAAGATTTGACAGG-3¢ and 5¢-ATATCCC GGGTTAAAATTTAAACAATCCTG-3¢ C-terminal deletion, ABZ1(1–100): 5¢-TATAGGATCCATGTCACC TTTAAGGCAGAG-3¢ and 5¢-ATACCCGGGTTATAA...
Ngày tải lên: 23/03/2014, 13:20