723 a scan chain with four flip flops

2.1.4.7 Lab - Establishing a Console Session with Tera Term - ILM

2.1.4.7 Lab - Establishing a Console Session with Tera Term - ILM

... lab, also have a USB console port In this lab, you will learn how to access a Cisco device via a direct local connection to the console port, using the terminal emulation program called Tera ... port availability on the PC and the router or switch If the PC has a serial port and a DB9-to-RJ45 cable is available, it is generally easier to connect to the router or switch using the serial ... driver can be downloaded from the following link: Trang 7mdfid=282774238&flowid=714&softwareid=282855122&release=3.1&relind=AVAILABLE&rellifecycle=&reltyp e=latest Note:

Ngày tải lên: 15/12/2017, 18:27

11 822 1
Pricing and lot sizing optimization in a two-echelon supply chain with a constrained Logit demand function

Pricing and lot sizing optimization in a two-echelon supply chain with a constrained Logit demand function

... non-linear optimization problems (Moghadam & Seyedhosseini, 2010; Hashemi, et al., 2010; Zahara & Hu, 2008; Xu et al., 2013; Jafari et al., 2013; Karimi-Nasab, et al., 2015; Bai et al., ... supplier and vendor To formulate the problem the following parameters and variables are taken into account: Parameters Variables Trang 4 208 Assumptions  The maximum willingness to pay, that each ... Pricing and lot sizing optimization in a two-echelon supply chain with a constrained Logit demand function   Yeison Díaz-Mateus a , Bibiana Forero a , Héctor López-Ospina b* and Gabriel Zambrano-Rey

Ngày tải lên: 14/05/2020, 22:32

16 26 0
A maneuverability study on container ship with four degree of freedom in shallow water

A maneuverability study on container ship with four degree of freedom in shallow water

... 3"&$$#//$&$-2 .4&$ 0$&"!%#"&"56722' 24&$ 0$&"!%#&$/"567'58792- ... ')$&!"#*+,-. -"&$$"#/"0/1$""$&&!""-2 3"&$$#//$&$-2 ... 3&##1 2 4""1&##1 5 6#& 57 89:1 ; ,) <=><? 6"@# A ,1"##### A,C

Ngày tải lên: 26/05/2020, 17:31

15 18 0
A multi-product inventory management model in a three-level supply chain with multiple members at each level

A multi-product inventory management model in a three-level supply chain with multiple members at each level

... Consider a supply chain with three suppliers, a manufacturer, and four retailers, for example In this supply chain, only one primary material is provided and the three primary materials in the manufacturer ... learning and salvage worth on an inventory model for deteriorating items with inventory-dependent demand rate and partial backlogging with capability constraints Mashud et al (2018) studied a ... is a linear function for demand and production rates, Pal et al (2012) Wang and Sarker (2006) modeled and solved a multi-level supply chain model assuming that it is not innovative algorithm based

Ngày tải lên: 27/05/2020, 03:14

12 36 0
Optimal decision problem in a three-level closed-loop supply chain with risk-averse players under demand uncertainty

Optimal decision problem in a three-level closed-loop supply chain with risk-averse players under demand uncertainty

... three-level closed-loop supply chain with risk-averse players under demand uncertainty Safoura Famil Alamdar a , Masoud Rabbani a* and Jafar Heydari a a School of Industrial Engineering, College of ... Metal Management, AER Worldwide and IBM’s Global Asset Recovery Services take the market power and act as the channel leader in the CLSC (Karakayali et al., 2007) Also, there are different coalition ... coordination of a CLSC including two rival channels, a manufacturing chain and a remanufacturing chain, through wholesale price and revenue-sharing contracts In the study of Ma & Wang (2014),

Ngày tải lên: 27/05/2020, 03:18

18 17 0
giaùo vieân nguyeãn quang töôûng giaùo aùn ñaïi soá 7 tuần 12 ngày soạn 01112009 ngày dạy 02112009 tiết 23 a mục tiêu hs biết công thức biểu diễn mối quan hệ giữa 2 đại lượng tỉ lệ thuận hs nhận b

giaùo vieân nguyeãn quang töôûng giaùo aùn ñaïi soá 7 tuần 12 ngày soạn 01112009 ngày dạy 02112009 tiết 23 a mục tiêu hs biết công thức biểu diễn mối quan hệ giữa 2 đại lượng tỉ lệ thuận hs nhận b

...  ABC, A= 900; AB = AC.Điểm K là trung điểm của BC + Chứng minh AKB = AKC.+ Từ C kẻ đường thẳng vuông góc với BC, cắt BA kéo dài tại E AKB  AKC  180 (hai góc kề bù)Vậy AKB AKC = 900 hay ... y a x  hay xy = a (a là hằng số khác 0) thì ta nói y tỉ lệ nghịch với x theo hệ số tỉ lệ a Tổng quát: y tỉ lệ nghịch với x  y a x  hay xy = a (a là hệ số tỉ lệ) HS 2: Nêu tính chất của ... thuận với nhau thì:+ Tỉ số hai giá trị tương ứng của chúng luôn không đổi + Tỉ số hai giá trị bát kỳ của hai đại lượng này bằng tỉ số hai giá trị tương ứng của đại lượng Trang 3 Tiết 24 A Mục tiêu:

Ngày tải lên: 27/04/2021, 03:29

74 9 0
TÓM tắt LUẬN văn a maneuverability study on container ship with four degree of freedom in shallow water

TÓM tắt LUẬN văn a maneuverability study on container ship with four degree of freedom in shallow water

... G#$### H I&##1 H J@""1&##1 K L& M D")) LUAN VAN CHAT LUONG download : add luanvanchat@agmail.com Trang 10 34 678 ... G , UH LUAN VAN CHAT LUONG download : add luanvanchat@agmail.com Trang 14     !"#$%&'$(!" 1223  :59 TUEe]^ o 6}w]^ S]^ âđêôơẶưẨẪàẬưÈẺẶưẼưɰẸẶưỀỂỄẾẶưả·Ì  Trang 15 3456789 ...  87  1.82 %95 3!  37 7 42893 4  %11& 1'5 3395 ' 567 8  896: LUAN VAN CHAT LUONG download : add luanvanchat@agmail.com Trang 201234 3 6 78 9 12      

Ngày tải lên: 19/10/2022, 22:20

15 2 0
ĐỀ KIỂM TRA CN 7 GIỮA KÌ 1(22 23)

ĐỀ KIỂM TRA CN 7 GIỮA KÌ 1(22 23)

... nào? A Độc canh B Luân canh C Thủy canh D Khí canh Câu 8: Đặc điểm đầu tiên của trồng trọt công nghệ cao là gì? A Ưu tiên sử dụng giống cây trồng cho năng suất cao, chất lượng tốt, thời gian sinh ... trứng của 1 loài sâu trên cây Em hãy giúp mẹ sử dụng biện pháp phù hợp để vừa loại bỏ sâu hại, vừa đảm bảo an toàn khi sử dụng rau trong bữa cơm gia đình Vì sao em lại lựa chọn biện pháp đó? Trang ... nào? A Độc canh B Luân canh C Thủy canh D Khí canh Câu 8: Đặc điểm đầu tiên của trồng trọt công nghệ cao là gì? A Ưu tiên sử dụng giống cây trồng cho năng suất cao, chất lượng tốt, thời gian sinh

Ngày tải lên: 08/11/2022, 16:59

18 6 0
Hydromagnetic convective flow past a vertical porous plate through a porous medium with suction and heat source

Hydromagnetic convective flow past a vertical porous plate through a porous medium with suction and heat source

... plate with constant suction and heat sink Sarangi and Jose [14] investigated the unsteady free convective MHD flow and mass Trang 2transfer past a vertical porous plate with variable temperature ... range of applications, Hasimoto [1] estimated the boundary layer growth on a flat plate with suction or injection Gersten and Gross [2] studied the flow and heat transfer along a plane wall with ... Daspalla, Nayagarh-752 078 (Orissa), India 3 Department of Physics, Stewart Science College, Mission Road, Cuttack-753 001 (Orissa), India Abstract This paper theoretically analyzes the unsteady

Ngày tải lên: 05/09/2013, 16:10

12 431 0
Giáo án dạy ngày 2 buổi( Tuần 7 lớp A)

Giáo án dạy ngày 2 buổi( Tuần 7 lớp A)

... nhóm cử 5 em tham gia chơi ; nhóm này đa ra 1 từ thì nhóm kia cũng đa ra 1 từ, nếu nhóm nào không đa ra đợc từ tơng ứng với nhóm kia thì sẽ thua HS còn lại làm trọng tài và khán giả Trang 10 “ Bên ... cơng ngựa mà một tay ôm cây đàn măng-đo-lin,tay kia gảy len những âm thanh rộn rã Tiếng đàn của cô mới hấp đẫn lòng ngời làm sao. _ Kết thúc : Từ đó ,lúc nào trong kí ức non nớt của Va-li-a cũng ... tuổi đợc bố mẹ đa đi xem xiếc -Diễn biến : Chơng trĩnh xiếc hôm nay tiết mục nào cũng hay , nhng Va-li-a thích nhất tiết mục cô gái xinh đẹp vừa phi ngựa vừa đánh đàn Co gái phi ngựa thât dũng

Ngày tải lên: 27/09/2013, 00:10

28 538 0
Giáo án dạy ngày 2 buổi( Tuần 7 lớp A và B)

Giáo án dạy ngày 2 buổi( Tuần 7 lớp A và B)

... tra bài cũ Cho HS viết những từ chứa các nguyên âm đôi ơ, a trong hai khổ thơ của Huy Cận tiết chính tả trớc (la tha, ma, tởng,…) ) 2.Bài mới : a Giới thiệu bài: GV nêu mục đích, yêu cầu của ... nếu là Lan, bạn sẽ về nhà nói gì để giúp em mình? 2 Nga cân nặng hơn những bạn cùng lứa tuổi cùng chiều cao nhiều Nga đang muốn thay đổi thói quen ăn vặt và uống đồ ngọt của mình Nếu là Nga bạn ... trớc học bài gì? ? Nêu nguyên nhân của cuộc khởi nghĩa Hai Bà Trng? ? Nêu kết quả của cuộc khởi nghĩa Hai Bà Trng? ? Cuộc khởi nghĩa Hai Bà Trng có ý nghĩa gì? 2/ Bài mới: GT bài: *HĐ1:Làm

Ngày tải lên: 27/09/2013, 00:10

16 493 0
The 7 Biggest Mistakes People Make with the Law of Attraction and Money

The 7 Biggest Mistakes People Make with the Law of Attraction and Money

... the abundance surrounding you Look at your home and all the possessions within it and marvel at how wealthy you really are Feel grateful for all you have, and affirm that more is on the way Also ... Mistakes People Make with the Law of Attraction and Money and How YOU Can Avoid Them A Complimentary Special Report by Valerie Dawson, Founder of The Dawson Method MoneyMagnetMeditations.com Page ... problems with the very same energy that created them in the first place In order to make lasting changes you have to change the way you operate day to day, mentally, physically and emotionally Law

Ngày tải lên: 20/10/2013, 19:15

19 556 1
Tài liệu MCSE Study Guide - Designing a Network Infrastructure with Windows 2000 Exam 70-221 ppt

Tài liệu MCSE Study Guide - Designing a Network Infrastructure with Windows 2000 Exam 70-221 ppt

... the organization Trang 24Parnell AerospaceParnell Aerospace is a design and manufacturing company that creates guidance systems foraircraft and rockets The company's manufacturing capability ... each location, you need to investigate the connectivity options available inthat area • Assess net available bandwidth and latency issues Bandwidth is the measure of the amount of data that a ... and planned upgrades and rollouts You need to become aware of any company plans to upgrade its existing applications If there is an upgrade to an existingapplication available, the company may

Ngày tải lên: 21/12/2013, 04:19

60 452 0
Tài liệu Module 7: Performing a Basic MMS Implementation pdf

Tài liệu Module 7: Performing a Basic MMS Implementation pdf

... Exchange (LDAP)-based Management Agent Microsoft Exchange (LDAP)-based Management Agent Microsoft Active Directory Management Agent Microsoft Active Directory Management Agent Generic Management ... HR database will be used during the initial population of the metadirectory ! Microsoft Exchange (LDAP)-based Management Agent (Exchange database) This management agent will operate in Association ... Metaverse Namespace Metaverse Namespace Connector Namespace Connector Namespace Connector Namespace Connector Namespace Connector Namespace Connector Namespace Connector Namespace Connector Namespace

Ngày tải lên: 21/12/2013, 19:15

12 428 0
Tài liệu Module 7: Designing a Multiple-Domain Structure pptx

Tài liệu Module 7: Designing a Multiple-Domain Structure pptx

... configuration information, and global catalog They also have automatic transitive trust relationships that allow users in each domain to gain access to available resources in all other domains in the ... create, and less administrative groups to create and maintain. ! Easier delegation of administrative authority. In a single-domain structure, you can create organizational units (OUs) as ... Lead-in... child domain can be the parent of additional child domains Domains Within a Tree Share a Single Tree Root A tree has a single root and is built as a strict hierarchy Each

Ngày tải lên: 17/01/2014, 09:20

30 295 0
Tài liệu Module 7: Creating a Security Design for Accounts pdf

Tài liệu Module 7: Creating a Security Design for Accounts pdf

... has physical access to a computer can extract NTLM and LAN Manager password hash values from the Security Accounts Manager (SAM) database and attack the hashes offline by using commonly available ... can manage an account can change the rights and permissions of the account or disable its use Anyone who can manage a password to an account can, at any time, access all of the information that ... domain service accounts Mitigate Use local accounts for services Attacker can use brute force to easily break LAN Manager password hashes Avoid Remove LAN Manager passwords from the SAM database

Ngày tải lên: 18/01/2014, 05:20

30 353 0
Tài liệu BANKING ON OPPORTUNITY: A SCAN OF THE EVOLVING FIELD OF BANK ON INITIATIVES docx

Tài liệu BANKING ON OPPORTUNITY: A SCAN OF THE EVOLVING FIELD OF BANK ON INITIATIVES docx

... Miami, Newark, Providence, San Antonio, Savannah, and Seattle.32 Campaigns that Promote Savings and Financial Access The formation of AEIs and Bank On was happening at the same time when many ... campaigns also facilitate access, through financial institution partnerships, to affordable savings accounts and other financial products There are approximately 60 state and local America Saves campaigns ... cases, as alternatives Gaps within the Financial Access Field Although a basic transactional bank account can be considered the primary point of entry into the financial mainstream, unbanked and

Ngày tải lên: 16/02/2014, 06:20

97 462 0
Tài liệu Báo cáo khoa học: Helicobacter pylori acidic stress response factor HP1286 is a YceI homolog with new binding specificity pdf

Tài liệu Báo cáo khoa học: Helicobacter pylori acidic stress response factor HP1286 is a YceI homolog with new binding specificity pdf

... twice; that is, if Ala25 of chain A is close to Asn77 of chain B, then Asn77 of chain A is close to Ala25 of chain B. AlaO–ArgND2 AsnOD1–HisNE2 Trp30 Arg42, Trp30, Arg76 Phe36 Phe142, Pro136, Asn135 ... to a Table 1 Statistics on data collection and refinement A wavelength of 0.8726 A ˚ was used Rotations of 1 were performed The Ramachan-dran plot was calculated using RAMPAGE X-ray data Cell ... primers: forward, 5¢-CACCAAACCTTATACGATTGATAAGGCA AAC-3¢; and reverse, 5¢-TTATTATTGGGCGTAAGCT TCTAG-3¢ The construct was cloned directly into the pET151 expression vector by a Directional TOPO cloning

Ngày tải lên: 16/02/2014, 14:20

10 770 0
Tài liệu Báo cáo khoa học: Anaerobic sulfatase-maturating enzyme – A mechanistic link with glycyl radical-activating enzymes? docx

Tài liệu Báo cáo khoa học: Anaerobic sulfatase-maturating enzyme – A mechanistic link with glycyl radical-activating enzymes? docx

... class of radical-AdoMet enzymes Abbreviations AdoMet, S-adenosyl- L -methionine; anSME, anaerobic sulfatase-maturating enzyme; anSMEbt, Bacteroides thetaiotaomicron anaerobic sulfatase-maturating ... Trang 1Anaerobic sulfatase-maturating enzyme – A mechanistic link with glycyl radical-activating enzymes? Alhosna Benjdia1, Sowmya Subramanian2, Je´roˆme Leprince3, Hubert Vaudry3, Michael ... more quantitative analyses will require Mo¨ssbauer studies, the analytical and absorption data are consistent with WT and M1 mutant anSMEbt enzymes being able to accommodate up to three and two

Ngày tải lên: 16/02/2014, 14:20

15 561 0
Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx

Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx

... ATAAGAATGCGGCCGCTCAGTCTGAGGTGATAACATTCCC ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGT ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGT ATAAGAATGCGGCCGCTCAGGGCTGCGTGGTCACAGAGGC ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGT ... GCGAAGCTTTTATTTGTCATCGTCATCCTTGTAGTCTTTCCCAGCCTGTTGGGCCTG ATAAGAATGCGGCCGCCTATTTCCCAGCCTGTTGGGCCTG ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTG GCGGGATCCCGTTTCCCAGCCTGTTGGGCCT AAACTGCAGAAGCTTGATTTTGAATTCTGT AAACTGCAGAAGCTTGATTTTGAATTCTGT ... GCGGGATCCCGGATGCTGGCAGCGTGGGTTGG ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT ATAAGAATGCGGCCGCTCAGCTGTCACTCAGCCGCAGCAG

Ngày tải lên: 19/02/2014, 05:20

14 517 0
w